Unusual Localization of Hysterothylacium Incurvum in Xiphias gladius (Linnaeus 1758) Caught in the Atlantic Ocean
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Parasitological Assessment
2.2. Molecular Analysis
2.2.1. DNA Extraction from Parasites
2.2.2. Polymerase Chain Reaction and Sequence Analysis
Gene | Forward Primer Sequence | Reverse Primer Sequence | Size (bp) | Reference |
---|---|---|---|---|
ITS regions | GTAGGTGAACCTGCGGAAGGATCATT | TTAGTTTCTTTTCCTCCGCT | 900 | Pekmezci, G.Z., Yardimci, B. [25] |
rrnS | TTGTTCCAG AATAATCGGCTAGACTT | TCTACTTTACTACAACTTACTCC | 530 | D’Amelio et al. [26] |
cox2 | TTTCTAGTTATATAGATTGRTTYAT | CACCAACTCTTAAAATTATC | 629 | Quiazon et al. [27] |
3. Results
Molecular Identification of Hysterothylacium sp.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Alvarado Bremer, J.; Hinton, M.G.; Greig, T.W. Evidence of spatial genetic heterogeneity in Pacific swordfish (Xiphias gladius) revealed by the analysis of Idh-A sequences. Bull. Mar. Sci. 2006, 79, 493–503. [Google Scholar]
- Chow, S.; Clarke, S.; Nakadate, M.; Okazaki, M. Boundary between north and south Atlantic populations of the swordfish (Xiphias gladius) inferred by a single nucleotide polymorphism at calmodulin gene intron. Mar. Biol. 2007, 152, 87–93. [Google Scholar] [CrossRef]
- Garcia, A.; Cecchetti, S.; Santos, M.N.; Mattiucci, S.; Nascetti, G.; Cimmaruta, R. Population structure of Atlantic Swordfish (Xiphias gladius L. 1758) (Teleostea, Xiphiidae) using mitochondrial DNA analysis: Implications for fisheries management. Anim. Biodivers. Cons. 2011, 34, 133–140. [Google Scholar] [CrossRef]
- Mattiucci, S.; Farina, V.; Garcia, A.; Santos, M.N.; Mariniello, L.; Nascetti, G. Metazoan parasitic infections of swordfish (Xiphias gladius L., 1758) from the Mediterranean Sea and Atlantic Gibraltar waters: Implications for stock assessment. Col. Vol. Sci. Pap. ICCAT 2005, 58, 1470–1482. [Google Scholar]
- Garcia, A.; Santos, M.N.; Damiano, S.; Nascetti, G.; Mattiucci, S. The metazoan parasites of swordfish from Atlantic tropical-equatorial waters. J. Fish Biol. 2008, 73, 2274–2287. [Google Scholar] [CrossRef]
- Castro-Pampillòn, J.A.; Rodrìguez-Domìnguez, H.; Soto-Bùa, M.; Mejuto-Garcìa, J.; Arias Fernandez, C.; Garcìa-Estèvez, J.M. Parasites of swordfish from the Gulf of Guinea. J. Parasitol. 2002, 88, 188–189. [Google Scholar] [CrossRef]
- Kotoulas, G.; Magoulas, A.; Tsimenides, N.; Zouros, E. Marked mitochondrial DNA differences between Mediterranean and Atlantic populations of the swordfish, Xiphias gladius. Mol. Ecol. 1995, 4, 473–481. [Google Scholar] [CrossRef]
- De la Serna, J.M.; Alot, E.; Godoy, M.D. Analysis preliminar de la madurez sexual del pez espada (Xiphias gladius) en el area Atlantica proxima al estrecho de Gibraltar. Col. Vol. Sci. Pap. ICCAT 1992, 39, 522–537. [Google Scholar]
- Marcogliese, D.J. Parasites of the superorganism: Are they indicators of ecosystem health? Int. J. Parasitol. 2005, 35, 705–716. [Google Scholar] [CrossRef]
- Mackenzie, K. Parasites as indicators of host populations. Int. J. Parasitol. 1987, 17, 345–352. [Google Scholar] [CrossRef]
- Smith, P.J.; Diggles, B.; Kim, S. Evaluation of parasite markers to access swordfish stock structure. In Proceedings of the Scientific Committee Third Regular Session, Honolulu, HI, USA, 13–24 August 2007. [Google Scholar]
- Rajan, D.K.; Ravichandran, S.; Venmathi Maran, B.A. First record of the Gloiopotes huttoni (Thomson, 1890) (Copepoda: Caligidae) parasitic on the swordfish Xiphias gladius along the southeast coast of India. J. Parasit. Dis. 2018, 42, 458–461. [Google Scholar] [CrossRef]
- Bacevičius, E.; Karalius, S. A survey of the data on swordfish (Xiphias gladius L.) in the southern and southeastern Baltic Sea. Bull. Sea Fish. Inst. 2005, 2, 63–72. [Google Scholar]
- Öktener, A.; Trilles, J.P.; Leonardos, I. Five Ectoparasites from Turkish fishes. Turk. J. Parasitol. 2007, 31, 154–157. [Google Scholar]
- Mattiucci, S.; Garcia, A.; Cipriani, P.; Santos, M.N.; Nascetti, G.; Cimmaruta, R. Metazoan parasite infection in the swordfish, Xiphias gladius, from the Mediterranean Sea and comparison with Atlantic populations: Implications for its stock characterization. Parasite 2014, 21, 35. [Google Scholar] [CrossRef] [Green Version]
- Llarena-Reino, M.; Abollo, E.; Pascuala, S. Morphological and genetic identification of Pennella instructa (Copepoda: Pennellidae) on Atlantic swordfish (Xiphias gladius, L. 1758). Fish. Res. 2019, 209, 178–185. [Google Scholar] [CrossRef]
- Mugetti, D.; Colombino, E.; Menconi, V.; Garibaldi, F.; Mignone, W.; Gustinelli, A.; Prearo, M.; Guarda, F.; Capucchio, M.T. Unusual Localization of Pennella Sp. in Swordfish (Xiphias gladius) Hearts. Animals 2021, 11, 1757. [Google Scholar] [CrossRef]
- Dartnall, H.J.C.; Walkey, M. Parasites of marine sticklebacks. J. Fish Biol. 1979, 14, 471–474. [Google Scholar] [CrossRef]
- Huizinga, H.W. The life cycle of Contracaecum multipapillatum (Von Drasche, 1882) Lucker, 1941 (Nematoda: Heterochelidae). J. Parasitol. 1967, 53, 368–375. [Google Scholar] [CrossRef]
- Margolis, L.; Arthur, J.H. Synopsis of the parasites of fishes of Canada. In Bulletin of the Fisheries Research Board of Canada; Department of Fisheries and Oceans: Ottawa, ON, Canada, 1979; Volume 199, pp. 1–269. [Google Scholar]
- Dick, T.A. The atrium of the fish heart as a site for Contracaecum spp. larvae. J. Wildl. Dis. 1987, 23, 328–330. [Google Scholar] [CrossRef]
- Bruce, N.L.; Cannon, L.R.G. Hysterothylacium, Iheringascaris and Maricostula new genus, nematodes (Ascaridoidea) from Australian pelagic marine fishes. J. Nat. Hist. 1989, 23, 1397–1441. [Google Scholar] [CrossRef]
- Bush, A.O.; Lafferty, K.D.; Lotz, J.M.; Shostak, A.W. Parasitology Meets Ecology on Its Own Terms: Margolis et al. Revisited. J. Parasitol. 1997, 83, 575–583. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Pekmezci, G.Z.; Yardimci, B. On the occurrence and molecular identification of Contracaecum larvae (Nematoda: Anisakidae) in Mugil cephalus from Turkish waters. Parasitol. Res. 2019, 118, 1393–1402. [Google Scholar] [CrossRef]
- D’Amelio, S.; Barros, N.B.; Ingrosso, S.; Fauquier, D.A.; Russo, R.; Paggi, L. Genetic characterization of members of the genus Contracaecum (Nematoda: Anisakidae) from fish-eating birds from west-central Florida, USA, with evidence of new species. Parasitology 2007, 134, 1041–1051. [Google Scholar] [CrossRef]
- Quiazon, K.M.; Yoshinaga, T.; Ogawa, K.; Yukami, R. Morphological differences between larvae and in vitro-cultured adults of Anisakis simplex (sensu stricto) and Anisakis pegreffii (Nematoda: Anisakidae). Parasitol. Int. 2008, 57, 83–89. [Google Scholar] [CrossRef]
- Al Gabbani, Q.; Thagfan, F.; Al-Quraishy, S.; Banaeem, M.; Alsaleh, T.; Alotaibi, M.; Abdel-Gaber, R. Morphological and molecular characterizations for the developmental stages of Hysterothylacium species infecting Argyrops spinifer. J. King Saud Univ. Sci. 2021, 33, 101590. [Google Scholar] [CrossRef]
- Ramdani, S.; Trilles, J.P.; Ramdane, Z. Metazoan Parasites Infecting Xiphias gladius From the Eastern Coast of Algeria (Sw Mediterranean Sea). Zoodiversity 2021, 55, 505–518. [Google Scholar] [CrossRef]
- Costa, A.; Graci, S.; Cammilleri, G.; Buscemi, M.D.; Collura, R.; Vella, A.; Ferrantelli, V. Molecular Identification of Hysterothylacium spp. In Fishes from the Southern Mediterranean Sea (Southern Italy). J. Parasitol. 2018, 104, 398–406. [Google Scholar] [CrossRef]
- Kabata, Z. Crustacea as enemies of fishes. In Diseases of Fishes, 1st ed.; Sniesko, S.F., Axelrod, H.R., Eds.; TFH Publications: New Neptune City, NJ, USA, 1970; Volume 1, p. 171. [Google Scholar]
- Schuurmans Stekhoven, J.H. Beobachtungen zur Morphologie und Physiologie der Lernaeocera branchialis und Lernaeocera lusci. Zeitschrift. Parasitenkunde 1936, 8, 659–696. [Google Scholar] [CrossRef]
- Valero, A.; Terrados, S.; Díaz, V.; Reguera, V.; Lozano, J. Determination of IgE in the serum of patients with allergic reactions to four species of fish-parasite anisakids. J. Investig. Allergy Clin. Immunol. 2003, 13, 94–98. [Google Scholar]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Benedetto, G.; Corti, I.; Malandra, R.; Riolo, K.; Giannetto, A.; Gaglio, G. Unusual Localization of Hysterothylacium Incurvum in Xiphias gladius (Linnaeus 1758) Caught in the Atlantic Ocean. Pathogens 2022, 11, 1315. https://doi.org/10.3390/pathogens11111315
De Benedetto G, Corti I, Malandra R, Riolo K, Giannetto A, Gaglio G. Unusual Localization of Hysterothylacium Incurvum in Xiphias gladius (Linnaeus 1758) Caught in the Atlantic Ocean. Pathogens. 2022; 11(11):1315. https://doi.org/10.3390/pathogens11111315
Chicago/Turabian StyleDe Benedetto, Giovanni, Ivan Corti, Renato Malandra, Kristian Riolo, Alessia Giannetto, and Gabriella Gaglio. 2022. "Unusual Localization of Hysterothylacium Incurvum in Xiphias gladius (Linnaeus 1758) Caught in the Atlantic Ocean" Pathogens 11, no. 11: 1315. https://doi.org/10.3390/pathogens11111315