Next Article in Journal
Resolving the Taxonomy of Mountain Syrphidae (Diptera) in the Iberian Peninsula: The Species Group of Cheilosia melanura Becker, 1894
Previous Article in Journal
Slit in a Nest Site Influences the Nest Site Selection in Cavity Nesting Ant Colonies
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 9
10.3390/insects15090639
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

European Culex pipiens Populations Carry Different Strains of Wolbachia pipientis

by
Tobias Lilja
1,*,
Anders Lindström
1,
Luis M. Hernández-Triana
2,
Marco Di Luca
3 and
Olivia Wesula Lwande
4
1
Department of Microbiology, Swedish Veterinary Agency, 751 89 Uppsala, Sweden
2
Vector-Borne Diseases Research Group, Virology Department, Animal and Plant Health Agency (APHA), Addlestone KT15 3NB, UK
3
Department of Infectious Diseases, Istituto Superiore di Sanità, 00161 Rome, Italy
4
Department of Clinical Microbiology, Umeå University, 901 85 Umeå, Sweden
*
Author to whom correspondence should be addressed.
Insects 2024, 15(9), 639; https://doi.org/10.3390/insects15090639
Submission received: 24 July 2024 / Revised: 20 August 2024 / Accepted: 22 August 2024 / Published: 26 August 2024
(This article belongs to the Section Insect Molecular Biology and Genomics)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

The mosquito species Culex pipiens, has two ecotypes, pipiens and molestus. The two forms differ in mating behavior and how they manage overwintering, with the molestus form thriving in closed indoor surroundings but without an ability to manage cold winter conditions, and the pipiens form that requiring open spaces for mating and going into diapause during winter. Both ecotypes are important vectors for mosquito-borne viruses. Cx. pipiens mosquitoes often carry endosymbiotic Wolbachia bacteria that are transmitted from the mother to the egg, but this varies frequency of occurrence. The Wolbachia endosymbiont affects the reproductive success of mosquitoes so that only eggs infected with a compatible Wolbachia can be fertilized by an infected male. In artificially infected Aedes mosquitoes, Wolbachia affects whether the mosquito can transmit a virus though bites. We studied how Cx. pipiens mosquitoes from Sweden carried Wolbachia and compared them to mosquitoes from other European countries, and found that all tested Cx. pipiens mosquitoes carried Wolbachia. We characterized the Wolbachia from these mosquitoes and found that Cx. pipiens of the two ecotypes carry different strains of Wolbachia in Sweden and Norway but not in sampled mosquitoes from Italy or England. This highlights the differences between the two ecotypes in northern Europe.

Abstract

The mosquito Culex pipiens occurs in two ecotypes differing in their mating and overwintering behavior: pipiens mate in open environments and diapause, and molestus also mate in small spaces and is active throughout the year. Cx. pipiens carry Wolbachia endosymbionts of the wPip strain, but the frequency of infection differs between studied populations. Wolbachia infection affects the host reproductive success through cytoplasmic incompatibility. wPip Wolbachia is divided into five types, wPip I–V. The type of wPip carried varies among Cx. pipiens populations. In northern European locations different wPip types are found in the two ecotypes, whereas in southern locations, they often carry the same type, indicating differences in hybridization between ecotypes. In this study, Cx. pipiens specimens of both ecotypes were collected from Sweden and compared to specimens from Norway, England, Italy, and the Netherlands, as well as Cx. quinquefasciatus from Mali and Thailand. The abundance varied, but all specimens were infected by Wolbachia, while the tested specimens of other mosquito species were often uninfected. The wPip strains were determined through the sequence analysis of Wolbachia genes ank2 and pk1, showing that Cx. pipiens ecotypes in Scandinavia carry different wPip strains. The observed differences in wPip strains indicate that hybridization is not frequent and may contribute to barriers against hybridization of the ecotypes in Sweden and Norway.

1. Introduction

The mosquito species Culex pipiens is established in large parts of the world and is part of a species complex with Culex quinquefasciatus [1]. Within the species Culex pipiens, there are two ecotypes, Cx. pipiens form (f) pipiens and Cx. pipiens f molestus, that differ in terms of their behavior, whereby the pipiens form mates above ground, is non-autogenous, diapauses in winter, and is ornithophilic, while the molestus form can mate underground, is autogenous, does not diapause, and readily also bites mammals, as reviewed in [2]. The two ecotypes are defined by their behavioral characteristics and cannot be reliably differentiated morphologically [3]. Microsatellites throughout the genome have been used to separate the populations. One marker, the CQ11 microsatellite, is fixed as one allele in the molestus form and a separate allele is fixed in the pipiens form, with hybrids being heterozygous, which makes it useful to identify the ecotypes [4]. While the two ecotypes can be clearly separated in northern European countries, there is more hybridization observed between the two forms in the Mediterranean region [2].
The Cx. pipiens complex is an important vector of pathogens, including viruses such as the West Nile virus and Usutu virus, and protozoans such as avian malaria [5,6,7]. The complex has also been shown to carry strains of Wolbachia, an intracellular endosymbiotic bacterium that is transovarially transmitted from females to offspring. Wolbachia can affect the reproductive success of the infected mosquitoes by cytoplasmic incompatibility (CI), a mechanism that affects the sperm in such a way that only the eggs infected with a compatible strain of Wolbachia can be fertilized and develop normally [8], while uninfected eggs or eggs infected by a non-compatible strain of Wolbachia that are fertilized by sperm from an infected male will fail to develop. Despite Wolbachia affecting the gametes of both sexes, it is only transferred to the egg from the female [9]. In Aedes aegypti, Wolbachia infection has been seen to affect the vector competence, and an infection of Ae. aegypti with specific Wolbachia strains has been developed into new strategies to combat dengue virus infections [10]. On the other hand, natural Wolbachia infections affecting vectorial capacity has been an active area of research.
In all tested populations of Cx. pipiens, infection with Wolbachia of the wPip strain is highly prevalent, but the proportion of mosquitoes infected differs between studies. Some studies found that all individual mosquitoes carry Wolbachia [11,12]. Californian Cx. pipiens showed close to 100% infection rate. The study also reported vertical transmission rates in laboratory strains and wild populations and found that over 98% of embryos were infected [13]. Whether uninfected embryos were viable or not was not estimated. Other studies showed lower infection rates. In a previous Swedish study, 97% of Cx. pipiens tested were infected by wPip Wolbachia [14]. In a Russian study, underground populations of Cx. pipiens, which are most likely Cx. pipiens f molestus, had infection rates of as low as 70%, while outdoor populations had infection rates close to 100% [15]. A Belarusian study also found uninfected individuals of both ecotypes, where some populations had infection rates under 50% [16]. In German samples, about 93% of all tested Cx. pipiens f pipiens were positive for Wolbachia [17]. In a study from Iran, Wolbachia DNA was found in 87% of 260 wild-caught mosquitoes. The rate of infection in adult females ranged from 61% to 100%, and in males from 80% to 100% [18]. Also, a Chinese study showed that infection rates differed between locations, from no Wolbachia-infected individuals to 100% infected [19]. This study even confirmed negative samples with a secondary PCR method to rule out false negatives [19], showing that Cx. pipiens populations can be uninfected.
The Wolbachia present in C. pipiens are all from the wPip group. Studies of many diverse wPip Wolbachia show that this group is monophyletic [20], but within the wPip strain of Wolbachia, there is considerable genetic diversity. The wPip Wolbachia group can be divided into five distinct groups wPip I-V. Using Cx. pipiens specimens from many parts of the world, the classification of wPip groups was described from the sequence variation in a concatenated sequence from seven genes in the wPip genome, MutL, ank2, pk1, pk2, GP12, GP15, and RepA. [20]. While there are many recombinations between strains, these genes mostly follow the same pattern, and the wPip type has later been implicated using restriction fragment length polymorphism (RFLP) of ank2 and pk1 [21]. The ank2 and pk1 markers are in genes containing ankoryn motifs that are thought to mediate protein–protein interactions [22]. The wPip groups have also been observed to correlate with the mitochondrial genotype [20], indicating that the Wolbachia strain and mitochondria are both predominantly inherited maternally with no major contributions from horizontal transmission. The nuclear genome on the other hand did not show the same pattern and similar wPip groups and mitochondria could be carried both by Cx. pipiens and Cx. quinquefasciatus [20]. Similarly, the same wPip group has been found in both pipiens and molestus ecotypes [23]. A major reason for determining the wPip group in specimens is to try to infer if there is cytoplasmic incompatibility between specimens. Cx. pipiens specimens carrying Wolbachia from the same wPip group are more likely to be compatible while specimens carrying different wPip groups are more likely to have at least partial incompatibility. However, determining the wPip group is not enough to fully determine the CI pattern [11,21].
The type of wPip Wolbachia carried has been studied in several Cx. pipiens populations, revealing a wide variation within and between locations. For example, in northern locations such as Moscow and Volgograd, Russia, as well as in Berlin and Hannover, Germany, wPip II was found in the pipiens ecotype while wPip IV was found in the molestus ecotype. wPip I and wPip II were found in both ecotypes in Comport, Portugal, and in Prades le Lez, France, respectively [23]. In Morocco, wPip I, IV, and V are all present and both wPip I and V were found in both ecotypes [24]. In Turkey, wPip I and II dominated but IV was found in two locations in Northwestern Turkey. The study did not differentiate between ecotypes, but all three wPip groups were found in both rural and urban sites [11]. From the published results, it seems that wPip groups (and mitochondrial genomes) are different in the two ecotypes in northern locations, whereas there is more hybridization in more southern locations [11,23,24].
In addition to the CI effects the different wPip strains may have, they can also affect the biology of the mosquito in different ways. Cx. quinquefasciatus carrying their natural wPipSJ Wolbachia is less susceptible to the pathogenic action of mosquitocidal bacterial strains when compared with antibiotic-treated mosquitoes that do not carry Wolbachia [25]. The response to viral infections may also be affected by wPip strains. The infection load of Culex pipiens densovirus (CxDV), which is an insect-specific virus that is vertically transmitted in Cx. pipiens, correlated with the Wolbachia load. There was further difference depending on the wPip type, where wPip I was associated with higher viral loads than wPip IV [26]. In Tunisia, where both wPip I and wPip IV are present, areas with one wPip type also had specific CxDV strains, indicating that they are inherited together [27]. Whether differences between wPip groups also can affect coinfection with other viruses has not been tested.
Since the infection rate in Cx. pipiens has differed between previous reports and some reports have suggested that Wolbachia infection rates differ between the two ecotypes, we wanted to investigate what proportion of the different mosquito populations carried Wolbachia and whether that proportion differed between the ecotypes. We analyzed the infection level of Wolbachia in Cx. pipiens mosquitoes from Sweden and Norway and compared them with mosquitoes from other locations, as well as other mosquito species. To better characterize the tested populations and see potential differences, we investigated which wPip strains infect Cx. pipiens of both ecotypes collected in different regions through sequence analysis of the Wolbachia genes ank2 and pk1.

2. Materials and Methods

Mosquito collection: Cx. pipiens f molestus mosquitoes from Sweden and Norway were collected through citizen science where people experiencing nuisance collected mosquitoes. The Swedish samples were collected in Gothenburg, Sollebrunn, Uddevalla, Malmoe and Hoorby. The Norwegian samples were collected in Drammen. Cx. pipiens f pipiens mosquitoes from Sweden were collected with BG sentinel traps in Gothenburg (Transsafe project) and overwintering locations (Örebro) with mosquito magnet traps (Mosquito Magnet, Lancaster, PA, USA) (Simrishamn) (Figure 1). Aedes vexans, Culex modestus, Culex territans, and Culex torrentium mosquitoes were collected in Sweden as part of a citizen science project (Fånga myggan, https://www.sva.se/aktuellt/pressmeddelanden/fanga-myggan/, accessed on 1 August 2024) urging citizens to send mosquitoes from different parts of Sweden. Mosquitoes and extracted DNAs were also provided by collaborators for mosquitoes collected in Italy and England, and lab strains originating from England, the Netherlands, and Thailand. Culex quinquefasciatus from Mali were collected with BG sentinel traps (Biogents, Regensburg, Germany). In total, 192 mosquitoes, including 154 Cx. pipiens, 8 Cx. quinquefasciatus, 9 Culex torrentium, 6 Culex modestus, 2 Culex territans, and 13 Aedes vexans, were tested for Wolbachia presence by qPCR wsp amplification.
DNA extraction from mosquitoes: To assess whether Wolbachia was spread throughout the body, the mosquitos were separated into body parts including, the abdomen and thorax with the head, wings, and legs, respectively. Tissues were homogenized using a plastic pestle and DNA was extracted separately from each part using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. DNA was eluted in 200 µL.
Real-time PCR identification of Cx. pipiens ecotypes: Differentiation of Cx. torrentium and Cx. Pipiens, and further differentiation of Cx. pipiens specimens to ecotype were performed as previously described [28]. Shortly, to distinguish Cx. torrentium, species-specific primers and probe amplifying part of the Ace2 locus were used. To separate Cx. pipiens f pipiens and Cx. pipiens f molestus, primers and probes recognizing the different CQ11 alleles were used. All qPCRs were set up using Perfecta Toughmix 2x (QuantaBio, Beverly, MA, USA) and 2 µL mosquito DNA extract.
Real-time PCR detection of Wolbachia: The level of Wolbachia infection in the abdomen and thorax was determined by qPCR, as previously described [17]. The primers used were Wol_wsp_OSM_323(5′-TAGCGATTGAAGATATGC) and Wol_wsp_OSM_324(5′-CTAGCTTCTGAAGGATTG), each at 0.6 µM, the probe Wol_wsp_probe_OSM_324(5’/56-FAM/CACCAACAC/ZEN/CAACACCAA) was used at 0.02 µM [17]. The PCR was set up using Perfecta Toughmix 2× (QuantaBio, Beverly, MA, USA) and 2 µL mosquito DNA extract was used. All samples were run as either duplicates or triplicates. The program was as follows: 95 °C 3 min, 95 °C 5 s, 55 °C 20 s, 72 °C 30 s, 45×. Wolbachia levels were normalized using a dilution series of a Cx. pipiens sample with high levels of Wolbachia included in all qPCR runs. This ensured that the reaction was linear and not inhibited. The undiluted sample was set to a value of 1000, and this was used to create a relative quantification of Wolbachia in all samples.
Student’s t-test was used to compare levels of detected Wolbachia in the different populations; p < 0.05 was used.
PCR for sequencing: Only abdomen samples with a clearly positive Wolbachia detection were used for sequencing.
Of the pk1 gene, 1328 bp was amplified using the primers Wol_pk1_Wpa_0256_f(5′-CCACTACATTGCGCTATAGA) and Wol_pk1_Wpa_0256_r(5′-ACAGTAGAACTACACTCCTCCA) [22] at 0.4 µM. PCR was performed with AmpliTaq GoldTM DNA Polymerase with Buffer I (Thermo Fisher scientific, Waltham, MA, USA) and 1 µL of DNA. The PCR program was 95 °C 10 min, 95 °C 15 s, 52 °C 30 s, 72 °C 1.5 min ×35, 72 °C 5 min, 4 °C. Around 300 to 500 bp (deletions in some strains affect the length) of the ank2 gene was amplified with the primers: Wol_ank2_Wpa_0652_f CTTCTTCTGTGAGTGTACGT, Wol_ank2_Wpa_ 0652_r: TCCATATCGATCTACTGCGT [22]. The products were inspected on agarose gel and sequenced using the same primers at Macrogen (Amsterdam, The Netherlands). Usable sequences were generated from 107 specimens for ank2 and 79 specimens for pk1. Sequences are deposited in genbank PP690552-PP690630 (pk1) and PP797897-798003 (ank2).
Tree construction: All usable sequences were aligned using Clustal W implemented in MEGA 11 [29]. The method for evolutionary distance was selected by using the model selector in MEGA, showing that the Hasegawa–Kishino–Yano model should be used. Phylogenetic trees were calculated using the maximum likelihood method. The tree is drawn to scale and the evolutionary distances were computed using the Hasegawa–Kishino–Yano model [30], and are in the units of the number of base substitutions per site. Bootstrapping to evaluate branch support was performed with 500 iterations. Phylogenies were calculated in MEGA11.

3. Results

All 154 tested Cx. pipiens mosquitoes, regardless of the ecotype, were positive for Wolbachia infection as tested by wsp qPCR, while no Wolbachia was detected in Aedes vexans, Culex territans, or Culex torrentium. Wolbachia was detected in four of the six tested Culex modestus specimens, but at a much lower abundance than seen in the Cx. pipiens samples (Table 1).
The abundance of Wolbachia in each specimen was assessed in the abdomen and the rest of the body. The abundance of Wolbachia in the abdomen was compared between populations, but no differences were significant (Supplemental Figure S1).
To identify which strain of Wolbachia infected the different analyzed populations, ank2 and pk1 genes were amplified and sequenced from all specimens. In the ank2 sequence, there were deletion differences between the specimens, as well as SNP differences. For ank2 (Figure 2), all Swedish specimens, except two Cx. pipiens f pipiens specimens from Gothenburg, grouped together with Cx. pipiens f pipiens from Norway and the Netherlands, but were separate from specimens from the other locations. For the Swedish specimens, this marker was not differentiating between the two ecotypes. However, the Norwegian Cx. pipiens f molestus specimens did group separately from the other specimens for this marker.
Italian and English specimens of both ecotypes grouped together with the Cx. quinquefasciatus specimens and the Cx. pipiens f. molestus from the Netherlands.
By pk1 analysis (Figure 3), Swedish specimens grouped according to ecotype with all Cx. pipiens f molestus and one hybrid grouping together with the pk1-a allele. The Cx. pipiens f pipiens specimens formed a clade with one specimen from the Netherlands and one from Norway. This clade was not directly represented by any of the pk1 alleles described previously [12] but is closest to the pk1-c allele. The English specimens as well as one of the Norwegian Cx. pipiens f pipiens and a Cx. pipiens f pipiens from the Netherlands all grouped with the pk1-c allele. The Norwegian Cx. pipiens f molestus specimens and a hybrid specimen grouped together with the pk1-d allele. The Italian specimens as well as the Cx. quinquefasciatus and the molestus form from the Netherlands all grouped with the pk1-b allele.
These results show that the pipiens and the molestus ecotypes in Scandinavia carry different strains of wPip. Specimens from England and Italy share the same strain of wPip, regardless of ecotype. Similarly, English lab strains and lab strains from Netherlands and Thailand share the same wPip strain. The two tested hybrids from Scandinavia, one from Drammen and one from Gothenburg, both share the wPip type with the molestus specimens from the same locations. The results also show that Scandinavian Cx. pipiens have different wPip strains from specimens from England and Italy. Using the phylogenetic tree of ank2 and pk1, each specimen was designated to a wPip type (Supplementary Table S1) using the same method as Dumas et al. [12]. wPip-I was only found in the specimens from Swedish molestus; wPip-II was found in Cx. pipiens f pipiens from Sweden, Norway and the Netherlands but also in both ecotypes from England. wPip-III was found in both ecotypes from Italy and Cx. pipiens f molestus from the Netherlands and Cx. quinquefasciatus from Mali and Thailand. In our study, wPip-IV was found in Norwegian Cx. pipiens f molestus.

4. Discussion

Wolbachia of the wPip strain was found in all Cx. pipiens mosquitoes in our study. In the published literature, there are large variations in prevalence of Wolbachia infection in Cx. pipiens populations, and some studies report differences between the two ecotypes in infection prevalence. Specimens found in Africa but also in Europe that lack Wolbachia and have a distinct mitochondrial lineage, have been proposed to be a distinct species, Culex juppi [31]. In this study, all Cx. pipiens specimens carried Wolbachia, as determined by wsp qPCR, but the abundance varied. The Wolbachia abundance can vary greatly in Cx. pipiens and has even been correlated to insecticide resistance [32]. How the studies showing absence of Wolbachia in Cx. pipiens could be interpreted varies between studies. For some studies using conventional PCR methods, it is possible that the documented absence of the symbiont in some specimens depended on the lower sensitivity of the method. However, studies using similar methods differ, and Yang et al. [19] even confirmed the absence with a secondary primer set, suggesting that infection with wPip Wolbachia may not be universal in Cx. pipiens. It is possible that there are specific environmental factors that affect Wolbachia presence, but our study did not identify any areas suitable to such studies.
The typing of wPip was originally carried out dependent on a concatenated sequence of six genes, MutL, ank2, pk1, pk2, GP12, and GP15 [18], and while there is evidence of recombination, these genes mostly follow the same pattern and the wPip type has been implicated using the RFLP of ank2 and pk1 [19]. In our study, we sequenced both ank2 and pk1 to discover local variants within the wPip types. For ank2, the Swedish specimens of both ecotypes grouped together, except two specimens. This might represent a less frequent allele present in parts of Sweden that was only found twice in our study.
The results from pk1 highlighted the difference between Swedish pipiens and molestus ecotypes. Compared to ank2, there was more diversity in the pk1 sequence differentiating the populations further. From the pk1 phylogenetic tree, it was possible to see further differences than the wPip types available, and it is possible to further subdivide Wolbachia wPip types into separate lineages. It is clear from our results that the wPip groups are mostly dependent on pk1 sequence [12].
The difference in wPip type between Scandinavian pipiens and molestus ecotypes indicates a stronger barrier against hybridization in Scandinavia compared to other locations, in line with the evidence reviewed by Haba and McBride [2]. Furthermore, it is possible that the wPip strains themselves may reinforce this barrier between populations with cytoplasmic incompatibility. Haba and McBride [2] raise this possibility, but there are no documented cases of cytoplasmic incompatibility between the ecotypes. Swedish Cx. pipiens f molestus are wPip-I and Swedish Cx. pipiens f pipiens are wPip-II (special clade). In other studies, wPip type I and II are compatible in some cases [21]. Often, when lines of Cx. pipiens carrying different lines of wPip Wolbachia are crossed, there are examples of both unidirectional incompatibility and bidirectional incompatibility, even between lines with the same wPip type. Between wPip types, there is more often at least unidirectional incompatibility [21].
Although the rate of hybrids between ecotypes was low in our collections of Cx. pipiens where both ecotypes occur, we still found some hybrids which shared the wPip type with the Cx. pipiens f molestus collected in the same area, wPip-IV in Drammen and wPip-I in Gothenburg. Thus, the wPip types carried by the Cx. pipiens populations are at least permissive to cross with these lines in the female. These two hybrid specimens show that hybridization can occur as a result of molestus-form females mating with pipiens-form males. Previous studies of hybridization between the ecotypes have speculated that the most common would be the opposite with molestus-form males expanding to outdoor environments and mating with pipiens-form females [33].
Our results are compatible with the general understanding that the molestus form is spread through human trade and is separate from the local pipiens form [2,34]. Given the hypothesis that the molestus form is introduced in Scandinavian settings through human trade, molestus form in Norway has a different source from the populations in Sweden which are spread in several cities and smaller communities more than 300 km apart yet still share the same wPip type.
Many studies have shown that the pipiens and molestus forms have limited geneflow between each other in northern Europe but overlap in southern Europe and Northern Africa, reviewed by Haba and McBride [2]. In a German study, there was no geneflow detected between a lab strain of Cx. pipiens f molestus and field-caught Cx. pipiens f pipiens, even from the same area from which the lab strain was founded, suggesting that also in Germany there was little hybridization between the ecotypes [35]. A study carried out in Italy characterizing 55 populations of Cx. pipiens using CQ11 found that underground populations were homozygous for the f molestus allele of CQ11, and other populations had the molestus allele, heterozygotes and the pipiens allele in different proportions, with few rural populations only having the pipiens allele. Autogenous colonies could have both CQ11 alleles but the frequency of the molestus form increased during establishment of the colony but without reaching homozygosity [36]. In Moroccan Cx. Pipiens, there was no correlation between the trait of autogeny which is associated with the molestus ecotype and the CQ11 marker which has often been used as a proxy for the ecotype, meaning that there was such a substantial gene flow between the populations that the proxy of CQ11 genotype was no longer informative [37].
Looking mostly at Cx. pipiens outside of urban areas, microsatellite data do not identify Cx. pipiens from northern Europe as different from southern populations [38], while wPip strains are clearly different in different parts of Europe [12]. This pattern highlights the difference in hereditary pattern between Wolbachia and mitochondria being inherited on the maternal side only and nuclear microsatellite loci that are inherited from both males and females. The difference between genetic variation in the nuclear genome of the mosquito host and the symbiont is thought to be explained by a selective sweep introducing specific variants of the Wolbachia symbiont [31].
With a growing concern for diseases spread by Cx. pipiens, such as West Nile fever and Usutu, also in northern Europe, the differences between the urban Cx. pipiens f molestus ecotype and the more rural Cx. pipiens f pipiens are of interest. This study used Wolbachia wPip group to show that different populations of Cx. pipiens are infected by different Wolbachia and likely do not intermix to any large degree. These results further show that different populations of Cx. pipiens f molestus most likely have different origins and are dependent on human transports.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/insects15090639/s1, Table S1: sample information. Figure S1: Wolbachia abundance in specimens.

Author Contributions

Conceptualization, T.L. and O.W.L.; Data curation, T.L.; Formal Analysis, T.L.; Funding acquisition, O.W.L.; Investigation, T.L.; Methodology, T.L.; Project administration, O.W.L.; Resources, A.L., L.M.H.-T. and M.D.L.; Writing—original draft, T.L.; Writing—review and editing, T.L., O.W.L., M.D.L. and L.M.H.-T.; T.L. and O.W.L. designed the study, preformed laboratory work and T.L. wrote the manuscript, A.L. was responsible for mosquito collection in Sweden, L.M.H.-T. was responsible for providing mosquitoes from England, M.D.L. was responsible for mosquito collection in Italy, O.W.L. initiated the study and worked on the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The study was funded by Formas grant 2020-01056 to Olivia Wesula Lwande. LMHT thanks the Department of the Environment and Rural Affairs (DEFRA) for funding project SV3045, and also to the United Kingdom International Biosecurity Program - Vector Borne Diseases (EXOG0258).

Data Availability Statement

Generated DNA Sequences are deposited in genbank PP690552-PP690630 (pk1) and PP797897-798003 (ank2). qPCR results are summarized in supplemental material.

Acknowledgments

Part of the laboratory work was performed by Filippa Bertilsson and Fahmidazaman Irin under the supervision of T.L.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Linthicum, K.J. Summary of the Symposium Global Perspective on the Culex pipiens Complex in the 21st Century: The Interrelationship of Culex pipiens, quinquefasciatus, molestus and Others. J. Am. Mosq. Control Assoc. 2012, 28, 152–155. [Google Scholar] [CrossRef] [PubMed]
  2. Haba, Y.; McBride, L. Origin and status of Culex pipiens mosquito ecotypes. Curr. Biol. 2022, 32, R237–R246. [Google Scholar] [CrossRef] [PubMed]
  3. Harbach, R.E. Culex pipiens: Species versus species complex–taxonomic history and perspective. J. Am. Mosq. Control Assoc. 2012, 28, 10–23. [Google Scholar] [CrossRef] [PubMed]
  4. Bahnck, C.M.; Fonseca, D.M. Rapid assay to identify the two genetic forms of Culex (Culex) pipiens L. (Diptera: Culicidae) and hybrid populations. Am. J. Trop. Med. Hyg. 2006, 75, 251–255. [Google Scholar] [CrossRef]
  5. Martinet, J.-P.; Ferté, H.; Failloux, A.-B.; Schaffner, F.; Depaquit, J. Mosquitoes of north-western Europe as potential vectors of arboviruses: A review. Viruses 2019, 11, 1059. [Google Scholar] [CrossRef]
  6. Otranto, D.; Dantas-Torres, F.; Brianti, E.; Traversa, D.; Petrić, D.; Genchi, C.; Capelli, G. Vector-borne helminths of dogs and humans in Europe. Parasites Vectors 2013, 6, 16. [Google Scholar] [CrossRef]
  7. Huijben, S.; Schaftenaar, W.; Wijsman, A.; Paaijmans, K.; Takken, W. Avian malaria in Europe: An emerging infectious disease? In Emerging Pests and Vector-Borne Diseases in Europe: Ecology and Control of Vector-Borne Diseases; Takken, W., Knols, B.G., Eds.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2007. [Google Scholar] [CrossRef]
  8. Werren, J.H.; Baldo, L.; Clark, M.E. Wolbachia: Master manipulators of invertebrate biology. Nat. Rev. Microbiol. 2008, 6, 741–751. [Google Scholar] [CrossRef]
  9. Duron, O.; Weill, M. Wolbachia infection influences the development of Culex pipiens embryo in incompatible crosses. Heredity 2006, 96, 493–500. [Google Scholar] [CrossRef]
  10. Ogunlade, S.T.; Meehan, M.T.; Adekunle, A.I.; Rojas, D.P.; Adegboye, O.A.; McBryde, E.S. A review: Aedes-borne arboviral infections, controls and Wolbachia-based strategies. Vaccines 2021, 9, 32. [Google Scholar] [CrossRef]
  11. Altinli, M.; Gunay, F.; Alten, B.; Weill, M.; Sicard, M. Wolbachia diversity and cytoplasmic incompatibility patterns in Culex pipiens popu-lations in Turkey. Parasites Vectors 2018, 11, 198. [Google Scholar] [CrossRef]
  12. Dumas, E.; Atyame, C.M.; Milesi, P.; Fonseca, D.M.; Shaikevich, E.V.; Unal, S.; Makoundou, P.; Weill, M.; Duron, O. Population structure of Wolbachia and cytoplasmic introgression in a complex of mosquito species. BMC Evol. Biol. 2013, 13, 181. [Google Scholar] [CrossRef]
  13. Rasgon, J.L.; Scott, T.W. Wolbachia and cytoplasmic incompatibility in the California Culex pipiens mosquito species complex: Parameter estimates and infection dynamics in natural populations. Genetics 2003, 165, 2029–2038. [Google Scholar] [CrossRef] [PubMed]
  14. Bergman, A.; Hesson, J.C. Wolbachia prevalence in the vector species Culex pipiens and Culex torrentium in a Sindbis virus-endemic region of Sweden. Parasites Vectors 2021, 14, 428. [Google Scholar] [CrossRef]
  15. Vinogradova, E.B.; Shaikevich, E.V.; Ivanitsky, A.V. A study of the distribution of the Culex pipiens complex (Insecta: Diptera: Culicidae) mosquitoes in the European part of Russia by molecular methods of identification. Comp. Cy-Togenet 2007, 1, 129–138. [Google Scholar]
  16. Khrabrova, N.V.; Bukhanskaya, E.D.; Sibataev, A.K.; Volkova, T.V. The distribution of strains of endosymbiotic bacteria Wolbachia pipientis in natural populations of Culex pipiens mosquitoes (Diptera: Culicidae). Eur. Mosq. Bull. 2009, 27, 18–22. [Google Scholar]
  17. Leggewie, M.; Krumkamp, R.; Badusche, M.; Heitmann, A.; Jansen, S.; Schmidt-Chanasit, J.; Tannich, E.; Becker, S.C. Culex torrentium mosquitoes from Germany are negative for Wolbachia. Med. Vet. Entomol. 2018, 32, 115–120. [Google Scholar] [CrossRef]
  18. Karami, M.; Moosa-Kazemi, S.H.; Oshaghi, M.A.; Vatandoost, H.; Sedaghat, M.M.; Rajabnia Hosseini, M.; Maleki-Ravasan, N.; Yahyapour, Y.; Ferdosi-Shahandashti, E. Wolbachia endobacteria in natural populations of Culex pipiens of Iran and its phylogenetic congruence. J. Arthropod-Borne Dis. 2016, 10, 347. [Google Scholar]
  19. Yang, Y.; He, Y.; Zhu, G.; Zhang, J.; Gong, Z.; Huang, S.; Lu, G.; Peng, Y.; Meng, Y.; Hao, X.; et al. Prevalence and molecular characterization of Wolbachia in field-collected Aedes albopictus, Anopheles sinensis, Armigeres subalbatus, Culex pipiens and Cx. tritaeniorhynchus in China. PLoS Neglected Trop. Dis. 2021, 15, e0009911. [Google Scholar] [CrossRef]
  20. Atyame, C.M.; Delsuc, F.; Pasteur, N.; Weill, M.; Duron, O. Diversification of Wolbachia endosymbiont in the Culex pipiens mosquito. Mol. Biol. Evol. 2011, 28, 2761–2772. [Google Scholar] [CrossRef] [PubMed]
  21. Atyame, C.M.; Labbe, P.; Dumas, E.; Milesi, P.; Charlat, S.; Fort, P.; Weill, M. Wolbachia divergence and the evolution of cytoplasmic incompatibility in Culex pipiens. PLoS ONE 2014, 9, e87336. [Google Scholar] [CrossRef] [PubMed]
  22. Duron, O.; Boureux, A.; Echaubard, P.; Berthomieu, A.; Berticat, C.; Fort, P.; Weill, M. Variability and expression of ankyrin domain genes in Wolbachia variants infecting the mosquito Culex pipiens. J. Bacteriol. 2007, 189, 4442–4448. [Google Scholar] [CrossRef] [PubMed]
  23. Shaikevich, E.V.; Vinogradova, E.B.; Bouattour, A.; Gouveia de Almeida, A.P. Genetic diversity of Culex pipiens mosquitoes in distinct populations from Europe: Contribution of Cx. quinquefasciatus in Mediterranean populations. Parasites Vectors 2016, 9, 47. [Google Scholar] [CrossRef] [PubMed]
  24. Tmimi, F.Z.; Bkhache, M.; Mounaji, K.; Failloux, A.B.; Sarih, M. First report of the endobacteria Wolbachia in natural populations of Culex pipiens in Morocco. J. Vector Ecol. 2017, 42, 349–351. [Google Scholar] [CrossRef]
  25. Díaz-Nieto, L.M.; Gil, M.F.; Lazarte, J.N.; Perotti, M.A.; Berón, C.M. Culex quinquefasciatus carrying Wolbachia is less susceptible to entomopathogenic bacteria. Sci. Rep. 2021, 11, 1094. [Google Scholar] [CrossRef]
  26. Altinli, M.; Soms, J.; Ravallec, M.; Justy, F.; Bonneau, M.; Weill, M.; Gosselin-Grenet, A.; Sicard, M. Sharing cells with Wolbachia: The transovarian vertical transmission of Culex pipiens densovirus. Environ. Microbiol. 2019, 21, 3284–3298. [Google Scholar] [CrossRef]
  27. Altinli, M.; Lequime, S.; Atyame, C.; Justy, F.; Weill, M.; Sicard, M. Wolbachia modulates prevalence and viral load of Culex pipiens densoviruses in natural populations. Mol. Ecol. 2020, 29, 4000–4013. [Google Scholar] [CrossRef]
  28. Vogels, C.B.; van de Peppel, L.J.; van Vliet, A.J.; Westenberg, M.; Ibañez-Justicia, A.; Stroo, A.; Buijs, J.A.; Visser, T.M.; Koenraadt, C.J. Winter activity and aboveground hybridization between the two biotypes of the West Nile virus vector Culex pipiens. Vector-Borne Zoonotic Dis. 2015, 15, 619–626. [Google Scholar] [CrossRef]
  29. Tamura, K.; Stecher, G.; Kumar, S. MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  30. Hasegawa, M.; Kishino, H.; Yano, T.A. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 1985, 22, 160–174. [Google Scholar] [CrossRef]
  31. Dumas, E.; Atyame, C.M.; Malcolm, C.A.; Le Goff, G.; Unal, S.; Makoundou, P.; Pasteur, N.; Weill, M.; Duron, O. Molecular data reveal a cryptic species within the Culex pipiens mosquito complex. Insect Mol. Biol. 2016, 25, 800–809. [Google Scholar] [CrossRef] [PubMed]
  32. Berticat, C.; Rousset, F.; Raymond, M.; Berthomieu, A.; Weill, M. High Wolbachia density in insecticide–resistant mosquitoes. Proc. R. Soc. London. Ser. B Biol. Sci. 2002, 269, 1413–1416. [Google Scholar] [CrossRef] [PubMed]
  33. Gomes, B.; Sousa, C.A.; Novo, M.T.; Freitas, F.B.; Alves, R.; Côrte-Real, A.R.; Salgueiro, P.; Donnelly, M.J.; Almeida, A.P.G.; Pinto, J. Asymmetric introgression between sympatric molestus and pipiens forms of Culex pipiens (Diptera: Culicidae) in the Comporta region, Portugal. BMC Evol. Biol. 2009, 9, 262. [Google Scholar] [CrossRef]
  34. Fonseca, D.M.; Keyghobadi, N.; Malcolm, C.A.; Mehmet, C.; Schaffner, F.; Mogi, M.; Fleischer, R.C.; Wilkerson, R.C. Emerging vectors in the Culex pipiens complex. Science 2004, 303, 1535–1538. [Google Scholar] [CrossRef]
  35. Honnen, A.C.; Monaghan, M.T. City-Dwellers and Country Folks: Lack of Population Differentiation Along an Urban-Rural Gradient in the Mosquito Culex pipiens (Diptera: Culicidae). J. Insect Sci. 2017, 17, 107. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  36. Di Luca, M.; Toma, L.; Boccolini, D.; Severini, F.; La Rosa, G.; Minelli, G.; Bongiorno, G.; Montarsi, F.; Arnoldi, D.; Capelli, G.; et al. Ecological distribution and CQ11 genetic structure of Culex pipiens complex (Diptera: Culicidae) in Italy. PLoS ONE 2016, 11, e0146476. [Google Scholar] [CrossRef] [PubMed]
  37. Arich, S.; Haba, Y.; Assaid, N.; Fritz, M.L.; McBride, C.S.; Weill, M.; Taki, H.; Sarih, M.; Labbé, P. No association between habitat, autogeny and genetics in Moroccan Culex pipiens populations. Parasites Vectors 2022, 15, 405. [Google Scholar] [CrossRef]
  38. Lõhmus, M.; Lindström, A.; Björklund, M. How often do they meet? Genetic similarity between European populations of a potential disease vector Culex pipiens. Infect. Ecol. Epidemiol. 2012, 2, 12001. [Google Scholar]
Insects 15 00639 g001
Figure 1. Collection sites for the Cx. pipiens specimens collected in Sweden and Norway. Blue dots are collection sites for Cx. pipiens f pipiens specimens and red dots are collection sites for Cx. pipiens f molestus specimens.
Figure 1. Collection sites for the Cx. pipiens specimens collected in Sweden and Norway. Blue dots are collection sites for Cx. pipiens f pipiens specimens and red dots are collection sites for Cx. pipiens f molestus specimens.
Insects 15 00639 g001
Insects 15 00639 g002
Figure 2. Maximum likelihood phylogenetic tree of ank2 sequences. Specimens with identical sequences are presented together. Dots mark the previously published reference sequences [22] used to define the haplogroups and the outgroup wAlbB. Branches supported by bootstrap values over 70% are indicated with the bootstrap value.
Figure 2. Maximum likelihood phylogenetic tree of ank2 sequences. Specimens with identical sequences are presented together. Dots mark the previously published reference sequences [22] used to define the haplogroups and the outgroup wAlbB. Branches supported by bootstrap values over 70% are indicated with the bootstrap value.
Insects 15 00639 g002
Insects 15 00639 g003
Figure 3. Maximum likelihood phylogenetic tree of pk1 sequences. Specimens with identical sequences are presented together. Dots mark the previously published reference sequences [22] that are used to define the haplogroups and the outgroup wAlbB. The Cx. pipiens f pipiens specimens from Sweden and Norway group together in a distinct cluster (pk1-c*) not defined as a haplogroup in [22]. Branches supported by bootstrap values over 70% are indicated with the bootstrap value.
Figure 3. Maximum likelihood phylogenetic tree of pk1 sequences. Specimens with identical sequences are presented together. Dots mark the previously published reference sequences [22] that are used to define the haplogroups and the outgroup wAlbB. The Cx. pipiens f pipiens specimens from Sweden and Norway group together in a distinct cluster (pk1-c*) not defined as a haplogroup in [22]. Branches supported by bootstrap values over 70% are indicated with the bootstrap value.
Insects 15 00639 g003
Table 1. Mosquitoes tested for Wolbachia infection by wsp qPCR. All tested Cx. pipiens were positive while other species had a lower incidence of infection or were completely uninfected.
Table 1. Mosquitoes tested for Wolbachia infection by wsp qPCR. All tested Cx. pipiens were positive while other species had a lower incidence of infection or were completely uninfected.
SpeciesLocation% Wolbachia Incidence# Wolbachia Positive# Screened
Aedes vexansSweden0%013
Culex modestusSweden67%46
Culex territansSweden0%02
Culex torrentiumSweden0%09
Culex quinquefasciatusMali, Thailand100%88
Culex pipiens f pipiensSweden100%3535
Culex pipiens f pipiensNorway100%33
Culex pipiens f pipiensEngland100%1010
Culex pipiens f pipiensItaly100%2424
Culex pipiens f pipiensThe Netherlands100%33
Culex pipiens hybridsSweden, Norway, England100%88
Culex pipiens f molestusSweden100%2121
Culex pipiens f molestusNorway100%55
Culex pipiens f molestusEngland100%66
Culex pipiens f molestusItaly100%3636
Culex pipiens f molestusThe Netherlands100%33
# Number of specimens.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lilja, T.; Lindström, A.; Hernández-Triana, L.M.; Di Luca, M.; Lwande, O.W. European Culex pipiens Populations Carry Different Strains of Wolbachia pipientis. Insects 2024, 15, 639. https://doi.org/10.3390/insects15090639

AMA Style

Lilja T, Lindström A, Hernández-Triana LM, Di Luca M, Lwande OW. European Culex pipiens Populations Carry Different Strains of Wolbachia pipientis. Insects. 2024; 15(9):639. https://doi.org/10.3390/insects15090639

Chicago/Turabian Style

Lilja, Tobias, Anders Lindström, Luis M. Hernández-Triana, Marco Di Luca, and Olivia Wesula Lwande. 2024. "European Culex pipiens Populations Carry Different Strains of Wolbachia pipientis" Insects 15, no. 9: 639. https://doi.org/10.3390/insects15090639

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop