Oxacillin (Methicillin) Resistant Staphylococci in Domestic Animals in the Czech Republic
Abstract
:1. Introduction
2. Material and Methods
2.1. Isolation and Identification of Bacteria: Bacteriological Confirmation
2.2. Samples from Digestive Tract
2.3. Samples from the Skin; Urinary Apparatus; Oral Cavity; Eyes; Respiratory, Musculoskeletal and Lymphatic Systems
2.4. Mammary Gland and Milk Samples
2.5. Bacteriological Confirmation and Susceptibility Determination
2.6. Antimicrobial Susceptibility Testing
2.7. MRS Molecular Characterization
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Julák, J. Introduction to Medical Microbiology, 2nd ed.; Karolinum: Prague, Czech Republic, 2015; p. 404. [Google Scholar]
- Bzdil, J.; Holy, O.; Chmelar, D. Gram-positive aerobic and microaerophilic microorganisms isolated from pathological processes and lesions of horses. Vet. Med. 2017, 62, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Rossi, C.C.; Dias, I.D.S.; Muniz, I.M.; Lilenbaum, W.; Giambiagi-Demarval, M. The oral microbiota of domestic cats harbors a wide variety of Staphylococcus species with zoonotic potential. Vet. Microbiol. 2017, 201, 136–140. [Google Scholar] [CrossRef] [PubMed]
- Mama, O.M.; Gómez-Sanz, E.; Ruiz-Ripa, L.; Gómez, P.; Torres, C. Diversity of staphylococcal species in food producing animals in Spain, with detection of PVL-positive MRSA ST8 (USA300). Vet. Microbiol. 2019, 233, 5–10. [Google Scholar] [CrossRef] [PubMed]
- Vasileiou, N.G.C.; Chatzopoulos, D.C.; Sarrou, S.; Fragkou, I.A.; Katsafadou, A.I.; Mavrogianni, V.S.; Petinaki, E.; Fthenakis, G.C. Role of staphylococci in mastitis in sheep. J. Dairy Res. 2019, 86, 254–266. [Google Scholar] [CrossRef] [Green Version]
- Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Fitzpatrick, E.S.; Fanning, S.; Hartigan, P.J. Veterinary Microbiology and Microbial Disease, 2nd ed.; Blackwell Publishing: Oxford, UK, 2011; p. 912. [Google Scholar]
- Anderson, K.L.; Kearns, R.; Lyman, R.; Correa, M.T. Staphylococci in dairy goats and human milkers, and the relationship with herd management practices. Small Rumin. Res. 2018, 171, 13–22. [Google Scholar] [CrossRef]
- Magleby, R.; Bemis, D.A.; Kim, D.; Carroll, K.C.; Castanheira, M.; Kania, S.A.; Jenkins, S.G.; Westblade, L.F. First reported human isolation of Staphylococcus delphini. Diagn. Microbiol. Infect. Dis. 2019, 94, 274–276. [Google Scholar] [CrossRef] [PubMed]
- Votava, M.; Černohorská, L.; Heroldová, M.; Holá, V.; Mejzlíková, L.; Ondrovčík, P.; Růžička, F.; Dvořáčková, M.; Woznicová, V.; Zahradníček, O. Special Medical Microbiology; Neptun: Brno, Czech Republic, 2006; p. 495. ISBN 80-902896-6-5. (In Czech) [Google Scholar]
- Bradley, A. Bovine Mastitis: An Evolving Disease. Vet. J. 2002, 164, 116–128. [Google Scholar] [CrossRef]
- Zecca, E.; Costanzo, M.; Croce, A.; Sola, D.; Pirovano, A.; Matino, E.; Pirisi, M. First reported human case of meningitis by Staphylococcus condimenti. Infection 2019, 47, 651–653. [Google Scholar] [CrossRef]
- Bzdil, J.; Štanclová, D.; Toporčák, J.; Dopitová, Š.; Axmannová, M. Staphylococci Isolated from Dogs and Cats and its Susceptibility to Antimicrobials. Veterinářství 2019, 69, 155–160. (In Czech) [Google Scholar]
- Songer, J.G.; Post, K.W. Veterinary Microbiology Bacterial and Fungal Agents of Animal Disease; Elsevier Sounders: Philadelphia, PA, USA, 2005; p. 434. [Google Scholar]
- Murugaiyan, J.; Walther, B.; Stamm, I.; Abou-Elnaga, Y.; Brueggemann-Schwarze, S.; Vincze, S.; Wieler, L.H.; Lübke-Becker, A.; Semmler, T.; Roesler, U. Species differentiation within the Staphylococcus intermedius group using a refined MALDI-TOF MS database. Clin. Microbiol. Infect. 2014, 20, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
- Litster, A.; Moss, S.M.; Honnery, M.; Rees, B.; Trott, D.J. Prevalence of bacterial species in cats with clinical signs of lower urinary tract disease: Recognition of Staphylococcus felis as a possible feline urinary tract pathogen. Vet. Microbiol. 2007, 121, 182–188. [Google Scholar] [CrossRef]
- Ahmad, N.I.; Yean, C.Y.; Foo, P.C.; Safiee, A.W.M.; Hassan, S.A. Prevalence and association of Panton-Valentine Leukocidin gene with the risk of sepsis in patients infected with Methicillin Resistant Staphylococcus aureus. J. Infect. Public Health 2020, 13, 1508–1512. [Google Scholar] [CrossRef]
- Von Eiff, C.; Peters, G.; Heilmann, C. Pathogenesis of infections due to coagulase-negative staphylococci. Lancet Infect. Dis. 2002, 2, 677–685. [Google Scholar] [CrossRef]
- Takeuchi, F.; Watanabe, S.; Baba, T.; Yuzawa, H.; Ito, T.; Morimoto, Y.; Kuroda, M.; Cui, L.; Takahashi, M.; Ankai, A.; et al. Whole-Genome Sequencing of Staphylococcus haemolyticus Uncovers the Extreme Plasticity of Its Genome and the Evolution of Human-Colonizing Staphylococcal Species. J. Bacteriol. 2005, 187, 7292–7308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kmieciak, W.; Szewczyk, E.M. Are zoonotic Staphylococcus pseudintermedius strains a growing threat for humans? Folia Microbiol. 2018, 63, 743–747. [Google Scholar] [CrossRef] [Green Version]
- Kizerwetter-Świda, M.; Pławińska-Czarnak, J. Staphylococci isolated from animals as a source of genes that confer multidrug resistance to antimicrobial agents of critical importance to public health. Med. Weter. 2017, 73, 626–631. [Google Scholar] [CrossRef] [Green Version]
- Ouoba, L.I.I.; Mbozo, A.B.V.; Anyogu, A.; Obioha, P.I.; Lingani-Sawadogo, H.; Sutherland, J.P.; Jespersen, L.; Ghoddusi, H.B. Environmental heterogeneity of Staphylococcus species from alkaline fermented foods and associated toxins and antimicrobial resistance genetic elements. Int. J. Food Microbiol. 2019, 311, 108356. [Google Scholar] [CrossRef] [Green Version]
- Becker, K.; Ballhausen, B.; Köck, R.; Kriegeskorte, A. Methicillin resistance in Staphylococcus isolates: The “mec alphabet” with specific consideration of mecC, a mec homolog associated with zoonotic S. aureus lineages. Int. J. Med Microbiol. 2014, 304, 794–804. [Google Scholar] [CrossRef] [PubMed]
- Oreiby, A.; Khalifa, H.; Eld, A.; Ahmed, A.; Shimamoto, T. Clinical and molecular characterization of both methicillin-resistant and-sensitive Staphylococcus aureus mastitis. J. Hell. Vet. Med. Soc. 2019, 70, 1743–1748. [Google Scholar] [CrossRef]
- Bzdil, J.; Chaloupka, O.; Bezrouk, Z. Staphylococcus aureus and Bovine Mastitis, Changes in Prevalence and Susceptibility to Antimicrobials in 2007–2016. Veterinářství 2017, 6, 466–471. (In Czech) [Google Scholar]
- Ahmed, W.; Neubauer, H.; Tomaso, H.; El Hofy, F.I.; Monecke, S.; Abdeltawab, A.A.; Hotzel, H. Characterization of Staphylococci and Streptococci Isolated from Milk of Bovides with Mastitis in Egypt. Pathogens 2020, 9, 381. [Google Scholar] [CrossRef]
- Gordon, R.J.; Lowy, F.D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin. Infect. Dis. 2008, 46, S350–S359. [Google Scholar] [CrossRef] [Green Version]
- Foster, T.J.; Höök, M. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol. 1998, 6, 484–488. [Google Scholar] [CrossRef]
- Balachandran, M.; Bemis, D.A.; Kania, S.A. Expression and function of protein A in Staphylococcus pseudintermedius. Virulence 2018, 9, 390–401. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial Biofilms: A Common Cause of Persistent Infections. Science 1999, 284, 1318–1322. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oliveira, D.; Borges, A.; Simões, M. Staphylococcus aureus Toxins and Their Molecular Activity in Infectious Diseases. Toxins 2018, 10, 252. [Google Scholar] [CrossRef] [Green Version]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Approved Standard, CLSI Document VET01-A4, 4th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013; p. 70. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, CLSI Supplement VET08, 4th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018; p. 170. [Google Scholar]
- NCCLS. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals; Approved Standard, NCCLS Document M31-A2, 2nd ed.; NCCLS: Wayne, PA, USA, 2002; ISBN 1-56238-461-9. [Google Scholar]
- European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 10.0, 2018; European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2020; Available online: http://www.eucast.org/clinical_breakpoints (accessed on 25 August 2020).
- Comité de l’Antibiogramme de la Société Francaise de Microbiologie (CA-SFM). RecommandationsVétérinaries; Société Francaise de Microbiologie: Paris, France, 2018; p. 15. [Google Scholar]
- BD BBL. BBL Sensi-Disc Antimicrobial Susceptibility Test Discs, 8840621JAA(02)2014-03; BBL: Le Pont de Claix, France, 2020; p. 15. Available online: https://docplayer.cz/46964153-Bbl-sensi-disc-antimicrobial-susceptibility-test-discs.html (accessed on 24 August 2020).
- Biopharm. Diagnostics Disc for Susceptibility Testing to Antibiotic Rifaximin; Biopharmacy and Veterinary Drugs Research Institute: Jílové u Prahy, Czech Republic, 2020; p. 1. [Google Scholar]
- Geha, D.J.; Uhl, J.R.; Gustaferro, C.A.; Persing, D.H. Multiplex PCR for identification of methicillin-resistant Staphylococci in the clinical laboratory. J. Clin. Microbiol. 1994, 32, 1768–1772. [Google Scholar] [CrossRef] [Green Version]
- Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of Multiplex PCR To Identify Staphylococcus aureus Adhesins Involved in Human Hematogenous Infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef] [Green Version]
- Peacock, S.J.; Moore, C.; Justice, A.; Kantzanou, M.; Story, L.; Mackie, K.; O’Neill, G.; Day, N.P.J. Virulent Combinations of Adhesin and Toxin Genes in Natural Populations of Staphylococcus aureus. Infect. Immun. 2002, 70, 4987–4996. [Google Scholar] [CrossRef] [Green Version]
- Růžičková, V.; Voller, J.; Pantůček, R.; Petráš, P.; Doškař, J. Multiplex PCR for detection of three exfoliative toxin serotype genes in Staphylococcus aureus. Folia Microbiol. 2005, 50, 499–502. [Google Scholar] [CrossRef]
- Becker, K.; Roth, R.; Peters, G. Rapid and Specific Detection of Toxigenic Staphylococcus aureus: Use of Two Multiplex PCR Enzyme Immunoassays for Amplification and Hybridization of Staphylococcal Enterotoxin Genes, Exfoliative Toxin Genes, and Toxic Shock Syndrome Toxin 1 Gene. J. Clin. Microbiol. 1998, 36, 2548–2553. [Google Scholar] [CrossRef] [Green Version]
- Fitzgerald, J.R.; Monday, S.R.; Foster, T.J.; Bohach, G.A.; Hartigan, P.J.; Meaney, W.J.; Smyth, C.J. Characterization of a Putative Pathogenicity Island from Bovine Staphylococcus aureus Encoding Multiple Superantigens. J. Bacteriol. 2001, 183, 63–70, Erratum in J. Bacteriol. 2001, 166, 4259. [Google Scholar] [CrossRef] [Green Version]
- Madhaiyan, M.; Wirth, J.S.; Saravanan, V.S. Phylogenomic analyses of the Staphylococcaceae family suggest the reclassification of five species within the genus Staphylococcus as heterotypic synonyms, the promotion of five subspecies to novel species, the taxonomic reassignment of five Staphylococcus species to Mammaliicoccus gen. nov., and the formal assignment of Nosocomiicoccus to the family Staphylococcaceae. Int. J. Syst. Evol. Microbiol. 2020, 70, 5926–5936. [Google Scholar]
- Malinowski, E.; Lassa, H.; Kłlossowska, A.; Smulski, S.; Markiewicz, H.; Kaczmarowski, M. Etiological agents of dairy cows’ mastitis in western part of Poland. Pol. J. Vet. Sci. 2006, 9, 191–194. [Google Scholar] [PubMed]
- Bzdil, J. Spectrum of Aerobic Microorganisms Isolated from Cattle Milk Samples with Symptoms of Mastitis. Veterinářství 2015, 8, 630–635. (In Czech) [Google Scholar]
- Silva, V.; Hermenegildo, S.; Ferreira, C.; Manaia, C.; Capita, R.; Alonso-Calleja, C.; Carvalho, I.; Pereira, J.; Maltez, L.; Capelo, J.; et al. Genetic Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from Human Bloodstream Infections: Detection of MLSB Resistance. Antibiotics 2020, 9, 375. [Google Scholar] [CrossRef] [PubMed]
- Montazeri, E.A.; Seyed-Mohammadi, S.; Dezfuli, A.A.; Khosravi, A.D.; Dastoorpoor, M.; Roointan, M.; Saki, M. Investigation of SCCmec types I–IV in clinical isolates of methicillin-resistant coagulase-negative staphylococci in Ahvaz, Southwest Iran. Biosci. Rep. 2020, 40, BSR20200847. [Google Scholar] [CrossRef]
- Salaberry, S.R.S.; Saidenberg, A.; Zuniga, E.; Melville, P.A.; Santos, F.G.B.; Guimarães, E.C.; Gregori, F.; Benites, N.R. Virulence factors genes of Staphylococcus spp. isolated from caprine subclinical mastitis. Microb. Pathog. 2015, 85, 35–39. [Google Scholar] [CrossRef]
- Simojoki, H.; Hyvönen, P.; Ferrer, C.P.; Taponen, S.; Pyörälä, S. Is the biofilm formation and slime producing ability of coagulase-negative staphylococci associated with the persistence and severity of intramammary infection? Vet. Microbiol. 2012, 158, 344–352. [Google Scholar] [CrossRef]
- Bertelloni, F.; Cagnoli, G.; Ebani, V.V. Virulence and Antimicrobial Resistance in Canine Staphylococcus spp. Isolates. Microorganisms 2021, 9, 515. [Google Scholar] [CrossRef]
- Soumya, K.R.; Philip, S.; Sugathan, S.; Mathew, J.; Radhakrishnan, E.K. Virulence factors associated with Coagulase Negative Staphylococci isolated from human infections. 3 Biotech 2017, 7, 140. [Google Scholar] [CrossRef] [Green Version]
- Piessens, V.; De Vliegher, S.; Verbist, B.; Braem, G.; Van Nuffel, A.; De Vuyst, L.; Heyndrickx, M.; Van Coillie, E. Characterization of coagulase-negative staphylococcus species from cows’ milk and environment based on bap, icaA, and mecA genes and phenotypic susceptibility to antimicrobials and teat dips. J. Dairy Sci. 2012, 95, 7027–7038. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdel-Moein, K.A.; Zaher, H.M. The Nasal Carriage of Coagulase-Negative Staphylococci Among Animals and Its Public Health Implication. Vector-Borne Zoonotic Dis. 2020, 20, 897–902. [Google Scholar] [CrossRef] [PubMed]
- Adame-Gómez, R.; Castro-Alarcón, N.; Vences-Velázquez, A.; Toribio-Jiménez, J.; Pérez-Valdespino, A.; Leyva-Vázquez, M.A.; Ramírez-Peralta, A. Genetic diversity and virulence factors of S. aureus isolated from food, humans and animals. Int. J. Microbiol. 2020, 2020, 1048097. [Google Scholar] [CrossRef] [PubMed]
Antimicrobials | Antibiotics Concentration Per Disc (µg) | Diameter (mm) | ||
---|---|---|---|---|
R | S | Source | ||
Cefoxitin (S. aureus, S. lugdunensis) | 30 | ≤21 | ≥22 | CLSI VET 01 S (2018) |
Cefoxitin (CNS) | 30 | ≤24 | ≥25 | CLSI VET 01 S (2018) |
Oxacillin (S. aureus, S. pseudintermedius, Staphylococcus spp.) | 5 | <20 | ≥20 | CASFM (2018) |
Amoxicillin/clavulanic acid | 20/10 | ≤19 | ≥22 | NCCLS (2002) |
Trimethoprim/sulfamethoxazole (Staphylococcus spp.) | 1.25/23.75 | ≤10 | ≥16 | CLSI VET 01 S (2018) |
Gentamicin (S. aureus) | 10 | <18 | ≥18 | EUCAST (2020) |
Gentamicin (CNS) | 10 | <22 | ≥22 | EUCAST (2020) |
Tetracycline (Staphylococcus spp.) | 30 | ≤17 | ≥23 | CLSI VET 01 S (2018) |
Chloramphenicol (Staphylococcus spp.) | 30 | ≤12 | ≥18 | CLSI VET 01 S (2018) |
Erythromycin (Staphylococcus spp.) | 15 | ≤13 | ≥23 | CLSI VET 01 S (2018) |
Florfenicol (Staphylococcus spp.) | 30 | ≤18 | ≥22 | CLSI VET 01 (2013) |
Clindamycin (Staphylococcus spp.) | 2 | ≤14 | ≥21 | CLSI VET 01 S (2018) |
Enrofloxacin (Staphylococcus spp.) | 5 | ≤16 | ≥23 | CLSI VET 01 S (2018) |
Nitrofurantoin (Staphylococcus spp.) | 100 | ≤14 | ≥17 | CLSI VET 01 S (2018) |
Novobiocin | 30 | ≤17 | ≥22 | BD BBL (2020) |
Rifaximin | 40 | <10 | >19 | BIOPHARM (2020) |
Gene | Primer | Nucleotide Sequence (5′–3′) | Amplicon Size | Reference |
---|---|---|---|---|
mecA | MECA-1 | GTAGAAATGACTGAACGTCCGATAA | 310 | [38] |
MECA-2 | CCAATTCCACATTGTTTCGGTCTAA | |||
cna | CNA-1 | GTCAAGCAGTTATTAACACCAGAC | 423 | [39] |
CNA-2 | AATCAGTAATTGCACTTTGTCCACTG | |||
eno | ENO-1 | ACGTGCAGCAGCTGACT | 302 | [39] |
ENO-2 | CAACAGCATYCTTCAGTACCTTC | |||
clfA | CLFA-1 | ATTGGCGTGGCTTCAGTGCT | 292 | [39] |
CLFA-2 | CGTTTCTTCCGTAGTTGCATTTG | |||
clfB | CLFB-1 | ACATCAGTAATAGTAGGGGGCAAC | 205 | [39] |
CLFB-2 | TTCGCACTGTTTGTGTTTGCAC | |||
fib | FIB-1 | CTACAACTACAATTGCCGTCAACAG | 404 | [39] |
FIB-2 | GCTCTTGTAAGACCATTTTCTTCAC | |||
ebp | EBP-1 | CATCCAGAACCAATCGAAGAC | 186 | [39] |
EBP-2 | CTTAACAGTTACATCATCATGTTTATCTTTG | |||
bbp | BBP-1 | AACTACATCTAGTACTCAACAACAG | 575 | [39] |
BBP-2 | ATGTGCTTGAATAACACCATCATCT | |||
fnbA | FNBA-1 | CACAACCAGCAAATATAG | 1362 | [40] |
FNBA-2 | CTGTGTGGTAATCAATGTC | |||
fnbB | FNBB-1 | GTAACAGCTAATGGTCGAATTGATACT | 524 | [39] |
FNBB-2 | CAAGTTCGATAGGAGTACTATGTTC | |||
icaA | ICAA-1 | GATTATGTAATGTGCTTGGA | 770 | [40] |
ICAA-2 | ACTACTGCTGCGTTAATAAT | |||
etA | ETA-1 | CTATTTACTGTAGGAGCTAG | 741 | [41] |
ETA-2 | ATTTATTTGATGCTCTCTAT | |||
etB | ETB-1 | ACGGCTATATACATTCAATT | 200 | [41] |
ETB-2 | TCCATCGATAATATACCTAA | |||
tsst | TSST-1 | AAGCCCTTTGTTGCTTGCG | 445 | [42] |
TSST-2 | ATCGAACTTTGGCCCATACTTT |
Staphylococcus Species | Number of Isolated Strains (n =) | Prevalence (%) | Staphylococcus Species | Number of Isolated Strains (n =) | Prevalence (%) |
---|---|---|---|---|---|
S. aureus | 205 | 3.93 | Mammaliicoccus lentus * | 3 | 0.06 |
S. arlettae | 3 | 0.06 | S. lugdunensis | 1 | 0.02 |
S. capitis ssp. capitis | 2 | 0.04 | S. lutrae | 3 | 0.06 |
S. caprae | 2 | 0.04 | S. petrasii ssp. petrasii * | 1 | 0.02 |
S. carnosus | 1 | 0.02 | S. pseudintermedius | 336 | 6.44 |
S. caseolyticus | 1 | 0.02 | S. coagulans * | 19 | 0.36 |
S. chromogenes | 45 | 0.86 | S. schleiferi ssp. schleiferi * | 2 | 0.04 |
S. cohnii ssp. cohnii | 1 | 0.02 | Mammaliicoccus sciuri * | 18 | 0.34 |
S. delphini | 3 | 0.06 | S. simulans | 11 | 0.21 |
S. epidermidis | 23 | 0.44 | S. succinus ssp. succinus * | 2 | 0.04 |
S. equorum | 7 | 0.13 | Mammaliicoccus vitulinus * | 1 | 0.02 |
S. felis | 32 | 0.61 | S. warneri | 2 | 0.04 |
S. haemolyticus | 68 | 1.30 | S. xylosus | 16 | 0.31 |
S. hyicus | 6 | 0.11 | |||
S. intermedius | 40 | 0.77 | Total | 854 | 16.37 |
Staphylococcus spp. | S. aureus | S. arlettae | S. capitis ssp. capitis | S. caprae | S. carnosus | S. caseolyticus | S. chromogenes | S. cohnii ssp. cohnii | S. delphini | S. epidermidis | S. equorum | S. felis | S. haemolyticus | S. hyicus | S. intermedius | M. lentus * | S. lugdunensis | S. lutrae | S. petrasii ssp. petrasii * | S. pseudintermedius | S. coagulans * | S. schleiferi ssp. schleiferi * | M. sciuri * | S. simulans | S. succinus ssp. succinus * | M. vitulinus * | S. warneri | S. xylosus | Total |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Animal (Group) | |||||||||||||||||||||||||||||
Domestic carnivores | 6 | 0 | 2 | 0 | 1 | 0 | 3 | 0 | 1 | 8 | 0 | 32 | 14 | 0 | 38 | 0 | 0 | 2 | 1 | 333 | 11 | 2 | 2 | 1 | 0 | 0 | 1 | 0 | 458 |
(dogs and cats) | |||||||||||||||||||||||||||||
Ruminants | 171 | 3 | 0 | 2 | 0 | 1 | 40 | 1 | 0 | 5 | 1 | 0 | 42 | 1 | 0 | 2 | 0 | 1 | 0 | 0 | 3 | 0 | 10 | 9 | 2 | 1 | 1 | 12 | 308 |
Pigs | 6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 | 0 | 0 | 0 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 18 |
Solipeds | 12 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 2 | 0 | 6 | 0 | 0 | 0 | 2 | 1 | 1 | 0 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 29 |
Birds | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 8 |
Exotic mammals | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4 |
Exotic birds | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 5 |
Rodents | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 12 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 0 | 6 | 0 | 0 | 0 | 0 | 0 | 24 |
Total | 205 | 3 | 2 | 2 | 1 | 1 | 45 | 1 | 3 | 23 | 7 | 32 | 68 | 6 | 40 | 3 | 1 | 3 | 1 | 336 | 19 | 2 | 18 | 11 | 2 | 1 | 2 | 16 | 854 |
Staphylococcus Species | S. aureus | S. epidermidis | S. haemolyticus | S. intermedius | S. pseudintermedius | S. coagulans | Total | Number of Samples |
---|---|---|---|---|---|---|---|---|
Animal (Group) | ||||||||
Domestic carnivores (dogs and cats) | 1 (0.04) | 1 (0.04) | 4 (0.16) | 4 (0.16) | 23 (0.93) | 1 (0.04) | 34 (1.38) | 2471 |
Ruminants | 3 (0.16) | 0 | 0 | 0 | 0 | 0 | 3 (0.16) | 1836 |
Pigs | 1 (1.41) | 0 | 0 | 0 | 0 | 0 | 1 (1.41) | 71 |
Solipeds | 1 (1.10) | 0 | 0 | 0 | 0 | 0 | 1 (1.10) | 91 |
Birds | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 242 |
Exotic mammals | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 84 |
Exotic birds | 0 | 1 (0.97) | 0 | 0 | 0 | 0 | 1 (0.97) | 103 |
Exotic reptiles | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 46 |
Fish | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 35 |
Insects(bees) | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
Rodents | 1 (0.42) | 0 | 1 (0.42) | 0 | 1 (0.42) | 0 | 3 (1.27) | 236 |
Total | 7 (0.13) | 2 (0.04) | 5 (0.10) | 4 (0.08) | 24 (0.46) | 1 (0.02) | 43 (0.82) | 5218 |
Staphylococcus Species | S. aureus | S. epidermidis | S. haemolyticus | S. intermedius | S. pseudintermedius | S. coagulans | Total | Number of Samples |
---|---|---|---|---|---|---|---|---|
Organ (Apparatus) | ||||||||
Ear | 0 | 0 | 0 | 0 | 4 (0.79) | 0 | 4 (0.79) | 507 |
Eye | 0 | 0 | 0 | 0 | 2 (1.12) | 0 | 2 (1.12) | 179 |
Skin | 2 (0.46) | 0 | 0 | 4 (0.91) | 14 (3.20) | 1 (0.23) | 21 (4.79) | 438 |
Respiratory | 1 (0.34) | 1 (0.34) | 4 (1.36) | 0 | 2 (0.68) | 0 | 8 (2.72) | 294 |
Digestive | 0 | 0 | 0 | 0 | 2 (0.10) | 0 | 2 (0.10) | 1983 |
Mammary gland | 3 (0.19) | 0 | 0 | 0 | 0 | 0 | 3 (0.19) | 1576 |
Urogenital | 0 | 1 (0.49) | 1 (0.49) | 0 | 0 | 0 | 2 (0.97) | 206 |
Musculoskeletal | 1 (3.33) | 0 | 0 | 0 | 0 | 0 | 1 (3.33) | 30 |
Lymphatic | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 |
Circulation | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 3 |
Nervous | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Total | 7 (0.13) | 2 (0.04) | 5 (0.10) | 4 (0.08) | 24 (0.46) | 1 (0.02) | 43 (0.82) | 5218 |
Staphylococcus Species | S. aureus | S. epidermidis | S. haemolyticus | S. intermedius | S. pseudintermedius | S. coagulans | Total |
---|---|---|---|---|---|---|---|
Antimicrobials | |||||||
Rifaximin | 7/7 (100%) | 1/2 (50%) | 5/5 (100%) | 4/4 (100%) | 24/24 (100%) | 1/1 (100%) | 42/43 (97.7%) |
Trimethoprim/ sulphamethoxazole | 6/7 (85.7%) | 1/2 (50%) | 0/5 (0%) | 2/4 (50.0%) | 11/24 (45.8%) | 1/1 (100%) | 21/43 (48.8%) |
Gentamicin | 3/7 (42.9%) | 0/2 (0%) | 0/5 (0%) | 0/4 (0%) | 5/24 (20.8%) | 1/1 (100%) | 9/43 (20.9%) |
Tetracycline | 0/7 (0%) | 0/2 (0%) | 2/5 (40.0%) | 1/4 (25.0%) | 4/24 (16.7%) | 1/1 (100%) | 8/43 (18.6%) |
Chloramphenicol | 7/7 (100%) | 2/2 (100%) | 5/5 (100%) | 2/4 (50.0%) | 17/24 (70.8%) | 1/1 (100%) | 34/43 (79.1%) |
Florfenicol | 7/7 (100%) | 2/2 (100%) | 5/5 (100%) | 4/4 (100%) | 24/24 (100%) | 1/1 (100%) | 43/43 (100%) |
Erythromycin | 6/7 (85.7%) | 0/2 (0%) | 0/5 (0%) | 0/4 (0%) | 2/24 (8.3%) | 1/1 (100%) | 9/43 (20.9%) |
Clindamycin | 5/7 (71.4%) | 1/2 (50%) | 2/5 (40.0%) | 0/4 (0%) | 2/24 (8.3%) | 1/1 (100%) | 11/43 (25.6%) |
Enrofloxacin | 3/7 (42.9%) | 0/2 (0%) | 0/5 (0%) | 0/4 (0%) | 0/24 (0%) | 0/1 (0%) | 3/43 (7.0%) |
Novobiocin | 7/7 (100%) | 2/2 (100%) | 4/5 (80.0%) | 4/4 (100%) | 24/24 (100%) | 1/1 (100%) | 42/43 (97.7%) |
Nitrofurantoin | 7/7 (100%) | 2/2 (100%) | 5/5 (100%) | 4/4 (100%) | 24/24 (100%) | 1/1 (100%) | 43/43 (100%) |
Animal | Matter | mecA | cna | eno | clfA | clfB | fnbB | icaA |
---|---|---|---|---|---|---|---|---|
Cat | urine | + | + | - | + | + | - | + |
Pig | joint | + | + | + | + | + | + | + |
Cat | skin | + | + | + | + | + | + | + |
Cow | milk | + | + | + | + | + | + | + |
Cow | milk | + | + | - | + | + | + | + |
Horse | skin | + | + | + | + | + | + | + |
Dog | skin | + | + | + | + | + | + | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bzdil, J.; Zouharova, M.; Nedbalcova, K.; Sladecek, V.; Senk, D.; Holy, O. Oxacillin (Methicillin) Resistant Staphylococci in Domestic Animals in the Czech Republic. Pathogens 2021, 10, 1585. https://doi.org/10.3390/pathogens10121585
Bzdil J, Zouharova M, Nedbalcova K, Sladecek V, Senk D, Holy O. Oxacillin (Methicillin) Resistant Staphylococci in Domestic Animals in the Czech Republic. Pathogens. 2021; 10(12):1585. https://doi.org/10.3390/pathogens10121585
Chicago/Turabian StyleBzdil, Jaroslav, Monika Zouharova, Katerina Nedbalcova, Vladimir Sladecek, David Senk, and Ondrej Holy. 2021. "Oxacillin (Methicillin) Resistant Staphylococci in Domestic Animals in the Czech Republic" Pathogens 10, no. 12: 1585. https://doi.org/10.3390/pathogens10121585