Next Article in Journal
The Effects of Natural Insecticides on the Green Peach Aphid Myzus persicae (Sulzer) and Its Natural Enemies Propylea quatuordecimpunctata (L.) and Aphidius colemani Viereck
Previous Article in Journal
Comparative Transcriptome Analysis Reveals Different Responses in Three Developmental Stages of Mythimna loreyi to Cold Stress
Previous Article in Special Issue
Spotted Lanternflies Respond to Natural Pheromone Lures for Mate-Finding and Oviposition
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 7
10.3390/insects15070555
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression and Functional Analysis of the Smo Protein in Apis mellifera

by
Lina Guo
1,†,
Jue Wang
1,†,
Diandian Yu
1,
Yu Zhang
1,
Huiman Zhang
1 and
Yuan Guo
2,*
1
College of Animal Science, Shanxi Agricultural University, Jinzhong 030801, China
2
College of Horticulture, Shanxi Agricultural University, Taiyuan 030031, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2024, 15(7), 555; https://doi.org/10.3390/insects15070555
Submission received: 14 June 2024 / Revised: 14 July 2024 / Accepted: 19 July 2024 / Published: 22 July 2024
(This article belongs to the Collection Insect Signals)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Honeybees (Apis mellifera) rely on their olfaction for various daily activities and tasks. Smoothened (Smo) serves as a critical element in the Hedgehog pathway and is likely associated with the modulation of the olfactory capabilities of bees. This study involved the identification, localization, and functional validation of Smo. The findings establish a foundational understanding of the role of Smo in influencing the olfactory abilities of bees.

Abstract

Smoothened (Smo) is a critical component regulating the Hedgehog signaling pathway. However, whether Smo is associated with the modulation of olfactory recognition capabilities of bees remains unclear. In this study, we amplified Smo from Apis mellifera. The coding sequence of Smo was 2952 bp long, encoded 983 amino acids. Smo was most highly expressed in the antennae. Cyclopamine (200 μg/mL) significantly reduced but purmorphamine (800 μg/mL) significantly increased Smo expression (p < 0.05). OR152 and OR2 expression in the cyclopamine group significantly decreased, whereas OR152 expression in the purmorphamine group significantly increased (p < 0.05). A significant decrease in the relative values of electroantennography was observed in the cyclopamine group exposed to neral. Behavioral tests indicated a significant decrease in the attractive rates of neral, VUAA1, linalool, and methyl heptenone in the cyclopamine group. Conversely, the selection rates of linalool and methyl heptenone in the purmorphamine group significantly increased. Our findings indicate that Smo may play a role in modulating olfactory receptors in bees.

1. Introduction

The Hedgehog (Hh) signaling pathway, initially discovered in Drosophila [1], is a key regulator of embryonic development and tissue homeostasis [2]. The pathway is highly evolutionarily conserved [3], performing crucial roles in both vertebrates and invertebrates [4]. These roles include the regeneration of tissue, such as bone [5], neural tissue [6,7,8], skin, muscle [9] tissue, and the gastrointestinal mucosa [10]. Disruptions in the signal transduction of the Hh pathway can lead to the formation of tumors, such as basal cell carcinoma and neuroblastoma [11]. The immune system activates the Hh signaling pathway after injury [12,13,14].
Smoothened (Smo) is a critical component regulating the Hh signaling pathway [15]. The typical Hh pathway involves a multi-component signaling cascade, requiring a complex between Hh and the Smo receptor mediated by Patched (PTC), ultimately leading to the expression of the downstream factors Gli and cubitus interruptus (Ci) [16]. The Smo receptor, homologous to G-protein-coupled receptors, comprises a single peptide chain with seven transmembrane domains. The N-terminus is extracellular, whereas the C-terminus is intracellular, with highly conserved amino acid sequences in the transmembrane region. The serine and threonine residues at the C-terminus act as phosphorylation sites, facilitating the binding of phosphate groups during protein kinase catalysis [17]. Thus, elucidating its fundamental information and mechanism of action can provide a theoretical foundation for understanding its role in the Hh signaling pathway in Apis mellifera.
Bees depend on their olfactory system for foraging, identification of oviposition sites, communication, and reproduction [18,19]. The recognition of external odor molecules by insects is a highly intricate process involving various chemosensory proteins, with olfactory receptors (ORs) playing a pivotal role as key olfactory sensory proteins. Olfactory receptors are classified into two types, generalist and specialist. The generalist reacts to many kinds of odors and the specialist reacts to only one kind of odor, such as sex pheromone receptors [20,21].
Insect ORs can be categorized into conventional ORs and atypical ORs (Orco receptor family). Conventional ORs show low homology among different insect species, indicating high diversity, whereas the Orco receptor family exhibits high conservation across different insect species [22]. The Hh signaling pathway regulates the expression of ORs. In mammals, the Hh family member Sonic hedgehog is present in human nasal mucus and the dendrites of olfactory sensory neurons in the olfactory bulb of the rat brain [23]. A decrease in Sonic hedgehog levels in human nasal mucus is associated with olfactory loss [24,25]. Knocking down the Smo gene or inhibiting Smo expression with cyclopamine in mice affects the transport of ORs [26]. Sanchez et al. [27] demonstrated that the Hh signaling pathway also regulates the odor response of adult Drosophila olfactory neurons. However, to the best of our knowledge, there have been no reports on the functional analysis of the Smo protein in A. mellifera.
In this study, we analyzed the sequence of the Smo protein in A. mellifera, explored its expression characteristics in various tissues using quantitative reverse transcription polymerase chain reaction (qRT-PCR), observed its localization and expression in the antennae via in situ hybridization, and employed cyclopamine and purmorphamine to investigate whether the inhibition or activation of Smo activity would regulate the expression of ORs. Additionally, electroantennography (EAG) and a Y-shaped olfactometer were used for further functional validation.

2. Materials and Methods

2.1. Sample Collection

A. mellifera individuals were collected from the experimental base of the College of Animal Science at Shanxi Agricultural University. Antennae, heads (excluding antennae and proboscis), thoraxes, abdomens, legs, wings, and whole tissues of multiple worker bees were collected in quantities of 100 mg. The tissues were kept in liquid nitrogen during the isolation process and stored at −80 °C overnight for subsequent use.

2.2. Drug Feeding

A. mellifera were fed cyclopamine (APE×BIO, Houston, TX, USA) and purmorphamine (APE×BIO, Houston, TX, USA) using a drug concentration gradient of 0, 200, 500, and 800 μg/mL. Bees were captured and placed in homemade feeding boxes, with each box containing 20 individuals, and were fed for 24 and 48 h, resulting in four groups: 24 h cyclopamine, 48 h cyclopamine, 24 h purmorphamine, and 48 h purmorphamine. Next, 20 μL of the drug was transferred into 2 mL of sugar water, which was shaken thoroughly on a shaker to mix and injected into the enzyme label plate in the feeding boxes. Bees were then captured for further study. The feeding boxes were placed in an incubator (XT5107 Humidity Incubators, Ningbo, China) at 30 ± 2 °C and 65 ± 5% humidity.

2.3. Total RNA Extraction and cDNA Synthesis

For RNA extraction, we extracted RNA from whole bees for the gene identification part; we extracted RNA from different tissues of A. mellifera separately for different tissue expression; and we extracted RNA from the antennae and thorax of A. mellifera after feeding purmorphamine and cyclopamine according to the results of different tissue expression. Total RNA was extracted using TRIzol, and RNA quality was assessed via agarose gel electrophoresis. Following the instructions of the reverse transcription kit (Takara, Beijing, China), RNA was reverse transcribed into cDNA. The synthesized cDNA was stored at −20 °C for later use.

2.4. Smo Gene Amplification

Utilizing the GenBank reference sequence of A. mellifera Smo (XM_395373.6), we amplified it in three segments by designing three primers, i.e., P1, P2, and P3; nestle primers were labeled using horizontal lines. The primers were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. The PCR products were subjected to 1% agarose gel electrophoresis, and the desired fragments were purified after gel recovery. The purified fragments were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the correct sequences were submitted to GenBank (OP616714). Specific primers for qRT-PCR were then devised based on the cloned Smo gene sequence and the reference gene Arp1 (NM_001185145.1). The primer sequences are detailed in Table 1.

2.5. Expression of Smo

qRT-PCR was employed to detect the expression of Smo, OR151, OR152, and OR2 in A. mellifera (primers in Table 1). The reference gene is Arp1. RNA extraction and cDNA reverse transcription were performed according to Section 2.3. Each sample was run in triplicate. The 2−△△Ct method was used to analyze the sequences based on standard and fluorescence curves.

2.6. Localization of Smo Genes in the Antennae

The A. mellifera antennae were placed on the stage, the antennae were embedded by OCT (SAKURA, Tokyo, Japan), adhered to the surface of the carrier tray by freezing, and the thickness of the slice was about 5 μm. Then, it was fixed with 4% paraformaldehyde, washed fully with PBS, and the blocking solution was added for 1 h; the blocking solution was then shaken off, the primary antibody (Zoonbio Biotechnology Co., Ltd., Nanjing, China), which was diluted 500 times, was added, and the wet box was placed at 4 °C overnight. The negative control group was washed with PBS for 5 min × 3 times, the washing solution was shaken off, the diluted 500-fold secondary antibody was added, incubated at 25 ± 1 °C in the dark for 1 h, and then washed with PBS for 5 min × 3 times. Then, the residual liquid on the section was blotted dry with absorbent paper, the fluorescent quencher solution was added dropwise on the section, the film was covered, the coverslip was covered to avoid bubbles, and the fluorescence microscope (Leica, Wetalar, Germany) was used to take pictures and records under the blue excitation light.

2.7. EAG Recording

The test honeybees were treated with purmorphamine and cyclopamine, respectively, as outlined in Section 2.2. The groups demonstrating optimal feeding effects in terms of concentration and duration were chosen for antennal electrophysiology analysis. Standardized compounds were referenced to those reported by Claudianos et al. [28].
The antennae were carefully cut at the base and placed into EAG electrode probes (Syntech, Hilversum, The Netherlands) with a drop of Spectra 360 electrode gel (Parker Lab, Inc., Fairfield, NJ, USA). The electrodes were connected to a DC/AC amplifier (Syntech IDAC-4) and a stimulation amplifier (Syntech Combi Probe 10 ×) connected to a computer. A stimulation gas control device (Syntech CS-55) was used to pass gas over the antennae through a Pasteur pipette for 0.5 s. A stimulus flow of 40 mL/min carried the odor of the sample. The constant flow rate was 500 mL/min and the gas was filtered and humidified.
With each stimulus, 10 µL of the test solution was pipetted onto a fresh 5 × 3 cm strip of filter paper and liquid paraffin was used as the reference check. To reduce error and allow the antennae to recover, each antenna was stimulated twice with each substance at 30 s intervals. Three repetitions were conducted for each tested sample on different antennae, and the antennae were prepared immediately before use to maintain their activity. The standard compounds are listed in Table 2.
The antennal electrophysiological response for compounds was calculated as follows:
RV EAG = (Vs − Vbmean)/Vbmean
where RV EAG represents the relative EAG response value, Vs denotes the sample response value, and Vbmean is the mean response value of the control. This formula quantifies the relative alteration in antennal electrophysiological response compared to that in the control and is expressed as a ratio.

2.8. Behavioral Tests

The Y-shaped olfactometer (Nanjing Possum Instrument Co., Ltd., Nanjing, China) (stem 20 cm, arm 15 cm, forming a 75° angle) was used to investigate the behavioral responses. To ensure the accuracy of the experimental results, the entire procedure was conducted in a darkroom. Approximately 10 μL each of the sample and liquid paraffin (control) were separately applied to two filter papers measuring 3 cm in length and 1.5 cm in width, which were then placed in the odor source bottle. The gas flow rate was set at 300 mL/min. Groups with selected concentrations and durations were fed accordingly and then removed from the constant temperature and humidity chamber and placed in a darkroom. The indoor temperature was maintained at 23 ± 2 °C, and the testing period was from 8 a.m. to 4 p.m. Prior to the experiment, the gas pump was turned on for 1 min to allow the gas to pass through the olfactometer. Subsequently, the experimental honeybees were placed in the middle of the olfactometer, and their selective responses to different odors were observed and recorded.
The assessment criteria were as follows: each experimental bee’s observation time was a minimum of 10 min, and when the experimental bee entered the odor source bottle or stayed continuously in the 1/3 area of the bottle for 4 min, it was considered to have selected that substance. Samples and liquid paraffin in the odor source bottle were replaced after testing every five bees, maintaining the humidity. The experiment was repeated for five groups, with 10 bees featuring in each group. The olfactometer was reversed or replaced after testing two bees to eliminate interference. After each sample test, the odor source bottle and olfactometer were cleaned with a mixture of 75% alcohol and distilled water until dry, eliminating residual odors.

2.9. Statistical Analysis

One-way ANOVA was used to compare the gene expression of Smo in different tissues of honeybees and the differences in gene expression in the antennae and thorax of honeybees after drug feeding. t-tests were used to compare the differences in gene expression in the detection of ORs and the degree of antennal response in the EAG after drug feeding. The chi-square test was used for differences in Y-tube Olfactometer Experiments. p < 0.05 and p < 0.01 indicate statistically significant differences. The creation of statistical analysis plots was achieved using GraphPad Prism 9.5.1.

3. Results

3.1. Identification of Smo Genes

Three distinct bands, measuring 1281 bp, 1301 bp, and 1252 bp, were successfully amplified via PCR. Subsequent sequencing and assembly using DNAStar v.7.1.0 yielded the complete sequence of Smo (3511 bp). The online tool ORF finder predicted a coding sequence containing 2952 bp that encodes 983 amino acids. The obtained sequence was deposited in GenBank under the accession number OP616714.

3.2. Analysis of Differential Tissue Expression of Smo

The relative mRNA expression level of Smo in different tissues of A. mellifera was analyzed via qRT-PCR. The results showed that Smo was expressed in the head, thorax, abdomen, leg, wing, antennae and whole tissue, and the expression in antennae was significantly higher than that in other tissues (p < 0.05), followed by second higher expression in thorax and lower in head, abdomen, legs, wing and whole tissue (Figure 1).

3.3. Location of Smo

Immunofluorescence technology was used to explore the localization of Smo protein in the antennae, and a clear green fluorescence signal could be seen at the edge of the antennae in the antennal section of A. mellifera, indicating that the Smo protein was expressed in large quantities in these regions. We observed a ring of hairs at the edge of the antennae, and we speculated that the Smo might be expressed in the olfactory sensor; however, under the light microscope, we were unable to distinguish which type of olfactory sensor it was. In the blank control group, we did not add a fluorescent quencher, and we could also see that there was a clear distribution of hair-shaped sensilla at the edge of the antennae (Figure 2).

3.4. Effects of Cyclopamine and Purmorphamine on Smo Gene Expression

3.4.1. Cyclopamine

Cyclopamine, a naturally occurring steroidal alkaloid, serves as a specific small molecule inhibitor of the Hh signaling pathway. After 24 h of cyclopamine feeding, the mRNA expression of A. mellifera Smo was highly significantly reduced in the 200, 500, and 800 μg/mL groups compared with those in the control group (p < 0.01); after extending the time to 48 h, there was no significant difference in Smo expression between the 200 μg/mL groups compared with that in the control group, it was significantly higher in the 500 μg/mL group compared to the control group (p < 0.05), and the 800 μg/mL group had significantly reduced mRNA expression compared with that in the control group (p < 0.05). In terms of the inhibitory effect, the 200 μg/mL group exhibited the most pronounced inhibition effect at 24 h (Figure 3a), and, thus, 200 μg/mL was selected for further functional validation.

3.4.2. Purmorphamine

Purmorphamine is a small molecule agonist designed for the Smo protein and is fundamentally a purine derivative [29]. Activation of the Hh signaling pathway by purmorphamine leads to both upregulation and downregulation of downstream target genes, including Gli1 and ptch. Purmorphamine binds the Smo and potently activates the Hh signaling pathway. After feeding of A. mellifera with purmorphamine, the 500 μg/mL group showed an increase in Smo mRNA expression compared to that seen in the control group after 24 h, whereas the 200 μg/mL and 800 μg/mL groups demonstrated a decrease in Smo mRNA expression compared to that seen in the control group. When the duration was extended to 48 h, the Smo mRNA expression levels increased in the 200, 500, and 800 μg/mL groups compared to those in the control group. Among these, the 800 μg/mL group exhibited the most pronounced stimulating effect at both 24 and 48 h (Figure 3b). This group was selected for further experiments.

3.4.3. Regulation of OR by Smo

Based on the results of 3.2, Smo had the highest expression in the antennae of the A. mellifera, which are the olfactory organ of the honeybee and play an important role in the bee’s activities, such as foraging, so we wanted to explore whether purmorphamine and cyclopamine affects the expression of ORs. Referring to Claudianos et al.’s [28] study, we chose OR151, OR152, and OR2 to verify our conjecture. OR2 is an odor co-receptor. After inhibiting/activating Smo, the expression levels of ORs were observed. As depicted in Figure 3c, in the cyclopamine group, the expression levels of OR152 and OR2 significantly decreased (p < 0.05). In the purmorphamine group, the expression level of OR152 significantly increased (p < 0.05) (Figure 3d). Thus, we speculate that changes in OR expression may be related to changes in Smo.

3.5. EAG Recording

The 200 μg/mL cyclopamine group and 800 μg/mL purmorphamine group were selected for the EAG test. From the results of the two groups, the antennae of A. mellifera responded strongly to methylheptenone and had the strongest sensitivity to this compound. In the cyclopamine group, neral had the most significant inhibitory effect (Figure 4a); in the purmorphamine group, all five standard compounds had different degrees of agonistic effect, but there was no significant difference (Figure 4b).

3.6. Y-Tube Olfactometer Experiments

Using the same treatment groups selected for the EAG test, five standardized compounds were tested at a concentration of 500 μg/μL, with liquid paraffin at the other end of the Y-shaped olfactometer. The reaction results are shown in Figure 5. Compared to the control group, the cyclopamine group exhibited varying degrees of inhibitory effects on the five odorants. Linalool (13%), VUAA1 (28%), methyl heptenone (58%), and neral (47%) all had selection rates significantly lower than those in the control group (p < 0.05) (Table S1). Notably, VUAA1, without inhibition treatment, showed bees have the same selectivity for odorant substances as liquid paraffin; however, after cyclopamine treatment, the selection rate of liquid paraffin is higher than that of VUAA1. In the purmorphamine group, the selection rates for linalool (61%) and methyl heptenone (46%) were significantly higher than those in the control group (Table S2).

4. Discussion

In the Hh pathway, Smo serves as a mediator for transducing the Hh signal across the cellular membrane [30]. Abnormal activation of Smo usually leads to basal cell carcinoma and medulloblastoma, rendering Smo a prominent therapeutic target [31]. Presently, pharmaceutical interventions, including vismodegib, sonidegib, and glasdegib, have been developed to address cancers stemming from Smo activation [32,33]. No relevant studies of Smo on A. mellifera have been conducted yet. In Drosophila, Smo protein aggregation on the cell membrane is observed upon Hh activation. The protein undergoes phosphorylation during Hh activation, facilitated by casein kinase 1 and G protein-coupled receptor kinase 2 [34]. This phosphorylation process activates the Smo protein, initiating the Hh pathway.
Smo exhibited the highest expression in the antennae of A. mellifera. Antennae are important sensory organs in insects and are capable of sensing different odors and pheromones. In insects, pheromones (and other odorants) are received via olfactory sensory neurons (OSNs) residing in cuticular structures on the antennae named sensilla. Bees have six types of olfactory sensors in their antennae: trichoid, trichoid-grooved, placoid, basiconic, coeloconic, and ampullaceum [35]. Sensilla trichodea is the most widely distributed sensor in insect antennae [36]. In honeybees, the poreplate sensilla represent the most abundant olfactory sensillum type [22]. Sensilla type, abundance and distribution in antennae of insects depend on the chemosensory need for its behaviour [37]. Immunofluorescence analysis revealed that Smo is widely distributed in the antennae of honeybees and is localized in olfactory sensors, emphasizing the close relationship between Smo and olfaction in honeybees.
Liu et al. [38] showed that the expression of Gli 1 mRNA, Smo mRNA, and Smo protein decreased after treatment with cyclopamine and that the expression of Gli 1 mRNA, Smo, and Smo proteins was upregulated after treatment with purmorphamine. The results of the qRT-PCR experiments of 3.2 showed that Smo was expressed in all tissues of A. mellifera, suggesting that Smo plays an important role in the life activities of A. mellifera. In the present study, cyclopamine produced a significant inhibitory effect on Smo, which is consistent with the results of Zhu et al. [13], who showed that cyclopamine had different inhibitory effects on Smo, PTC, and Ci in the Hh pathway; purmorphamine significantly elevated Smo expression. Purmorphamine acts directly on Smo to regulate their activities [39].
ORs play a crucial role in olfactory signal transduction and are regulated by various transcription factors, including those involved in the Hh signaling pathway [27]. We verified whether cyclopamine and purmorphamine affected OR expression. After determining the optimal inhibitory and agonistic concentrations, we measured the OR mRNA of the ORs. We found that, after cyclopamine treatment, OR151, OR152, and OR2 showed different degrees of inhibition. After purmorphamine treatment, OR151, OR152, and OR2 also showed agonistic effects. This was positively correlated with the changes in Smo expression. Smo knockout results in a reduced behavioral response to odors in Drosophila, and Smo indirectly regulates the expression of Drosophila ORs, thereby affecting their odor sensitivity [36]. To the best of our knowledge, there have been no studies on the mechanisms by which Smo affects OR expression. Therefore, we hypothesized that OR expression may be linked to changes in Smo in A. mellifera; however, the specific mechanism of action involved remains unclear.
In the EAG test, A. mellifera exhibited the strongest response to methylheptenone. In the cyclopamine group, neral showed the most significant inhibitory effect. Previous studies indicated that the optimal ligand for OR151 is linalool; OR152 showed no significant response to linalool and nerolidol but exhibited a notable affinity for neral, myrcene, and methylheptenone [28]. This influenced our selection of these odorants, with VUAA1 being the binding ligand for OR2. The amplitude of EAG responses is influenced by various factors, such as receptor quantity, the receptor response of individual OR neurons, the density of responsive neurons, and the discharge rate of neurons involved in olfaction [40]. An increase in EAG response indicates enhanced sensitivity or selective changes in the ORs. After the use of inhibitors/exciters, A. mellifera antennae exhibited varying degrees of inhibition/excitation in odor preferences, suggesting that cyclopamine/purmorphamine-mediated regulation of Smo may activate the Smo-Hh pathway, thereby influencing the sensitivity of ORs.
Bees sustain themselves by collecting pollen and nectar from flowers. Factors such as flower color, shape, and structure affect bee collection behavior [41], and flower volatiles are one of the main factors affecting bee collection [42]. We further validated the results using a Y-shaped olfactometer. We set a uniform concentration of 500 μg/μL in the standard compound. Following the use of cyclopamine, the most notably change in selection rate, with a 46% difference before and after inhibition, was observed for linalool compared to that seen for the control. In the purmorphamine group, the most pronounced activation effect was observed for linalool, with a difference of 28%. Behavioral experiment results were inconsistent with the findings of electrophysiological performance, a phenomenon commonly observed in insect olfactory behavior studies [43]. These variations could be attributed to changes in receptor sensitivity, receptor expression, or alterations in odor-binding proteins.
In summary, in different tissues of honey, the highest mRNA expression of Smo in honeybee antennae, as well as immunofluorescent Smo localized expression in the antennae and olfactory sensors, proved that Smo is closely related to honeybee olfaction. When we fed the inhibitors and agonists, the OR and Smo changes were consistent, and the EAG and behavioral tests verified the idea that Smo does affect honeybee olfaction; however, the mechanism by which Smo regulates the OR changes that affect honeybee olfaction remains unknown. The present results provide a theoretical basis for us to investigate the mechanism of the Hh signaling pathway in regulating the olfaction of honeybees.

5. Conclusions

A. mellifera Smo is most highly expressed in the antennae, and feeding affects the expression of Smo and OR, with consequent changes occurring in bee behavior. These results suggest that changes in Smo may affect the olfactory senses of honeybees. These findings provide a basis for further studies on the link between the Hh signaling pathway and olfaction in A. mellifera.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/insects15070555/s1, Table S1: Selection of different odor substances in bees after feeding cyclopamine. Table S2: Selection of different odor substances in bees after feeding purmorphamine.

Author Contributions

Conceptualization, L.G., J.W., D.Y., Y.Z., H.Z. and Y.G.; methodology, J.W. and D.Y.; software, J.W.; formal analysis, J.W. and D.Y.; investigation, J.W., D.Y., L.G., Y.Z. and H.Z.; resources, J.W. and L.G.; data curation, J.W.; writing—original draft preparation, J.W.; writing—review and editing, J.W. and L.G.; visualization, J.W.; supervision, Y.G. and L.G.; project administration, L.G.; funding acquisition, Y.G. and L.G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by China Agriculture Research System of MOF and MARA (CARS-44-KXJ2); Shanxi Provincial Applied Basic Research Program (Youth) Project (20210302124360).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

No new data were created or analyzed in this study. Data sharing is not applicable to this article.

Acknowledgments

We thank Diandian Yu, Yu Zhang, and Huiman Zhang for their help with this experiment. We would like to thank Editage for its polishing support.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Embalabala, R.J.; Brockman, A.A.; Jurewicz, A.R.; Kong, J.A.; Ryan, K.; Guinto, C.D.; Álvarez-Buylla, A.; Chiang, C.; Ihrie, R.A. GLI3 is required for OLIG2+ progeny production in adult dorsal neural stem cells. Cells 2022, 11, 218. [Google Scholar] [CrossRef] [PubMed]
  2. Ohtsuka, T.; Kageyama, R. Dual activation of Shh and Notch signaling induces dramatic enlargement of neocortical surface area. Neurosci. Res. 2021, 176, 18–30. [Google Scholar] [CrossRef] [PubMed]
  3. Xia, R.; Xu, M.; Yang, J.; Ma, X. The role of Hedgehog and Notch signaling pathway in cancer. Mol. Biomed. 2022, 3, 44. [Google Scholar] [CrossRef]
  4. Liu, A. Proteostasis in the Hedgehog signaling pathway. Semin. Cell Dev. Biol. 2019, 93, 153–163. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, L.; Fu, X.; Ni, L.; Liu, C.; Zheng, Y.; You, H.; Li, M.; Xiu, C.; Zhang, L.; Gong, T.; et al. Hedgehog signaling controls bone homeostasis by regulating osteogenic/adipogenic fate of skeletal stem/progenitor cells in mice. J. Bone Mineral Res. 2022, 37, 559–576. [Google Scholar] [CrossRef] [PubMed]
  6. Yang, W.S.; Shen, Y.Q.; Yang, X.; Li, X.H.; Xu, S.H.; Zhao, L.B.; Li, R.; Xiong, X.; Bai, S.J.; Wu, Q.Y.; et al. MicroRNA transcriptomics analysis identifies dysregulated hedgehog signaling pathway in a mouse model of acute intracerebral hemorrhage exposed to hyperglycemia. J. Stroke Cerebrovasc. Dis. 2022, 31, 106281. [Google Scholar] [CrossRef]
  7. Wang, J.; Ware, K.; Bedolla, A.; Allgire, E.; Turcato, F.C.; Weed, M.; Sah, R.; Luo, Y. Disruption of Sonic Hedgehog signaling accelerates age-related neurogenesis decline and abolishes stroke-induced neurogenesis and leads to increased anxiety behavior in stroke mice. Transl. Stroke Res. 2022, 13, 830–844. [Google Scholar] [CrossRef] [PubMed]
  8. Ghasemi, H.; Pegah, A.; Tayebinia, H.; Khazaei, S.; Feizi, F.; Mazaheri, S.; Ghiasian, M.; Khazaei, M. The overexpression of sonic hedgehog associates with collateral development and amelioration of oxidative stress in stroke patients. J. Stroke Cerebrovasc. Dis. 2022, 31, 106408. [Google Scholar] [CrossRef]
  9. Palla, A.R.; Hilgendorf, K.I.; Yang, A.V.; Kerr, J.P.; Hinken, A.C.; Demeter, J.; Kraft, P.; Mooney, N.A.; Yucel, N.; Burns, D.M.; et al. Primary cilia on muscle stem cells are critical to maintain regenerative capacity and are lost during aging. Nat. Commun. 2022, 13, 1439. [Google Scholar] [CrossRef]
  10. Uehara, K.; Koyanagi-Aoi, M.; Koide, T.; Itoh, T.; Aoi, T. Epithelial-derived factors induce muscularis mucosa of human induced pluripotent stem cell-derived gastric organoids. Stem Cell Rep. 2022, 17, 820–834. [Google Scholar] [CrossRef]
  11. Otsuka, A.; Levesque, M.P.; Dummer, R.; Kabashima, K. Hedgehog signaling in basal cell carcinoma. J. Dermatol. Sci. 2015, 78, 95–100. [Google Scholar] [CrossRef]
  12. Sheng, M.; Lin, Y.; Xu, D.; Tian, Y.; Zhan, Y.; Li, C.; Farmer, D.G.; Kupiec-Weglinski, J.W.; Ke, B. CD47-mediated Hedgehog/SMO/GLI1 signaling promotes mesenchymal stem cell immunomodulation in mouse liver inflammation. Hepatology 2021, 74, 1560–1577. [Google Scholar] [CrossRef]
  13. Zhu, S.Q.; Zhang, Y.J.; Abbas, M.N.; Hao, X.W.; Zhao, Y.Z.; Liang, H.H.; Cui, H.J.; Yang, L.Q. Hedgehog promotes cell proliferation in the midgut of silkworm, Bombyx mori. Insect Sci. 2020, 27, 697–707. [Google Scholar] [CrossRef]
  14. Athar, M.; Li, C.; Kim, A.L.; Spiegelman, V.S.; Bickers, D.R. Sonic hedgehog signaling in basal cell nevus syndrome. Cancer Res. 2014, 74, 4967–4975. [Google Scholar] [CrossRef]
  15. Sommer, A.; Lemmon, M.A. Smoothening out the patches. Science 2018, 362, 26–27. [Google Scholar] [CrossRef]
  16. Briscoe, J.; Thérond, P.P. The mechanisms of Hedgehog signalling and its roles in development and disease. Nat. Rev. Mol. Cell Biol. 2013, 14, 416–429. [Google Scholar] [CrossRef]
  17. Akhshi, T.; Shannon, R.; Trimble, W.S. The complex web of canonical and non-canonical Hedgehog signaling. BioEssays 2022, 44, e2100183. [Google Scholar] [CrossRef]
  18. Bortolotti, L.; Costa, C. Chemical communication in the honey bee society. In Neurobiology of Chemical Communication; Mucignat-Caretta, C., Ed.; CRC Press/Taylor & Francis: Boca Raton, FL, USA, 2014. [Google Scholar]
  19. Paoli, M.; Galizia, G.C. Olfactory coding in honeybees. Cell Tissue Res. 2021, 383, 35–58. [Google Scholar] [CrossRef]
  20. Mohamed, A.A.; Retzke, T.; Das Chakraborty, S.; Fabian, B.; Hansson, B.S.; Knaden, M.; Sachse, S. Odor mixtures of opposing valence unveil inter-glomerular crosstalk in the Drosophila antennal lobe. Nat. Commun. 2019, 10, 1201. [Google Scholar] [CrossRef]
  21. Auer, T.O.; Khallaf, M.A.; Silbering, A.F.; Zappia, G.; Ellis, K.; Álvarez-Ocaña, R.; Arguello, J.R.; Hansson, B.S.; Jefferis, G.S.; Caron, S.J.; et al. Olfactory receptor and circuit evolution promote host specialization. Nature 2020, 579, 402–408. [Google Scholar] [CrossRef]
  22. Fleischer, J.; Rausch, A.; Dietze, K.; Erler, S.; Cassau, S.; Krieger, J. A small number of malebiased candidate pheromone receptors are expressed in large subsets of the olfactory sensory neurons in the antennae of drones from the European honey bee Apis mellifera. Insect Sci. 2022, 29, 749–766. [Google Scholar] [CrossRef]
  23. Gong, Q.; Chen, H.; Farbman, A.I. Olfactory sensory axon growth and branching is influenced by sonic hedgehog. Dev. Dyn. 2009, 238, 1768–1776. [Google Scholar] [CrossRef]
  24. Henkin, R.I.; Abdelmeguid, M.; Knöppel, A.B. On the mechanism of smell loss in patients with Type II congenital hyposmia. Am. J. Otolaryngol. 2016, 37, 436–441. [Google Scholar] [CrossRef]
  25. Demirci, H.; Worden, F.; Nelson, C.C.; Elner, V.M.; Kahana, A. Efficacy of Vismodegib (Erivedge™) for basal cell carcinoma involving the orbit and periocular area. Ophthalm. Plast. Reconstruct. Surg. 2015, 31, 463. [Google Scholar]
  26. Maurya, D.K.; Bohm, S.; Alenius, M. Hedgehog signaling regulates ciliary localization of mouse odorant receptors. Proc. Natl. Acad. Sci. USA 2017, 114, E9386–E9394. [Google Scholar] [CrossRef]
  27. Sanchez, G.M.; Alkhori, L.; Hatano, E.; Schultz, S.W.; Kuzhandaivel, A.; Jafari, S.; Granseth, B.; Alenius, M. Hedgehog signaling regulates the ciliary transport of odorant receptors in Drosophila. Cell Rep. 2016, 14, 464–470. [Google Scholar] [CrossRef]
  28. Claudianos, C.; Lim, J.; Young, M.; Yan, S.; Cristino, A.S.; Newcomb, R.D.; Gunasekaran, N.; Reinhard, J. Odor memories regulate olfactory receptor expression in the sensory periphery. Eur. J. Neurosci. 2014, 39, 1642–1654. [Google Scholar] [CrossRef]
  29. Wang, J.; Lu, J.; Bond, M.C.; Chen, M.; Ren, X.R.; Lyerly, H.K.; Barak, L.S.; Chen, W. Identification of select glucocorticoids as Smoothened agonists: Potential utility for regenerative medicine. Proc. Natl. Acad. Sci. USA 2010, 107, 9323–9328. [Google Scholar] [CrossRef]
  30. Radhakrishnan, A.; Rohatgi, R.; Siebold, C. Cholesterol access in cellular membranes controls Hedgehog signaling. Nat. Chem. Biol. 2020, 16, 1303–1313. [Google Scholar] [CrossRef]
  31. Yang, L.; Xie, G.; Fan, Q.; Xie, J. Activation of the hedgehog-signaling pathway in human cancer and the clinical implications. Oncogene 2010, 29, 469–481. [Google Scholar] [CrossRef]
  32. Sekulic, A.; Von Hoff, D. Hedgehog pathway inhibition. Cell 2016, 164, 831. [Google Scholar] [CrossRef]
  33. Bohl, S.R.; Bullinger, L.; Rücker, F.G. New targeted agents in acute myeloid leukemia: New hope on the rise. Int. J. Mol. Sci. 2019, 20, 1983. [Google Scholar] [CrossRef]
  34. Salaritabar, A.; Berindan-Neagoe, I.; Darvish, B.; Hadjiakhoondi, F.; Manayi, A.; Devi, K.P.; Barreca, D.; Orhan, I.E.; Süntar, I.; Farooqi, A.A.; et al. Targeting Hedgehog signaling pathway: Paving the road for cancer therapy. Pharmacol. Res. 2019, 141, 466–480. [Google Scholar] [CrossRef]
  35. Nation, J.L., Sr. Insect Physiology and Biochemistry; CRC Press: Boca Raton, FL, USA, 2022; Volume 5, p. 19. [Google Scholar]
  36. Liu, W.; Zhang, Y.; Dietrich, C.H.; Duan, Y. Comparative analysis of antennal fine structure of Goniagnathus punctifer, Stirellus yeongnamensis and Stirellus indrus (Hemiptera: Cicadellidae: Deltocephalinae). Zoomorphology 2020, 139, 461–469. [Google Scholar] [CrossRef]
  37. Fialho, M.D.C.Q.; Guss-Matiello, C.P.; Zanuncio, J.C.; Campos, L.A.O.; Serrão, J.E. A comparative study of the antennal sensilla in corbiculate bees. J. Apic. Res. 2014, 53, 392–403. [Google Scholar] [CrossRef]
  38. Liu, F.; Feng, X.X.; Zhu, S.L.; Huang, H.Y.; Chen, Y.D.; Pan, Y.F.; June, R.R.; Zheng, S.G.; Huang, J.L. Sonic hedgehog signaling pathway mediates proliferation and migration of fibroblast-like synoviocytes in rheumatoid arthritis via MAPK/ERK signaling pathway. Front. Immunol. 2018, 9, 2847. [Google Scholar] [CrossRef]
  39. Nakagawa, H.; Kataoka, M. Rigidity of protein structure revealed by incoherent neutron scattering. Biochim. Biophys. Acta 2020, 1864, 129536. [Google Scholar] [CrossRef]
  40. Jacob, V.E. Current source density analysis of electroantennogram recordings: A tool for mapping the olfactory response in an insect antenna. Front. Cell Neurosc. 2018, 12, 287. [Google Scholar] [CrossRef]
  41. Parachnowitsch, A.L.; Kessler, A. Pollinators exert natural selection on flower size and floral display in penstemon digitalis. N. Phytol. 2010, 188, 393–402. [Google Scholar] [CrossRef]
  42. Dötterl, S.; Vereecken, N.J. The chemical ecology and evolution of bee–flower interactions: A review and perspectives. Can. J. Zool. 2010, 88, 668–697. [Google Scholar] [CrossRef]
  43. Canale, A.; Benelli, G.; Germinara, G.S.; Fusini, G.; Romano, D.; Rapalini, F.; Desneux, N.; Rotundo, G.; Raspi, A.; Carpita, A. Behavioural and electrophysiological responses to overlooked female pheromone components in the olive fruit fly, Bactrocera oleae (Diptera: Tephritidae). Chemoecology 2015, 25, 147–157. [Google Scholar] [CrossRef]
Insects 15 00555 g001
Figure 1. Expression of Smo in different tissues of Apis mellifera. Note: according to one-way ANOVA, the data are shown as the Mean ± SD, and the different letters represent the level of significance (p < 0.05).
Figure 1. Expression of Smo in different tissues of Apis mellifera. Note: according to one-way ANOVA, the data are shown as the Mean ± SD, and the different letters represent the level of significance (p < 0.05).
Insects 15 00555 g001
Insects 15 00555 g002
Figure 2. Localization of Smo in antennal tissues of Apis mellifera. Note: (a,b) were blank control images; bar = 200 μm. (c,d) were fluorescent photographs taken under blue excitation light. (c): bar = 200 µm. (d): bar = 400 µm.
Figure 2. Localization of Smo in antennal tissues of Apis mellifera. Note: (a,b) were blank control images; bar = 200 μm. (c,d) were fluorescent photographs taken under blue excitation light. (c): bar = 200 µm. (d): bar = 400 µm.
Insects 15 00555 g002
Insects 15 00555 g003
Figure 3. mRNA expression after treatment with cyclopamine and purmorphamine. The mRNA expression of Smo after treatment with different concentrations of cyclopamine (a) and purmorphamine (b); 200, 500, and 800 μg/mL were compared with the control group, respectively, and, according to one-way ANOVA, the data are shown as the Mean ± SD and the different letters represent the level of significance (p < 0.05). (c) mRNA expression of ORs after 24 h of treatment with 200 μg/mL of cyclopamine; (d) mRNA expression of ORs after 48 h of treatment with 800 μg/mL of purmorphamine. (c,d): Student’s t-tests were used to compare the differences between the drug-fed group and the control group. * p < 0.05. “ns” indicates no significant difference.
Figure 3. mRNA expression after treatment with cyclopamine and purmorphamine. The mRNA expression of Smo after treatment with different concentrations of cyclopamine (a) and purmorphamine (b); 200, 500, and 800 μg/mL were compared with the control group, respectively, and, according to one-way ANOVA, the data are shown as the Mean ± SD and the different letters represent the level of significance (p < 0.05). (c) mRNA expression of ORs after 24 h of treatment with 200 μg/mL of cyclopamine; (d) mRNA expression of ORs after 48 h of treatment with 800 μg/mL of purmorphamine. (c,d): Student’s t-tests were used to compare the differences between the drug-fed group and the control group. * p < 0.05. “ns” indicates no significant difference.
Insects 15 00555 g003
Insects 15 00555 g004
Figure 4. EAG responses of Apis mellifera to different compounds after activation/inhibition of Smo. Note: (a) cyclopamine; (b) purmorphamine; 6 m is 6-methyl-5-heptene-2-one, VUAA1 is 2-((4-Ethyl-5-(pyridin-3-yl)-4H-1,2,4-triazol-3-yl) thio)-N-(4-ethylphenyl) acetamidea. A Student’s t-test was used to compare the difference in EAG between the drug-fed and control groups. * p < 0.05.
Figure 4. EAG responses of Apis mellifera to different compounds after activation/inhibition of Smo. Note: (a) cyclopamine; (b) purmorphamine; 6 m is 6-methyl-5-heptene-2-one, VUAA1 is 2-((4-Ethyl-5-(pyridin-3-yl)-4H-1,2,4-triazol-3-yl) thio)-N-(4-ethylphenyl) acetamidea. A Student’s t-test was used to compare the difference in EAG between the drug-fed and control groups. * p < 0.05.
Insects 15 00555 g004
Insects 15 00555 g005
Figure 5. Selectivity of different odorants by Apis mellifera after inhibiting/activating Smo (C = 500 μg/μL). (a) Cyclopamine; (b) Purmorphamine. Each odorant is followed by a “C” for control group; “T” for treat group. Chi-square test was used to compare the difference between the drug-fed group and the liquid paraffin group, * p < 0.05.
Figure 5. Selectivity of different odorants by Apis mellifera after inhibiting/activating Smo (C = 500 μg/μL). (a) Cyclopamine; (b) Purmorphamine. Each odorant is followed by a “C” for control group; “T” for treat group. Chi-square test was used to compare the difference between the drug-fed group and the liquid paraffin group, * p < 0.05.
Insects 15 00555 g005
Table 1. Smo primer information.
Table 1. Smo primer information.
Primer NamePrimer Sequence (5′-3′)Purpose
P1F: TCATTATTCCTAAAATTTCCCGCGTSequence amplification
F: CAAATCCCTGCAGCCCAAG
R: TGAATGAACCGCAAATCCCTG
P2F: ATTTCTAGCAAATGCTTAAAGCCTT
R: GCACCTCTACGAGTAACTAACTTTGGTA
P3F: AAACATTTAATAATGCTGGTCGATT
F: TTAATAATGCTGGTCGATTATCTATTAGT
R: TTTTATATTAAAAGTTTTTCGAAAAAGAA
SmoF: TGGTGTTTGCCACTTGTCCTqRT-PCR
R: ACCAAGCTCTGACTGCATGA
Arp1F: TGCTGCACTCGTAGTTGACAATGG
R: ACCCTGGTGGCGTGGTCTTC
OR151F: AAACACCGGAAAGAGGTATGG
R: TGCATCCAGCATACGAACAG
OR152F: CGCTCTTTTGCTCTCTGGTTCG
R: TGATCAGCAGGCCAAGCATA
OR2F: CTCGTGGGCTCCTGTTCGCTTG
R: CTGTTCCTTCGGGCTGCTCTGC
Table 2. Standard compounds used in this study.
Table 2. Standard compounds used in this study.
CompoundsCAS NumberPurity (%)Origin
Linalool78-70-6>98Macklin
Myrcene123-35-3>90Macklin
6-methyl-5-heptene-2-one (6-M)110-93-0>98Macklin
neral5392-40-5>97Macklin
2-((4-Ethyl-5-(pyridin-3-yl)-4H-1,2,4-triazol-3-yl) thio)-N-(4-ethylphenyl) acetamidea (VUAA1)525582-84-7>97.5Macklin
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, L.; Wang, J.; Yu, D.; Zhang, Y.; Zhang, H.; Guo, Y. Expression and Functional Analysis of the Smo Protein in Apis mellifera. Insects 2024, 15, 555. https://doi.org/10.3390/insects15070555

AMA Style

Guo L, Wang J, Yu D, Zhang Y, Zhang H, Guo Y. Expression and Functional Analysis of the Smo Protein in Apis mellifera. Insects. 2024; 15(7):555. https://doi.org/10.3390/insects15070555

Chicago/Turabian Style

Guo, Lina, Jue Wang, Diandian Yu, Yu Zhang, Huiman Zhang, and Yuan Guo. 2024. "Expression and Functional Analysis of the Smo Protein in Apis mellifera" Insects 15, no. 7: 555. https://doi.org/10.3390/insects15070555

APA Style

Guo, L., Wang, J., Yu, D., Zhang, Y., Zhang, H., & Guo, Y. (2024). Expression and Functional Analysis of the Smo Protein in Apis mellifera. Insects, 15(7), 555. https://doi.org/10.3390/insects15070555

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop