Emergence of IncHI2 Plasmid-Harboring blaNDM-5 from Porcine Escherichia coli Isolates in Guangdong, China
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Bacterial Collection, Species Identification, and Molecular Detection of Carbapenemase Genes
4.2. Conjugation and Antimicrobial Susceptibility Testing
4.3. Molecular Analysis of blaNDM-5-Positive Isolates
4.4. Whole-Genome Sequence and Plasmid Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Breilh, D.; Texier-Maugein, J.; Allaouchiche, B.; Saux, M.C.; Boselli, E. Carbapenems. J. Chemother. 2013, 25, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Guducuoglu, H.; Gursoy, N.C.; Yakupogullari, Y.; Parlak, M.; Karasin, G.; Sunnetcioglu, M.; Otlu, B. Hospital outbreak of a colistin-resistant, NDM-1- and OXA-48-producing Klebsiella Pneumoniae: High mortality from pandrug resistance. Microb. Drug Resist. 2018, 24, 966–972. [Google Scholar] [CrossRef]
- Doi, Y. Treatment options for carbapenem-resistant gram-negative bacterial infections. Clin. Infect. Dis. 2019, 69, S565–S575. [Google Scholar] [CrossRef] [Green Version]
- Cao, T.; Liu, Y.; Li, Y.; Wang, Y.; Shen, Z.; Shao, B.; Walsh, T.R.; Shen, J.; Wang, S. A public health concern: Emergence of carbapenem-resistant Klebsiella pneumoniae in a public transportation environment. J. Antimicrob. Chemother. 2020, 75, 2769–2772. [Google Scholar] [CrossRef]
- Nordmann, P.; Poirel, L.; Walsh, T.R.; Livermore, D.M. The emerging NDM carbapenemases. Trends Microbiol. 2011, 19, 588–595. [Google Scholar] [CrossRef] [PubMed]
- Bi, R.; Kong, Z.; Qian, H.; Jiang, F.; Kang, H.; Gu, B.; Ma, P. High prevalence of blaNDM variants among carbapenem-resistant Escherichia coli in northern Jiangsu Province, China. Front. Microbiol. 2018, 9, 2704. [Google Scholar] [CrossRef] [Green Version]
- Xiang, R.; Zhang, A.Y.; Ye, X.L.; Kang, Z.Z.; Lei, C.W.; Wang, H.N. Various sequence types of Enterobacteriaceae isolated from commercial chicken farms in China and carrying the blaNDM-5 gene. Antimicrob. Agents Chemother. 2018, 62, e0077918. [Google Scholar] [CrossRef] [Green Version]
- Takayama, Y.; Sekizuka, T.; Matsui, H.; Adachi, Y.; Eda, R.; Nihonyanagi, S.; Wada, T.; Matsui, M.; Suzuki, S.; Takaso, M.; et al. Characterization of the IncFII-IncFIB (pB171) plasmid carrying blaNDM-5 in Escherichia coli ST405 clinical isolate in Japan. Infect. Drug Resist. 2020, 13, 561–566. [Google Scholar] [CrossRef] [Green Version]
- Wu, W.; Feng, Y.; Tang, G.; Qiao, F.; McNally, A.; Zong, Z. NDM Metallo-β-Lactamases and their bacterial producers in health care settings. Clin. Microbiol. Rev. 2019, 32, e00115-18. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Q.; Berglund, B.; Zou, H.; Zhou, Z.; Xia, H.; Zhao, L.; Nilsson, L.E.; Li, X. Dissemination of blaNDM-5 via IncX3 plasmids in carbapenem-resistant Enterobacteriaceae among humans and in the environment in an intensive vegetable vultivation area in eastern China. Environ. Pollut. 2021, 273, 116370. [Google Scholar] [CrossRef]
- Ma, T.; Fu, J.; Xie, N.; Ma, S.; Lei, L.; Zhai, W.; Shen, Y.; Sun, C.; Wang, S.; Shen, Z.; et al. Fitness cost of blaNDM-5-carrying p3R-IncX3 plasmids in wild-type NDM-free Enterobacteriaceae. Microorganisms 2020, 8, 377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, R.; Liu, Y.; Zhang, Q.; Jin, L.; Wang, Q.; Zhang, Y.; Wang, X.; Hu, M.; Li, L.; Qi, J.; et al. The prevalence of colistin resistance in Escherichia coli and Klebsiella pneumoniae isolated from food animals in China: Coexistence of mcr-1 and blaNDM with low fitness cost. Int. J. Antimicrob. Agents 2018, 51, 739–744. [Google Scholar] [CrossRef]
- Gao, Y.; Wen, J.; Wang, S.; Xu, X.; Zhan, Z.; Chen, Z.; Bai, J.; Qu, X.; Zhang, H.; Zhang, J.; et al. Plasmid-encoded blaNDM-5 gene that confers high-level carbapenem resistance in Salmonella Typhimurium of pork origin. Infect. Drug Resist. 2020, 13, 1485–1490. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; He, J.; Li, Q.; Tang, Y.; Wang, J.; Pan, Z.; Chen, X.; Jiao, X. First detection of blaNDM-5-positive Salmonella Enterica serovar typhimurium isolated from retail pork in China. Microb. Drug Resist. 2020, 26, 434–437. [Google Scholar] [CrossRef]
- Sherchan, J.B.; Tada, T.; Shrestha, S.; Uchida, H.; Hishinuma, T.; Morioka, S.; Shahi, R.K.; Bhandari, S.; Twi, R.T.; Kirikae, T.; et al. Emergence of clinical isolates of highly carbapenem-resistant Klebsiella pneumoniae co-harboring blaNDM-5 and blaOXA-181 or -232 in Nepal. Int. J. Infect. Dis. 2020, 92, 247–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mouftah, S.F.; Pál, T.; Darwish, D.; Ghazawi, A.; Villa, L.; Carattoli, A.; Sonnevend, Á. Epidemic IncX3 plasmids spreading carbapenemase genes in the United Arab Emirates and Worldwide. Infect Drug Resist. 2019, 12, 1729–1742. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Feng, Y.; McNally, A.; Zong, Z. blaNDM-21, a New Variant of blaNDM in an Escherichia coli clinical isolate carrying blaCTX-M-55 and rmtb. J. Antimicrob. Chemother. 2018, 73, 2336–2339. [Google Scholar] [CrossRef]
- Liu, B.; Shui, L.; Zhou, K.; Jiang, Y.; Li, X.; Guan, J.; Li, Q.; Zhuo, C. Impact of plasmid-encoded H-NS-like protein on blaNDM-1-bearing IncX3 plasmid in Escherichia coli. J. Infect. Dis. 2020, 221, s229–s236. [Google Scholar] [CrossRef]
- Zhu, W.; Wang, X.; Qin, J.; Liang, W.; Shen, Z. Dissemination and stability of the blaNDM-5-carrying IncX3-Type plasmid among multiclonal Klebsiella pneumoniae isolates. mSphere 2020, 6, e00917-20. [Google Scholar] [CrossRef]
- Pérez-Vázquez, M.; Sola Campoy, P.J.; Ortega, A.; Bautista, V.; Monzón, S.; Ruiz-Carrascoso, G.; Mingorance, J.; González-Barberá, E.M.; Gimeno, C.; Aracil, B.; et al. Emergence of NDM-producing Klebsiella pneumoniae and Escherichia coli in Spain: Phylogeny, resistome, virulence and plasmids encoding blaNDM-like genes as determined by WGS. J. Antimicrob Chemother. 2019, 74, 3489–3496. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Vazquez, M.; Oteo-Iglesias, J.; Sola-Campoy, P.J.; Carrizo-Manzoni, H.; Bautista, V.; Lara, N.; Aracil, B.; Alhambra, A.; Martínez-Martínez, L.; Campos, J. Characterization of carbapenemase-producing Klebsiella oxytoca in Spain, 2016–2017. Antimicrob. Agents Chemother. 2019, 63, e02529-18. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Huang, X.Y.; Xia, Y.B.; Guo, Z.W.; Ma, Z.B.; Yi, M.Y.; Lv, L.C.; Lu, P.L.; Yan, J.C.; Huang, J.W.; et al. Clonal spread of Escherichia coli ST93 carrying mcr-1-harboring IncN1-IncHI2/ST3 plasmid among companion Animals, China. Front. Microbiol. 2018, 9, 02989. [Google Scholar] [CrossRef]
- Roberts, L.W.; Catchpoole, E.; Jennison, A.V.; Bergh, H.; Hume, A.; Heney, C.; George, N.; Paterson, D.L.; Schembri, M.A.; Beatson, S.A.; et al. Genomic analysis of carbapenemase-producing Enterobacteriaceae in Queensland reveals widespread transmission of blaIMP-4 on an IncHI2 plasmid. Microb. Genom. 2020, 6, e000321. [Google Scholar]
- Liu, B.T.; Song, F.J.; Zou, M.; Zhang, Q.D.; Shan, H. High incidence of Escherichia coli strains coharboring mcr-1 and blaNDM from chickens. Antimicrob. Agents Chemother. 2017, 61, e02347-16. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.; Xu, H.; Tang, Y.; Li, Q.; Jiao, X. A multidrug-resistant monophasic Salmonella Typhimurium co-harboring mcr-1, fosA3, blaCTX-M-14 in a transferable IncHI2 plasmid from a healthy catering worker in China. Infect. Drug Resist. 2020, 13, 3569–3574. [Google Scholar] [CrossRef] [PubMed]
- Li, X.P.; Sun, R.Y.; Song, J.Q.; Fang, L.X.; Zhang, R.M.; Lian, X.L.; Liao, X.P.; Liu, Y.H.; Lin, J.; Sun, J. Within-host heterogeneity and flexibility of mcr-1 transmission in chicken gut. Int. J. Antimicrob. Agents 2020, 55, 105806. [Google Scholar] [CrossRef] [PubMed]
- Zając, M.; Sztromwasser, P.; Bortolaia, V.; Leekitcharoenphon, P.; Cavaco, L.M.; Ziȩtek-Barszcz, A.; Hendriksen, R.S.; Wasyl, D. Occurrence and characterization of mcr-1-positive Escherichia coli isolated from food-producing animals in Poland, 2011–2016. Front. Microbiol. 2019, 10, 1753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, W.; Yan, Y.; Chen, J.; Sun, R.; Wang, Y.; Wang, T.; Feng, Z.; Peng, K.; Wang, J.; Chen, S.; et al. Genomic characterization of conjugative plasmids carrying the mcr-1 gene in foodborne and clinical strains of Salmonella and Escherichia coli. Food Control. 2021, 125, 108032. [Google Scholar] [CrossRef]
- Hammad, A.M.; Hoffmann, M.; Gonzalez-Escalona, N.; Abbas, N.H.; Yao, K.; Koenig, S.; Allué-Guardia, A.; Eppinger, M. Genomic features of colistin resistant Escherichia coli ST69 strain harboring mcr-1 on IncHI2 plasmid from raw milk cheese in Egypt. Infect. Genet. Evol. 2019, 73, 126–131. [Google Scholar] [CrossRef]
- Al-Tawfiq, J.A.; Laxminarayan, R.; Mendelson, M. How should we respond to the emergence of plasmid-mediated colistin resistance in humans and animals? Int. J. Infect Dis. 2017, 54, 77–84. [Google Scholar] [CrossRef] [Green Version]
- Campos, J.C.; Silva, M.J.F.; Santos, P.R.V.; Barros, E.M.; Pereira, M.O.; Seco, B.M.S.; Magagnin, C.M.; Leiroz, L.K.; Oliveira, T.G.M.; Faria-Júnior, C.; et al. Characterization of Tn3000, a transposon responsible for blaNDM-1 dissemination among Enterobacteriaceae in Brazil, Nepal, Morocco, and India. Antimicrob. Agents Chemother. 2015, 59, 7387–7395. [Google Scholar] [CrossRef] [Green Version]
- Ma, Z.; Liu, J.; Chen, L.; Liu, X.; Xiong, W.; Liu, J.H.; Zeng, Z. Rapid increase in the IS26-mediated cfr gene in E. coli isolates with IncP and IncX4 plasmids and Co-existing cfr and mcr-1 genes in a swine farm. Pathogens 2021, 10, 33. [Google Scholar] [CrossRef]
Strain | GDB8P64 | GDB8P64J | GDB8P65 | GDB8P65J | GDB8P70 | GDB8P70J | GDB8P75 | GDB8P75J | GDB8P77 | GDB8P77J | E. coli J53 | E. coli 25922 |
---|---|---|---|---|---|---|---|---|---|---|---|---|
MLST a | ST4063 | - | ST10 | - | ST2937 | - | ST48 | - | ST155 | - | - | - |
Plasmid type b | IncHI2 IncFIB IncQ1 p0111 | IncHI2 | IncX3 IncY | IncX3 | IncHI2 IncFIB IncFII IncY | IncHI2 | IncFIA IncR IncFII IncX3 | IncX3 | IncFIB IncN IncX3 p0111 | IncX3 | - | - |
Transfer frequencies c | 5.70 × 10−6 | - | 0.15 × 10−6 | - | 5.98 × 10−6 | - | 2.32 × 10−6 | - | 0.68 × 10−6 | - | - | - |
MIC d | ||||||||||||
AMP | >128 | >128 | >128 | >128 | >128 | >128 | >128 | >128 | >128 | >128 | 4 | 4 |
CTX | >64 | >64 | >64 | >64 | >64 | >64 | >64 | >64 | >64 | >64 | 0.06 | 0.03 |
CAZ | >64 | >64 | >64 | >64 | >64 | >64 | >64 | >64 | >64 | >64 | 0.06 | 0.06 |
MEM | 8 | 2 | 16 | 4 | 8 | 2 | 16 | 4 | 16 | 4 | 0.016 | 0.016 |
GEN | 4 | 0.5 | 0.5 | 0.5 | 4 | 0.5 | 0.5 | 0.25 | 0.5 | 0.25 | 0.25 | 0.25 |
AMI | 1 | 0.5 | 4 | 0.25 | 2 | 0.5 | 2 | 0.5 | 2 | 0.5 | 0.5 | 0.5 |
NEO | 64 | 0.5 | 1 | 0.5 | 64 | 0.5 | 1 | 0.5 | 32 | 1 | 0.5 | 1 |
APR | >128 | 1 | 4 | 1 | >128 | 1 | 4 | 1 | 4 | 1 | 1 | 1 |
DOX | 32 | 0.25 | 64 | 0.5 | 32 | 0.5 | 64 | 0.5 | 32 | 0.5 | 0.5 | 1 |
TIG | 1 | 0.06 | 1 | 0.06 | 1 | 0.06 | 1 | 0.06 | 0.5 | 0.06 | 0.06 | 0.06 |
FLR | 128 | 64 | >128 | 2 | >128 | 128 | >128 | 2 | >128 | 4 | 2 | 2 |
CL | 0.25 | 0.125 | 0.25 | 0.125 | 0.25 | 0.125 | 0.25 | 0.125 | 0.25 | 0.125 | 0.125 | 0.125 |
ENR | 32 | 0.5 | 1 | 0.016 | 16 | 0.5 | 2 | 0.016 | 16 | 0.016 | 0.016 | 0.008 |
CIP | 8 | 0.25 | 0.5 | 0.008 | 8 | 0.25 | 2 | 0.008 | 8 | 0.004 | 0.008 | 0.008 |
SXT | >64/1216 | 4/76 | >64/1216 | <0.25/4.75 | >64/1216 | 8/152 | >64/1216 | <0.25 | >64/1216 | <0.25/4.75 | <0.25/4.75 | <0.25/4.75 |
Name | Prime Sequence (5′ to 3′) | Target Fragment | Reference |
---|---|---|---|
umuC-tat | F:GCGTAGCGTTTCCATAGCGG | 1912 bp | This study |
R:GTTGACGGGTCTTTGGTGCT | |||
∆Tn2-hp | F:TGAAATGGCATGGGAATGAG | 1294 bp | This study |
R:TTTCTGCGACAGTGATAGCG | |||
R:GCTTTTGAAACTGTCGCACCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, Z.; Zeng, Z.; Liu, J.; Liu, C.; Pan, Y.; Zhang, Y.; Li, Y. Emergence of IncHI2 Plasmid-Harboring blaNDM-5 from Porcine Escherichia coli Isolates in Guangdong, China. Pathogens 2021, 10, 954. https://doi.org/10.3390/pathogens10080954
Ma Z, Zeng Z, Liu J, Liu C, Pan Y, Zhang Y, Li Y. Emergence of IncHI2 Plasmid-Harboring blaNDM-5 from Porcine Escherichia coli Isolates in Guangdong, China. Pathogens. 2021; 10(8):954. https://doi.org/10.3390/pathogens10080954
Chicago/Turabian StyleMa, Zhenbao, Zhenling Zeng, Jiao Liu, Chang Liu, Yu Pan, Yanan Zhang, and Yafei Li. 2021. "Emergence of IncHI2 Plasmid-Harboring blaNDM-5 from Porcine Escherichia coli Isolates in Guangdong, China" Pathogens 10, no. 8: 954. https://doi.org/10.3390/pathogens10080954