Optimization of DNA Extraction from Field-Collected Mammalian Whole Blood on Filter Paper for Trypanosoma cruzi (Chagas Disease) Detection
Abstract
1. Introduction
2. Results
2.1. Optimization with T. cruzi-Spiked Canine WB Samples
2.2. Optimization with Skunk WB Samples
3. Discussion
4. Materials and Methods
4.1. Samples
4.2. Canine WB Samples Spiked with T. cruzi
4.3. DNA Extraction from Skunk WB Samples
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Bern, C.; Messenger, L.A.; Whitman, J.D.; Maguire, J.H. Chagas Disease in the United States: A Public Health Approach. Clin. Microbiol. Rev. 2019, 33, e00023-19. [Google Scholar] [CrossRef]
- World Health Organization. Chagas Disease (American Trypanosomiasis), Fact Sheet No. 340. 2020. Available online: https://www.who.int/en/news-room/fact-sheets/detail/chagas-disease-(american-trypanosomiasis) (accessed on 19 November 2020).
- Hanford, E.J.; Zhan, F.B.; Lu, Y.; Giordano, A. Chagas disease in Texas: Recognizing the significance and implications of evidence in the literature. Soc. Sci. Med. 2007, 65, 60–79. [Google Scholar] [CrossRef]
- Sarkar, S.; Strutz, S.E.; Frank, D.M.; Rivaldi, C.L.; Sissel, B.; Sánchez-Cordero, V. Chagas disease risk in Texas. PLoS Negl. Trop. Dis. 2010, 4, e836. [Google Scholar] [CrossRef] [PubMed]
- Hotez, P.J.; Bottazzi, M.E.; Dumonteil, E.; Valenzuela, J.G.; Kamhawi, S.; Ortega, J.; Rosales, S.P.D.L.; Cravioto, M.B.; Tapia-Conyer, R. Texas and Mexico: Sharing a Legacy of Poverty and Neglected Tropical Diseases. PLoS Negl. Trop. Dis. 2012, 6, e1497. [Google Scholar] [CrossRef] [PubMed]
- Hotez, P.J.; Dumonteil, E.; Woc-Colburn, L.; Serpa, J.A.; Bezek, S.; Edwards, M.S.; Hallmark, C.J.; Musselwhite, L.W.; Flink, B.J.; Bottazzi, M.E. Chagas disease: “The new HIV/AIDS of the Americas”. PLoS Negl. Trop. Dis. 2012, 6, e1498. [Google Scholar] [CrossRef] [PubMed]
- Daszak, P.; Cunningham, A.A.; Hyatt, A.D. Emerging infectious diseases of wildlife threats to endangerment. Conserv. Biol. 2000, 20, 1349–1357. [Google Scholar]
- Cunningham, A.A.; Daszak, P.; Wood, J.L. One Health, emerging infectious diseases and wildlife: Two decades of progress? Philos. Trans. R. Soc. B Biol. Sci. 2017, 372, 20160167. [Google Scholar] [CrossRef]
- Bereczky, S.; Färnert, A.; Mårtensson, A.; Gil, J.P. Short report: Rapid dna extraction from archive blood spots on filter paper for genotyping of plasmodium falciparum. Am. J. Trop. Med. Hyg. 2005, 72, 249–251. [Google Scholar] [CrossRef]
- Lim, M.D. Dried Blood Spots for Global Health Diagnostics and Surveillance: Opportunities and Challenges. Am. J. Trop. Med. Hyg. 2018, 99, 256–265. [Google Scholar] [CrossRef]
- Gyapong, J.; Gyapong, M.; Yellu, N.; Anakwah, K.; Amofah, G.; Bockarie, M.; Adjei, S. Integration of control of neglected tropical diseases into health-care systems: Challenges and opportunities. Lancet 2010, 375, 160–165. [Google Scholar] [CrossRef]
- Ehrenberg, J.P.; Zhou, X.-N.; Fontes, G.; Rocha, E.M.M.; Tanner, M.; Utzinger, J. Strategies supporting the prevention and control of neglected tropical diseases during and beyond the COVID-19 pandemic. Infect. Dis. Poverty 2020, 9, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Piorkowski, G.; Baronti, C.; de Lamballerie, X.; de Fabritus, L.; Bichaud, L.; Pastorino, B.; Bessaud, M. Development of generic Taqman PCR and RT-PCR assays for the detection of DNA and mRNA of β-actin-encoding sequences in a wide range of animal species. J. Virol. Methods 2014, 202, 101–105. [Google Scholar] [CrossRef]
- Piron, M.; Fisa, R.; Casamitjana, N.; López-Chejade, P.; Puig, L.; Vergés, M.; Gascon, J.; Prat, J.G.I.; Portús, M.; Sauleda, S. Development of a real-time PCR assay for Trypanosoma cruzi detection in blood samples. Acta Trop. 2007, 103, 195–200. [Google Scholar] [CrossRef]
- Qamar, W.; Khan, M.R.; Arafah, A. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method. Saudi J. Biol. Sci. 2017, 24, 1465–1469. [Google Scholar] [CrossRef] [PubMed]
- Stowell, S.M.L.; Bentley, E.G.; Gagne, R.B.; Gustafson, K.D.; Rutledge, L.Y.; Ernest, H.B. Optimal DNA extractions from blood on preservation paper limits conservation genomic but not conservation genetic applications. J. Nat. Conserv. 2018, 46, 89–96. [Google Scholar] [CrossRef]
- Michaud, V.; Gil, P.; Kwiatek, O.; Prome, S.; Dixon, L.; Romero, L.; Le Potier, M.-F.; Arias, M.; Couacy-Hymann, E.; Roger, F.; et al. Long-term storage at tropical temperature of dried-blood filter papers for detection and genotyping of RNA and DNA viruses by direct PCR. J. Virol. Methods 2007, 146, 257–265. [Google Scholar] [CrossRef]
- Sacks, B.N.; Brown, S.K.; Ernest, H.B. Population structure of California coyotes corresponds to habitat-specific breaks and illuminates species history. Mol. Ecol. 2004, 13, 1265–1275. [Google Scholar] [CrossRef]
- Kashiwagi, T.; Maxwell, E.A.; Marshall, A.; Christensen, A.B. Evaluating manta ray mucus as an alternative DNA source for population genetics study: Underwater-sampling, dry-storage and PCR success. PeerJ 2015, 3, e1188. [Google Scholar] [CrossRef]
- Nunziata, S.O.; Wallenhorst, P.; Barrett, M.A.; Junge, R.E.; Yoder, A.D.; Weisrock, D.W. Population and conserva-tion genetics in an Endangered lemur, Indri indri, across three forest reserves in Madagascar. Int. J. Primatol. 2016, 37, 688–702. [Google Scholar] [CrossRef]
- Stowell, S.M.L.; Gagne, R.B.; McWhirter, D.; Edwards, W.; Ernest, H.B. Bighorn sheep genetic structure in Wyoming reflects geography and management. J. Wildl. Manag. 2020, 84, 1072–1090. [Google Scholar] [CrossRef]
- Forzán, M.; Wood, J. Low detection of ranavirus dna in wild postmetamorphic green frogs, rana (lithobates) clamitans, despite previous or concurrent tadpole mortality. J. Wildl. Dis. 2013, 49, 879–886. [Google Scholar] [CrossRef]
- LeClaire, S.; Menard, S.; Berry, A. Molecular characterization of Babesia and Cytauxzoon species in wild South-African meerkats. Parasitology 2014, 142, 543–548. [Google Scholar] [CrossRef] [PubMed]
- Lindstrom, B.; Ericsson, O.; Alvan, G.; Rombo, L.; Ekman, L.; Rais, M.; Sjoqvist, F. Determination of chloroquine and its de-sethyl metabolite in whole blood: An application for samples collected in capillary tubes and dried on filter paper. Ther. Drug Monit. 1985, 7, 207–210. [Google Scholar] [CrossRef] [PubMed]
- Färnert, A.; Arez, A.P.; Correia, A.T.; Björkman, A.; Snounou, G.; Rosário, V.D. Sampling and storage of blood and the detection of malaria parasites by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 1999, 93, 50–53. [Google Scholar] [CrossRef] [PubMed]
- Mfuh, K.O.; Yunga, S.T.; Esemu, L.F.; Bekindaka, O.N.; Yonga, J.; Djontu, J.C.; Mbakop, C.D.; Taylor, D.W.; Nerurkar, V.R.; Leke, R.G.F. Detection of Plasmodium falciparum DNA in saliva samples stored at room temperature: Potential for a non-invasive saliva-based diagnostic test for malaria. Malar. J. 2017, 16, 434. [Google Scholar] [CrossRef]
- Bezerra, G.S.N.; Barbosa, W.L.; da Silva, E.D.; Leal, N.C.; Medeiros, Z. Urine as a promising sample for Leishmania DNA extraction in the diagnosis of visceral leishmaniasis—A review. Braz. J. Infect. Dis. 2019, 23, 111–120. [Google Scholar] [CrossRef]
- Ronca, S.E.; Gulas-Wroblewski, B.E.; Kairis, R.B.; Murray, K.O. RNA extraction techniques of different body fluids for Zika virus: Blood, genitourinary specimens, saliva, and other relevant fluids. In Zika Virus Impact, Diagnosis, Control, and Models; Academic Press: Cambridge, MA, USA, 2021; pp. 243–253. [Google Scholar]
- He, H.; Argiro, L.; Dessein, H.; Chevillard, C. Improved technique that allows the performance of large-scale SNP genotyping on DNA immobilized by FTA® technology. Infect. Genet. Evol. 2007, 7, 128–132. [Google Scholar] [CrossRef]
- Gorchakov, R.; Gulas-Wroblewski, B.E.; Ronca, S.E.; Ruff, J.C.; Nolan, M.S.; Berry, R.; Alvarado, R.E.; Gunter, S.M.; Murray, K.O. Optimizing PCR Detection of West Nile Virus from Body Fluid Specimens to Delineate Natural History in an Infected Human Cohort. Int. J. Mol. Sci. 2019, 20, 1934. [Google Scholar] [CrossRef]
- Talavera-López, C.; Messenger, L.A.; Lewis, M.D.; Yeo, M.; Reis-Cunha, J.L.; Matos, G.M.; Bartholomeu, D.C.; Calzada, J.E.; Saldaña, A.; Ramírez, J.D.; et al. Repeat-Driven Generation of Antigenic Diversity in a Major Human Pathogen, Trypanosoma cruzi. Front. Cell. Infect. Microbiol. 2021, 11. [Google Scholar] [CrossRef]


| TaqMan Assay | Primer | Sequence (5′–3′) | Probe | Sequence (5′–3′) |
|---|---|---|---|---|
| T. cruzi | Cruzi 1 | ASTCGGCTGATCGTTTTCGA | Cruzi 3 | CACACACTGGACACCAA |
| Cruzi 2 | AATTCCTCCAGCAGCGGATA | |||
| β-actin | Act. f | GTSTGGATYGGHGGHTCBATC | Act. p | ACCTTCCAGCAGATGTGGATC |
| Act. r | GAYTCRTCRTAYTCCTSCTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gulas-Wroblewski, B.E.; Kairis, R.B.; Gorchakov, R.; Wheless, A.; Murray, K.O. Optimization of DNA Extraction from Field-Collected Mammalian Whole Blood on Filter Paper for Trypanosoma cruzi (Chagas Disease) Detection. Pathogens 2021, 10, 1040. https://doi.org/10.3390/pathogens10081040
Gulas-Wroblewski BE, Kairis RB, Gorchakov R, Wheless A, Murray KO. Optimization of DNA Extraction from Field-Collected Mammalian Whole Blood on Filter Paper for Trypanosoma cruzi (Chagas Disease) Detection. Pathogens. 2021; 10(8):1040. https://doi.org/10.3390/pathogens10081040
Chicago/Turabian StyleGulas-Wroblewski, Bonnie E., Rebecca B. Kairis, Rodion Gorchakov, Anna Wheless, and Kristy O. Murray. 2021. "Optimization of DNA Extraction from Field-Collected Mammalian Whole Blood on Filter Paper for Trypanosoma cruzi (Chagas Disease) Detection" Pathogens 10, no. 8: 1040. https://doi.org/10.3390/pathogens10081040
APA StyleGulas-Wroblewski, B. E., Kairis, R. B., Gorchakov, R., Wheless, A., & Murray, K. O. (2021). Optimization of DNA Extraction from Field-Collected Mammalian Whole Blood on Filter Paper for Trypanosoma cruzi (Chagas Disease) Detection. Pathogens, 10(8), 1040. https://doi.org/10.3390/pathogens10081040

