1. Introduction
The mosquito species
Culex pipiens is established in large parts of the world and is part of a species complex with
Culex quinquefasciatus [
1]. Within the species
Culex pipiens, there are two ecotypes,
Cx. pipiens form (f) pipiens and
Cx. pipiens f molestus, that differ in terms of their behavior, whereby the pipiens form mates above ground, is non-autogenous, diapauses in winter, and is ornithophilic, while the molestus form can mate underground, is autogenous, does not diapause, and readily also bites mammals, as reviewed in [
2]. The two ecotypes are defined by their behavioral characteristics and cannot be reliably differentiated morphologically [
3]. Microsatellites throughout the genome have been used to separate the populations. One marker, the CQ11 microsatellite, is fixed as one allele in the molestus form and a separate allele is fixed in the pipiens form, with hybrids being heterozygous, which makes it useful to identify the ecotypes [
4]. While the two ecotypes can be clearly separated in northern European countries, there is more hybridization observed between the two forms in the Mediterranean region [
2].
The
Cx. pipiens complex is an important vector of pathogens, including viruses such as the West Nile virus and Usutu virus, and protozoans such as avian malaria [
5,
6,
7]. The complex has also been shown to carry strains of
Wolbachia, an intracellular endosymbiotic bacterium that is transovarially transmitted from females to offspring.
Wolbachia can affect the reproductive success of the infected mosquitoes by cytoplasmic incompatibility (CI), a mechanism that affects the sperm in such a way that only the eggs infected with a compatible strain of
Wolbachia can be fertilized and develop normally [
8], while uninfected eggs or eggs infected by a non-compatible strain of
Wolbachia that are fertilized by sperm from an infected male will fail to develop. Despite
Wolbachia affecting the gametes of both sexes, it is only transferred to the egg from the female [
9]. In
Aedes aegypti,
Wolbachia infection has been seen to affect the vector competence, and an infection of
Ae. aegypti with specific
Wolbachia strains has been developed into new strategies to combat dengue virus infections [
10]. On the other hand, natural
Wolbachia infections affecting vectorial capacity has been an active area of research.
In all tested populations of
Cx. pipiens, infection with
Wolbachia of the
wPip strain is highly prevalent, but the proportion of mosquitoes infected differs between studies. Some studies found that all individual mosquitoes carry
Wolbachia [
11,
12]. Californian
Cx. pipiens showed close to 100% infection rate. The study also reported vertical transmission rates in laboratory strains and wild populations and found that over 98% of embryos were infected [
13]. Whether uninfected embryos were viable or not was not estimated. Other studies showed lower infection rates. In a previous Swedish study, 97% of
Cx. pipiens tested were infected by
wPip
Wolbachia [
14]. In a Russian study, underground populations of
Cx. pipiens, which are most likely
Cx. pipiens f molestus, had infection rates of as low as 70%, while outdoor populations had infection rates close to 100% [
15]. A Belarusian study also found uninfected individuals of both ecotypes, where some populations had infection rates under 50% [
16]. In German samples, about 93% of all tested
Cx. pipiens f pipiens were positive for
Wolbachia [
17]. In a study from Iran,
Wolbachia DNA was found in 87% of 260 wild-caught mosquitoes. The rate of infection in adult females ranged from 61% to 100%, and in males from 80% to 100% [
18]. Also, a Chinese study showed that infection rates differed between locations, from no
Wolbachia-infected individuals to 100% infected [
19]. This study even confirmed negative samples with a secondary PCR method to rule out false negatives [
19], showing that
Cx. pipiens populations can be uninfected.
The
Wolbachia present in
C. pipiens are all from the
wPip group. Studies of many diverse
wPip
Wolbachia show that this group is monophyletic [
20], but within the
wPip strain of
Wolbachia, there is considerable genetic diversity. The
wPip
Wolbachia group can be divided into five distinct groups
wPip I-V. Using
Cx. pipiens specimens from many parts of the world, the classification of
wPip groups was described from the sequence variation in a concatenated sequence from seven genes in the
wPip genome,
MutL, ank2,
pk1,
pk2,
GP12,
GP15, and
RepA. [
20]. While there are many recombinations between strains, these genes mostly follow the same pattern, and the
wPip type has later been implicated using restriction fragment length polymorphism (RFLP) of
ank2 and
pk1 [
21]. The ank2 and pk1 markers are in genes containing ankoryn motifs that are thought to mediate protein–protein interactions [
22]. The
wPip groups have also been observed to correlate with the mitochondrial genotype [
20], indicating that the
Wolbachia strain and mitochondria are both predominantly inherited maternally with no major contributions from horizontal transmission. The nuclear genome on the other hand did not show the same pattern and similar
wPip groups and mitochondria could be carried both by
Cx. pipiens and
Cx. quinquefasciatus [
20]. Similarly, the same
wPip group has been found in both pipiens and molestus ecotypes [
23]. A major reason for determining the
wPip group in specimens is to try to infer if there is cytoplasmic incompatibility between specimens.
Cx. pipiens specimens carrying
Wolbachia from the same
wPip group are more likely to be compatible while specimens carrying different
wPip groups are more likely to have at least partial incompatibility. However, determining the
wPip group is not enough to fully determine the CI pattern [
11,
21].
The type of
wPip
Wolbachia carried has been studied in several
Cx. pipiens populations, revealing a wide variation within and between locations. For example, in northern locations such as Moscow and Volgograd, Russia, as well as in Berlin and Hannover, Germany,
wPip II was found in the pipiens ecotype while
wPip IV was found in the molestus ecotype.
wPip I and
wPip II were found in both ecotypes in Comport, Portugal, and in Prades le Lez, France, respectively [
23]. In Morocco,
wPip I, IV, and V are all present and both
wPip I and V were found in both ecotypes [
24]. In Turkey,
wPip I and II dominated but IV was found in two locations in Northwestern Turkey. The study did not differentiate between ecotypes, but all three
wPip groups were found in both rural and urban sites [
11]. From the published results, it seems that
wPip groups (and mitochondrial genomes) are different in the two ecotypes in northern locations, whereas there is more hybridization in more southern locations [
11,
23,
24].
In addition to the CI effects the different
wPip strains may have, they can also affect the biology of the mosquito in different ways.
Cx. quinquefasciatus carrying their natural
wPipSJ
Wolbachia is less susceptible to the pathogenic action of mosquitocidal bacterial strains when compared with antibiotic-treated mosquitoes that do not carry
Wolbachia [
25]. The response to viral infections may also be affected by
wPip strains. The infection load of
Culex pipiens densovirus (CxDV), which is an insect-specific virus that is vertically transmitted in
Cx. pipiens, correlated with the
Wolbachia load. There was further difference depending on the
wPip type, where
wPip I was associated with higher viral loads than
wPip IV [
26]. In Tunisia, where both
wPip I and
wPip IV are present, areas with one
wPip type also had specific CxDV strains, indicating that they are inherited together [
27]. Whether differences between
wPip groups also can affect coinfection with other viruses has not been tested.
Since the infection rate in Cx. pipiens has differed between previous reports and some reports have suggested that Wolbachia infection rates differ between the two ecotypes, we wanted to investigate what proportion of the different mosquito populations carried Wolbachia and whether that proportion differed between the ecotypes. We analyzed the infection level of Wolbachia in Cx. pipiens mosquitoes from Sweden and Norway and compared them with mosquitoes from other locations, as well as other mosquito species. To better characterize the tested populations and see potential differences, we investigated which wPip strains infect Cx. pipiens of both ecotypes collected in different regions through sequence analysis of the Wolbachia genes ank2 and pk1.
2. Materials and Methods
Mosquito collection: Cx. pipiens f molestus mosquitoes from Sweden and Norway were collected through citizen science where people experiencing nuisance collected mosquitoes. The Swedish samples were collected in Gothenburg, Sollebrunn, Uddevalla, Malmoe and Hoorby. The Norwegian samples were collected in Drammen.
Cx. pipiens f pipiens mosquitoes from Sweden were collected with BG sentinel traps in Gothenburg (Transsafe project) and overwintering locations (Örebro) with mosquito magnet traps (Mosquito Magnet, Lancaster, PA, USA) (Simrishamn) (
Figure 1).
Aedes vexans,
Culex modestus,
Culex territans, and
Culex torrentium mosquitoes were collected in Sweden as part of a citizen science project (Fånga myggan,
https://www.sva.se/aktuellt/pressmeddelanden/fanga-myggan/, accessed on 1 August 2024) urging citizens to send mosquitoes from different parts of Sweden. Mosquitoes and extracted DNAs were also provided by collaborators for mosquitoes collected in Italy and England, and lab strains originating from England, the Netherlands, and Thailand.
Culex quinquefasciatus from Mali were collected with BG sentinel traps (Biogents, Regensburg, Germany). In total, 192 mosquitoes, including 154
Cx. pipiens, 8
Cx. quinquefasciatus, 9
Culex torrentium, 6
Culex modestus, 2
Culex territans, and 13
Aedes vexans, were tested for
Wolbachia presence by qPCR wsp amplification.
DNA extraction from mosquitoes: To assess whether Wolbachia was spread throughout the body, the mosquitos were separated into body parts including, the abdomen and thorax with the head, wings, and legs, respectively. Tissues were homogenized using a plastic pestle and DNA was extracted separately from each part using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. DNA was eluted in 200 µL.
Real-time PCR identification of Cx. pipiens ecotypes: Differentiation of
Cx. torrentium and
Cx. Pipiens, and further differentiation of
Cx. pipiens specimens to ecotype were performed as previously described [
28]. Shortly, to distinguish
Cx. torrentium, species-specific primers and probe amplifying part of the
Ace2 locus were used. To separate
Cx. pipiens f pipiens and
Cx. pipiens f molestus, primers and probes recognizing the different CQ11 alleles were used. All qPCRs were set up using Perfecta Toughmix 2x (QuantaBio, Beverly, MA, USA) and 2 µL mosquito DNA extract.
Real-time PCR detection of Wolbachia: The level of
Wolbachia infection in the abdomen and thorax was determined by qPCR, as previously described [
17]. The primers used were Wol_wsp_OSM_323(5′-TAGCGATTGAAGATATGC) and Wol_wsp_OSM_324(5′-CTAGCTTCTGAAGGATTG), each at 0.6 µM, the probe Wol_wsp_probe_OSM_324(5’/56-FAM/CACCAACAC/ZEN/CAACACCAA) was used at 0.02 µM [
17]. The PCR was set up using Perfecta Toughmix 2× (QuantaBio, Beverly, MA, USA) and 2 µL mosquito DNA extract was used. All samples were run as either duplicates or triplicates. The program was as follows: 95 °C 3 min, 95 °C 5 s, 55 °C 20 s, 72 °C 30 s, 45×.
Wolbachia levels were normalized using a dilution series of a
Cx. pipiens sample with high levels of
Wolbachia included in all qPCR runs. This ensured that the reaction was linear and not inhibited. The undiluted sample was set to a value of 1000, and this was used to create a relative quantification of
Wolbachia in all samples.
Student’s t-test was used to compare levels of detected Wolbachia in the different populations; p < 0.05 was used.
PCR for sequencing: Only abdomen samples with a clearly positive Wolbachia detection were used for sequencing.
Of the
pk1 gene, 1328 bp was amplified using the primers Wol_pk1_Wpa_0256_f(5′-CCACTACATTGCGCTATAGA) and Wol_pk1_Wpa_0256_r(5′-ACAGTAGAACTACACTCCTCCA) [
22] at 0.4 µM. PCR was performed with AmpliTaq GoldTM DNA Polymerase with Buffer I (Thermo Fisher scientific, Waltham, MA, USA) and 1 µL of DNA. The PCR program was 95 °C 10 min, 95 °C 15 s, 52 °C 30 s, 72 °C 1.5 min ×35, 72 °C 5 min, 4 °C. Around 300 to 500 bp (deletions in some strains affect the length) of the
ank2 gene was amplified with the primers: Wol_ank2_Wpa_0652_f CTTCTTCTGTGAGTGTACGT, Wol_ank2_Wpa_ 0652_r: TCCATATCGATCTACTGCGT [
22]. The products were inspected on agarose gel and sequenced using the same primers at Macrogen (Amsterdam, The Netherlands). Usable sequences were generated from 107 specimens for
ank2 and 79 specimens for
pk1. Sequences are deposited in genbank PP690552-PP690630 (
pk1) and PP797897-798003 (
ank2).
Tree construction: All usable sequences were aligned using Clustal W implemented in MEGA 11 [
29]. The method for evolutionary distance was selected by using the model selector in MEGA, showing that the Hasegawa–Kishino–Yano model should be used. Phylogenetic trees were calculated using the maximum likelihood method. The tree is drawn to scale and the evolutionary distances were computed using the Hasegawa–Kishino–Yano model [
30], and are in the units of the number of base substitutions per site. Bootstrapping to evaluate branch support was performed with 500 iterations. Phylogenies were calculated in MEGA11.
3. Results
All 154 tested
Cx. pipiens mosquitoes, regardless of the ecotype, were positive for
Wolbachia infection as tested by wsp qPCR, while no
Wolbachia was detected in
Aedes vexans,
Culex territans, or
Culex torrentium.
Wolbachia was detected in four of the six tested
Culex modestus specimens, but at a much lower abundance than seen in the
Cx. pipiens samples (
Table 1).
The abundance of
Wolbachia in each specimen was assessed in the abdomen and the rest of the body. The abundance of
Wolbachia in the abdomen was compared between populations, but no differences were significant (
Supplemental Figure S1).
To identify which strain of
Wolbachia infected the different analyzed populations,
ank2 and
pk1 genes were amplified and sequenced from all specimens. In the
ank2 sequence, there were deletion differences between the specimens, as well as SNP differences. For
ank2 (
Figure 2), all Swedish specimens, except two
Cx. pipiens f pipiens specimens from Gothenburg, grouped together with
Cx. pipiens f pipiens from Norway and the Netherlands, but were separate from specimens from the other locations. For the Swedish specimens, this marker was not differentiating between the two ecotypes. However, the Norwegian
Cx. pipiens f molestus specimens did group separately from the other specimens for this marker.
Italian and English specimens of both ecotypes grouped together with the Cx. quinquefasciatus specimens and the Cx. pipiens f. molestus from the Netherlands.
By
pk1 analysis (
Figure 3), Swedish specimens grouped according to ecotype with all
Cx. pipiens f molestus and one hybrid grouping together with the
pk1-a allele. The
Cx. pipiens f pipiens specimens formed a clade with one specimen from the Netherlands and one from Norway. This clade was not directly represented by any of the
pk1 alleles described previously [
12] but is closest to the
pk1-c allele. The English specimens as well as one of the Norwegian
Cx. pipiens f pipiens and a
Cx. pipiens f pipiens from the Netherlands all grouped with the
pk1-c allele. The Norwegian
Cx. pipiens f molestus specimens and a hybrid specimen grouped together with the
pk1-d allele. The Italian specimens as well as the
Cx. quinquefasciatus and the molestus form from the Netherlands all grouped with the
pk1-b allele.
These results show that the pipiens and the molestus ecotypes in Scandinavia carry different strains of
wPip. Specimens from England and Italy share the same strain of
wPip, regardless of ecotype. Similarly, English lab strains and lab strains from Netherlands and Thailand share the same
wPip strain. The two tested hybrids from Scandinavia, one from Drammen and one from Gothenburg, both share the
wPip type with the molestus specimens from the same locations. The results also show that Scandinavian
Cx. pipiens have different
wPip strains from specimens from England and Italy. Using the phylogenetic tree of
ank2 and
pk1, each specimen was designated to a
wPip type (
Supplementary Table S1) using the same method as Dumas et al. [
12].
wPip-I was only found in the specimens from Swedish molestus;
wPip-II was found in
Cx. pipiens f pipiens from Sweden, Norway and the Netherlands but also in both ecotypes from England.
wPip-III was found in both ecotypes from Italy and
Cx. pipiens f molestus from the Netherlands and
Cx. quinquefasciatus from Mali and Thailand. In our study,
wPip-IV was found in Norwegian
Cx. pipiens f molestus.
4. Discussion
Wolbachia of the
wPip strain was found in all
Cx. pipiens mosquitoes in our study. In the published literature, there are large variations in prevalence of
Wolbachia infection in
Cx. pipiens populations, and some studies report differences between the two ecotypes in infection prevalence. Specimens found in Africa but also in Europe that lack
Wolbachia and have a distinct mitochondrial lineage, have been proposed to be a distinct species,
Culex juppi [
31]. In this study, all
Cx. pipiens specimens carried
Wolbachia, as determined by wsp qPCR, but the abundance varied. The
Wolbachia abundance can vary greatly in
Cx. pipiens and has even been correlated to insecticide resistance [
32]. How the studies showing absence of
Wolbachia in
Cx. pipiens could be interpreted varies between studies. For some studies using conventional PCR methods, it is possible that the documented absence of the symbiont in some specimens depended on the lower sensitivity of the method. However, studies using similar methods differ, and Yang et al. [
19] even confirmed the absence with a secondary primer set, suggesting that infection with
wPip
Wolbachia may not be universal in
Cx. pipiens. It is possible that there are specific environmental factors that affect
Wolbachia presence, but our study did not identify any areas suitable to such studies.
The typing of
wPip was originally carried out dependent on a concatenated sequence of six genes,
MutL,
ank2,
pk1,
pk2,
GP12, and
GP15 [
18], and while there is evidence of recombination, these genes mostly follow the same pattern and the
wPip type has been implicated using the RFLP of
ank2 and
pk1 [
19]. In our study, we sequenced both
ank2 and
pk1 to discover local variants within the
wPip types. For
ank2, the Swedish specimens of both ecotypes grouped together, except two specimens. This might represent a less frequent allele present in parts of Sweden that was only found twice in our study.
The results from
pk1 highlighted the difference between Swedish pipiens and molestus ecotypes. Compared to
ank2, there was more diversity in the
pk1 sequence differentiating the populations further. From the
pk1 phylogenetic tree, it was possible to see further differences than the
wPip types available, and it is possible to further subdivide
Wolbachia wPip types into separate lineages. It is clear from our results that the
wPip groups are mostly dependent on
pk1 sequence [
12].
The difference in
wPip type between Scandinavian pipiens and molestus ecotypes indicates a stronger barrier against hybridization in Scandinavia compared to other locations, in line with the evidence reviewed by Haba and McBride [
2]. Furthermore, it is possible that the
wPip strains themselves may reinforce this barrier between populations with cytoplasmic incompatibility. Haba and McBride [
2] raise this possibility, but there are no documented cases of cytoplasmic incompatibility between the ecotypes. Swedish
Cx. pipiens f molestus are
wPip-I and Swedish
Cx. pipiens f pipiens are
wPip-II (special clade). In other studies,
wPip type I and II are compatible in some cases [
21]. Often, when lines of
Cx. pipiens carrying different lines of
wPip
Wolbachia are crossed, there are examples of both unidirectional incompatibility and bidirectional incompatibility, even between lines with the same
wPip type. Between
wPip types, there is more often at least unidirectional incompatibility [
21].
Although the rate of hybrids between ecotypes was low in our collections of
Cx. pipiens where both ecotypes occur, we still found some hybrids which shared the
wPip type with the
Cx. pipiens f molestus collected in the same area,
wPip-IV in Drammen and
wPip-I in Gothenburg. Thus, the
wPip types carried by the
Cx. pipiens populations are at least permissive to cross with these lines in the female. These two hybrid specimens show that hybridization can occur as a result of molestus-form females mating with pipiens-form males. Previous studies of hybridization between the ecotypes have speculated that the most common would be the opposite with molestus-form males expanding to outdoor environments and mating with pipiens-form females [
33].
Our results are compatible with the general understanding that the molestus form is spread through human trade and is separate from the local pipiens form [
2,
34]. Given the hypothesis that the molestus form is introduced in Scandinavian settings through human trade, molestus form in Norway has a different source from the populations in Sweden which are spread in several cities and smaller communities more than 300 km apart yet still share the same
wPip type.
Many studies have shown that the pipiens and molestus forms have limited geneflow between each other in northern Europe but overlap in southern Europe and Northern Africa, reviewed by Haba and McBride [
2]. In a German study, there was no geneflow detected between a lab strain of
Cx. pipiens f molestus and field-caught
Cx. pipiens f pipiens, even from the same area from which the lab strain was founded, suggesting that also in Germany there was little hybridization between the ecotypes [
35]. A study carried out in Italy characterizing 55 populations of
Cx. pipiens using CQ11 found that underground populations were homozygous for the f molestus allele of CQ11, and other populations had the molestus allele, heterozygotes and the pipiens allele in different proportions, with few rural populations only having the pipiens allele. Autogenous colonies could have both CQ11 alleles but the frequency of the molestus form increased during establishment of the colony but without reaching homozygosity [
36]. In Moroccan
Cx. Pipiens, there was no correlation between the trait of autogeny which is associated with the molestus ecotype and the CQ11 marker which has often been used as a proxy for the ecotype, meaning that there was such a substantial gene flow between the populations that the proxy of CQ11 genotype was no longer informative [
37].
Looking mostly at
Cx. pipiens outside of urban areas, microsatellite data do not identify
Cx. pipiens from northern Europe as different from southern populations [
38], while
wPip strains are clearly different in different parts of Europe [
12]. This pattern highlights the difference in hereditary pattern between
Wolbachia and mitochondria being inherited on the maternal side only and nuclear microsatellite loci that are inherited from both males and females. The difference between genetic variation in the nuclear genome of the mosquito host and the symbiont is thought to be explained by a selective sweep introducing specific variants of the
Wolbachia symbiont [
31].
With a growing concern for diseases spread by Cx. pipiens, such as West Nile fever and Usutu, also in northern Europe, the differences between the urban Cx. pipiens f molestus ecotype and the more rural Cx. pipiens f pipiens are of interest. This study used Wolbachia wPip group to show that different populations of Cx. pipiens are infected by different Wolbachia and likely do not intermix to any large degree. These results further show that different populations of Cx. pipiens f molestus most likely have different origins and are dependent on human transports.