Next Article in Journal
Comparative Genomic Analysis of a Multidrug-Resistant Staphylococcus hominis ShoR14 Clinical Isolate from Terengganu, Malaysia, Led to the Discovery of Novel Mobile Genetic Elements
Previous Article in Journal
Ticks, Fleas, and Harboured Pathogens from Dogs and Cats in Cyprus
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 11
Issue 12
10.3390/pathogens11121404
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Staphylococcus aureus from Subclinical Cases of Mastitis in Dairy Cattle in Poland, What Are They Hiding? Antibiotic Resistance and Virulence Profile

by
Edyta Kaczorek-Łukowska
1,*,
Joanna Małaczewska
1,
Patrycja Sowińska
2,
Marta Szymańska
2,
Ewelina Agnieszka Wójcik
2 and
Andrzej Krzysztof Siwicki
1
1
Department of Microbiology and Clinical Immunology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Oczapowskiego 13, 10-719 Olsztyn, Poland
2
Proteon Pharmaceuticals, Tylna 3a, 90-364 Łódź, Poland
*
Author to whom correspondence should be addressed.
Pathogens 2022, 11(12), 1404; https://doi.org/10.3390/pathogens11121404
Submission received: 24 October 2022 / Revised: 14 November 2022 / Accepted: 17 November 2022 / Published: 23 November 2022
(This article belongs to the Section Bacterial Pathogens)
Versions Notes

Abstract

:
Bovine mastitis is a common disease worldwide, and staphylococci are one of the most important etiological factors of this disease. Staphylococcus aureus show adaptability to new conditions, by which monitoring their virulence and antibiotic resistance mechanisms is extremely important, as it can lead to the development of new therapies and prevention programs. In this study, we analyzed Staphylococcus aureus (n = 28) obtained from dairy cattle with subclinical mastitis in Poland. The sensitivity of the isolated strains to antibiotics were confirmed by the disc diffusion method. Additionally, minimum inhibitory concentration values were determined for vancomycin, cefoxitin and oxacillin. Genotyping was performed by two methods: PCR melting profile and MLVF-PCR (multiple-locus variable-number tandem-repeat fingerprinting). Furthermore, the presence of antibiotic resistance and virulence genes were checked using PCR reactions. The analyzed strains showed the greatest resistance to penicillin (57%), oxytetracycline (25%) and tetracycline (18%). Among the analyzed staphylococci, the presence of 9 of 15 selected virulence-related genes was confirmed, of which the icaD, clfB and sea genes were confirmed in all staphylococci. Biofilm was observed in the great majority of the analyzed bacteria (at least 70%). In the case of genotyping among the analyzed staphylococci (combined analysis of results from two methods), 14 patterns were distinguished, of which type 2 was the dominant one (n = 10). This study provides new data that highlights the importance of the dominance of biofilm over antibiotic resistance among the analyzed strains.

1. Introduction

Mastitis can be caused by more than 200 aetiological factors, of which one of the more frequently mentioned is Staphylococcus aureus. This bacterium is classified as a contagious pathogen, which means that it spreads in the herd due to improper hygiene on the farm. This pathogen can cause chronic infections that are difficult to cure with conventional therapy and, as a result, lead to enormous economic losses in the dairy industry [1]. S. aureus usually causes subclinical mastitis, which is very difficult to treat (due to ahigh seeding rate of infected animals and chronic recurrent infections). Probably, this is related to the numerous virulence factors present in this pathogen, such as the ability to produce biofilm, the production of toxins, or various enzymes designed to damage and better occupy the infected area [2,3]. On the other hand, it is related to the occurrence of antibiotic resistance among these bacteria, which has arisen from the overuse of these active substances in veterinary medicine and in agriculture [1,3,4]. Especially dangerous are methicillin-resistant staphylococci strains, which pose a direct threat to humans (through food-borne pathogens), and these, unfortunately, are observed more frequently each year in veterinary medicine [4]. Although the problem of S. aureus in dairy cattle has been known for years, a perfect preventive therapy or treatment has not yet been developed. This is due to the rapid genetic variability of this pathogen and the lack of knowledge about the interaction between the bacterium and the host [5,6]. Studies from around the world have shown that there is no clear pattern in the distribution of virulence genes (adhesins or toxins) among bovine isolates. Depending on the area from which the strains originate, a different antibiotic resistance profile can be observed. Such a situation significantly complicates the results of mastitis prevention research and the development of new therapies, and further research towards a better understanding of these bacteria should be conducted. Only through this will it finally be possible to develop methods for inhibiting the development of these pathogens. Hence, the aim of our study was to examine what mechanisms of virulence and antibiotic resistance are dominant in S. aureus isolated in northeastern Poland among dairy cattle with subclinical mastitis.

2. Materials and Methods

2.1. Milk Samples

All milk samples were collected from dairy cattle with subclinical mastitis from various farms located in northeast Poland (Warmia and Mazury voivodeship) between 2016 and 2019. To standardize the study group, only staphylococci from subclinical cases were selected for the study. Subclinical milk samples were included in the study if there were no clinical signs and the somatic cell count (SCC) was higher than 400,000 cells/mL.

2.2. Bacteriological Identification

Milk samples (0.01 mL) for bacteriological examination were transferred with a calibrated inoculation loop onto Columbia agar medium supplemented with 5% defibrinated sheep blood (Oxoid, Basingstoke, UK) and Chapman medium (Oxoid, Basingstoke, UK). The plates were incubated at 37 °C under aerobic conditions for 48 h. The grown isolates were subjected to microbiological analysis, which included evaluation of the morphology of bacterial colonies, Gram staining, and selected biochemical tests (tests for catalase, coagulase and selected latex tests (Staphytect Plus) (Oxoid, Basingstoke, UK)). The final identification of S. aureus was confirmed by PCR of the nuc and femA genes [7] (primers in Supplementary Table S1). In total, 28 S. aureus strains were included in this study. To avoid testing epidemiologically related isolates, only one isolate per dairy farm was included.

2.3. Antimicrobial Susceptibility Testing—Disc Diffusion Method

The sensitivity of the isolated strains to antibiotics were confirmed by the disc diffusion method [8] with 21 antimicrobials commonly used in Poland for veterinary treatment: amoxicillin + clavulanic acid (20 + 10 µg) (AMC), enrofloxacin (5 µg) (ENR), clindamycin (2 µg) (CL), tetracycline (30 µg) (TE), erythromycin (15 µg) (E), ceftriaxone (30 µg) (CEQ), cloxacillin (5 µg) (OB), neomycin (30 µg) (N), penicillin G (10U) (P), marbofloxacin (MAR), ceftiofur (30 µg) (EFT), bacitracin (10 µg) (B), cefamandole (30 µg) (MA), cefoperazone (75 µg) (CFP), gentamycin (10 µg) (CN), oxytetracycline (30 µg) (OT), penicillin/novobiocin (40 µg) (PNV), trimethoprim/sulfamethoxazole 1:19 (25 µg) (SXT), ubrolexin (CFX), rifampicin (5 µg) (RD) and cefapirin (30 μg) (CPR). All discs were purchased from Oxoid (Basingstoke, UK). The resistance to antibiotics was assessed according to the CLSI—Clinical and Laboratory Standards Institute [9] guidelines using the quality control strain Staphylococcus aureus ATCC 25923. All strains were categorized as sensitive (S), intermediate (I) or resistant (R) to the tested active substances.

2.4. Antimicrobial Susceptibility Testing—E-Test, Minimum Inhibitory Concentration (MIC)

MIC testing for oxacillin, cefoxitin and vancomycin was carried out using ready-made e-test strips (Oxoid, Basingstoke, UK) according to the manufacturer’s instructions. Mueller–Hinton BBL II agar supplemented with 2% NaCl (w/v) was used for oxacillin, while Muelle–Hinton agar without NaCl was used for the other two substances. The plates were incubated at 35 °C+/−2 °C for 18 h. Interpretation was performed according to CLSI guidelines [9].

2.5. Biofilm Formation

This experiment was performed using polystyrene microtiter plates with flat bottoms based on the techniques described by Ebrahimi et al. [10] with slight modification. All strains (n = 28) were incubated in TSB with the addition of 1% glucose under aerobic conditions at 37 °C. The results were read after 24, 48 and 72 h using an ELISA plate reader (Sunrise absorbance reader, Tecan, Austria). Each strain was analyzed in 8 wells in triplicate. Biofilm production was interpreted according to the criteria described by Stepanović et al. [11]. The mean optical density (OD) of the negative control + 3 standard deviations of the negative control was considered the cut-off (ODc = 0.188), and biofilm producers were therefore categorized as follows:
  • Not a biofilm producer: OD ≤ ODc (all strains with OD values below 0.188),
  • Weak biofilm producer: ODc < OD ≤ 2  ×  ODc (all strains with OD values above 0.188 and below 0.375),
  • Moderate biofilm producer: 2 × ODc  < OD ≤ 4  ×  ODc (all strains with OD values above 0.375 and below 0.752),
  • Strong biofilm producer: OD > 4  ×  ODc (all strains with OD values above 0.752).

2.6. DNA Isolation

Bacterial DNA was extracted using an ExtractMe DNA bacteria kit (Blirt, Gdańsk, Poland) according to the manufacturer’s recommendations. Eluted DNA concentrations and quality were measured using a BioSpectrometer (Eppendorf, Hamburg, Germany) and stored at −20 °C for further analysis.

2.7. PCR MP (PCR Melting Profile)

The PCR MP procedure, which was based on the digestion of genomic DNA with restriction enzymes and the ligation of the obtained DNA restriction fragments with an oligonucleotide adaptor, followed by PCR amplification with a reduction in the denaturation temperature during each cycle, was optimized for Staphylococcus spp. In this study, approximately 0.5 μg of DNA (25 μL) was digested with HindIII (Thermo Scientific, Waltham, MA, USA). Following incubation at 37 °C for 30 min and inactivation at 65 °C for 15 min, the ligation mix was added: 4 μL of adapter (two oligonucleotides), 2.8 μL of ligation buffer (Thermo Scientific), 0.4 μL T4 DNA ligase (5 U/L, Thermo Scientific, MA, USA) and 0.5 µL 25 mM ATP. The samples were incubated at 16 °C for 1 h and then heated in a thermoblock at 65 °C for 10 min. Afterwards, the samples were cooled at room temperature for 10 min. The PCR was carried out in a 25 μL reaction mixture containing 14.75 μL PCR grade water, 4 μL ligation product, 2.5 μL 10× PCR buffer (Shark, Blirt, Gdańsk, Poland), 1 μL 50 mM MgCl2, 2 μL of a deoxynucleoside triphosphate (dNTP) mixture, 0.5 μL (2 U) of polymerase (Hypernova Blirt, Gdańsk, Poland) and 0.25 μL of primer AD-P (CTCACTCTCAACAACGTCGACAGCTT (5′→3′). The denaturation temperature was determined during the optimization of two S. aureus strains using a gradient thermal cycler (Eppendorf Mastercycler Nexus, Hamburg, Germany) with a gradient range of 78–88 °C for the denaturation step. The PCRs were performed as follows: (i) 7 min at 72 °C—initial denaturation, releasing of unligated nucleotides; (ii) 90 s at a 78–88 °C gradient across the thermal block—denaturation, (iii) 24 cycles of denaturation at 60 s at 78–88 °C gradient across the thermal block, annealing at 72 °C for 2 min and elongation at 72 °C for 2 min 15 s, with a final 72 °C for 5 min after the last cycle. MP-PCRs for all isolates were performed as described above using the established optimal denaturation temperature of 80 °C. Each PCR product (8 μL) was run on a 1.5% agarose gel, and the amplification patterns were determined by examination on Simply Safe (EurX, Gdańsk, Poland) stained gels illuminated by UV light (Alpha Innotech, Fc8800, Markaryd, Sweden). The amplicon sizes were determined by comparing the bands with a 100-bp DNA mass ladder (Fermentas, Waltham, MA, USA).

2.8. MLVF-PCR

The MLVF (multiple-locus variable-number tandem-repeat fingerprinting) typing procedure and a set of 5 primers for the genes ClfA1, ClfB1, SdrCDE, SpaI and SspA1 were analogous to the previously published scheme for S. aureus differentiation [12].
The PCR was carried out in a 50 μL reaction mixture containing 25 μL of 2 × PCR TaqNova-RED, 0.5 µM each of primers ClfB1-F, ClfB1-R, SpaI-F, and SpaI-R, 1 µM each of primers ClfA1-F, ClfA1-R, SdrCDE-F, and SdrCDE1-R, 2 µM each of primers SspA1-F and SspA1-R, and 5 ng of template DNA. DNA fragments were amplified on a thermocycler (Eppendorf Mastercycler Nexus, Hamburg, Germany) using the following cycling conditions: (i) 30 s at 98 °C—initial denaturation, and (ii) 20 cycles of denaturation for 10 s at 98 °C, annealing at 60 °C for 30 s and elongation at 72 °C for 30 s, with a final extension at 72 °C for 5 min after the last cycle. Each PCR product (8 μL) was run on a 1.5% agarose gel, and the amplification patterns were determined by examination on Simply Safe (EurX, Gdańsk, Poland) stained gels illuminated by UV light (Alpha Innotech, Fc8800, Markaryd, Sweden). The amplicon sizes were determined by comparing the bands with a 100-bp DNA mass ladder (Fermentas, MA, USA).

2.9. PCR Detection of Antimicrobial Resistance and Virulence Genes of Staphylococcus aureus

The resistance genes for macrolides (erm(A), erm(B) and erm(C)), tetracyclines (tet(K), tet(L) and tet(M)), aminoglycosides (aad-6 and aphA-3′), beta-lactams (blaZ and mecA), sulfonamides (sul)and antiseptic resistance genes (gac and smr) were assessed by PCR. All genes were chosen in accordance with the available literature. In the case of virulence, the investigated genes were sea, seo, sen, lukM, lukd, clfA, icaA, icaC, icaB, icaD, clfB, sdrC, eno, bap and etb. Primer sequences, product sizes and annealing temperatures are summarized in Supplementary Table S1 [13,14,15,16,17,18,19,20,21,22] and Table S2 [23,24,25,26,27,28,29]. All primers were synthesized by Genomed S.A. (Warsaw, Poland). Amplification reactions were carried out with a HotStarTaq Plus Master Mix Kit (Qiagen, Hilden, Germany) in a Nexus Gradient thermocycler (Eppendorf, Hamburg, Germany). The 20-μL reaction sample contained 10 μL of HotStarTaq Plus Master Mix 2×, 1 μL of primers (final concentration 0.4 μM), 2 μL of 10× CoralLoad Concentrate (Qiagen), 4 μL of RNase-free water, and 2 μL of DNA. Cycling conditions were as follows: 95 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, annealing temperature for 30 s, and 72 °C for 60 s, with a final extension of 72 °C for 10 min. Ten microlitres of PCR product were electrophoresed on 2% agarose gel in the presence of Midori Green Advance (Nippon Genetics, Düren, Germany) at 120 V for 60 min. The results were read using the Quantum ST5 Gel Documentation System (Vilber, Eberhardzell, Germany). To confirm the specificity of the amplicons obtained, some PCR products of interest were randomly chosen and purified using a CleanUp kit (A&A Biotechnology, Gdynia, Poland) for sequencing (Genomed S.A., Warsaw, MA, Poland).

3. Results

3.1. Antimicrobial Susceptibility Testing—Phenotypic and Genotypic Assessments

The analyzed S. aureus samples showed the greatest resistance to penicillin (57%), oxytetracycline (25%) and tetracycline (18%). In contrast, they showed intermediate susceptibility to penicillin with novobiocin (75%), oxytetracycline (45%) and enrofloxacin (50%). The analyzed strains were relatively susceptible to the rest of the tested antibiotics (between 85% and 100% of the isolates were susceptible). Among the bacteria analyzed, no methicillin- or vancomycin-resistant strains were confirmed (Table 1). Of the 15 antibiotic resistance-related genes analyzed in the studied staphylococci, only two, tet(K) (64%) and blaZ (82%), were confirmed.

3.2. Detection of Virulence Genes by PCR

Among the strains analyzed, 9 of the 15 selected virulence-related genes were confirmed (Table 2). The icaD, clfB and sea genes were confirmed in all staphylococci. In 87% of the analyzed strains, the presence of the lukM, lukD and sdrC genes was confirmed, while only 3% of the S. aureus strains showed the presence of the sea and sen genes.

3.3. Biofilm Formation

Among the analyzed strains, the majority showed the ability to produce biofilms (at least 70% of the strains at each analyzed time). In the case of our study, it was observed that the number of strains capable of biofilm production and its intensification increased as the incubation time of the biofilm plates increased (Table 2).

3.4. Genotyping

Among the staphylococci analyzed, nine patterns were obtained using the PCR MP method, and ten patterns were obtained using the MLFV method. By using a combined analysis of the results from these two methods, it was possible to distinguish 14 patterns, of which type 2 was the dominant pattern (n = 10). Unfortunately, for one strain of analyzed S. aureus (ID-228), no MP PCR pattern was obtained. For all pointed isolates, the PCR MP and MLVF reactions were performed in triplicate to confirm the obtained results (Table 2, Figures S1 and S2).

4. Discussion

The introduction of prevention programs against contagious pathogens that cause mastitis in dairy cattle has resulted in a decrease in the aetiology of mastitis, and this phenomenon was also observed in the area that we analyzed [30]. Despite intensive hygienic and therapeutic efforts, S. aureus has not been completely eliminated. When infection occurs in the herd as a consequence of numerous virulence and antibiotic resistance mechanisms, this pathogen is very difficult to completely eliminate, and worse, recurrences are often observed, making staphylococcus a challenge for both veterinary doctors and dairy cow owners [31,32].
In the case of the S. aureus that we analyzed, the presence of high antibiotic resistance at both phenotypic and genotypic levels was not observed. As Arturrson et al. [2] reported, cows with subclinical mastitis caused by these staphylococci are often removed from the herd after lactation. To the best of our knowledge, such a technique is also practiced in our country, which may be the reason why antibiotic resistance is so low. Both the antibiograms and the presence of genes showed only increased resistance to tetracyclines (tet(K) 64%) and beta-lactams (blaZ 82%). These results are consistent with studies conducted in Brazil, Norway and China, where phenotypic resistance to tetracycline and penicillin was also observed [33,34]. Interestingly, in the case of research conducted by Martini et al. [33], the most common genes among the analyzed staphylococci were also found to be blaZ (97%) and tet(K) (84%). Our results suggest that both penicillin and tetracycline may have been overused in the past in the area we analyzed, making it necessary to consider whether they should be withdrawn from use in staphylococcal mastitis infections. Such a measure could prevent the spread of antibiotic resistance to tetracyclines and penicillin to other bacterial species (horizontal gene transfer).
Observing the emergence of strains of methicillin-resistant S. aureus (MRSA) and vancomycin-resistant S. aureus (VRSA) is extremely important. Initially, these strains were associated mainly with the hospital environment; for years, they have also been observed in the veterinary environment [35,36]. Among the staphylococci we analyzed, no methicillin- or vancomycin-resistant strains were confirmed. Further monitoring of this phenomenon is necessary, as the emergence of such strains among animals used for food purposes poses a direct threat to humans (food-borne pathogens).
High susceptibility to substances other than penicillins and tetracyclines is, in our opinion, a positive phenomenon that offers great opportunities in antibiotic therapy for veterinarians. Nevertheless, it should be mentioned here that high sensitivity in vitro does not guarantee therapeutic success [37]. It is estimated that in the case of infections caused by S. aureus, the chances of real or apparent cure vary from 4% to 92%, depending on factors such as the characteristics of the pathogen, the condition of the animals, herd management or treatment regimen [32,38]. Therefore, further work on developing replacement or supplementary therapies for antibiotic therapy should be carried out in the context of these bacteria.
It is well known that staphylococci have the capacity for genetic variation and adaptation to attack new species. Clones of S. aureus that are currently able to attack the udder in cattle most likely originate from clones of human origin, and this transformation has occurred gradually since the Neolithic age after the domestication of these animals, among others. To invade a new animal species, the bacterium must acquire or lose its virulence mechanisms so that it can survive anatomically and physiologically in the new location [5]. Therefore, monitoring the virulence mechanisms of staphylococci according to the infected animal species and selecting/developing prevention and treatment programs based on this is extremely important. In our study, the predominant virulence mechanism at both the phenotypic and genotypic levels was the ability of the tested strains to produce biofilms. In the case of the phenotypic study, at all three analyzed incubation times (24, 48 and 72 h), the majority of the staphylococci showed the ability to produce biofilms (above 70%). Among the biofilm-related genes, the presence of only two genes, eno and icaD, was confirmed, but interestingly, they were present in all the strains tested (including those that did not show the ability to produce biofilm). These results are partially consistent with the observations of other authors, in which some of the more frequently observed genes were icaD and eno, and the presence of these genes was not dependent on the ability to produce biofilms in vitro [39,40]. Numerous publications have shown that even if at a given moment the bacterium does not use these genes for biofilm production, in the future they may start using them due to various factors, e.g., change in temperature or time, or contact with some substance/surface [39,41,42]. In light of this information, the appearance of these genes in the strains we analyzed is already a worrisome fact, and the monitoring of this phenomenon should continue. In the case of the bacteria we analyzed, the presence of both the icaA and bap genes was not observed. These observations are consistent with the results of Gajewska et al. [40], who also analyzed S. aureus strains from dairy cattle but from a different region of Poland. In their study, the icaA gene was also not observed, and the bap gene was present in only 25% of the analyzed strains, despite the ability to produce biofilm in in vitro conditions. In our opinion, this may indicate that these genes do not play a key role in the ability to produce biofilms in the area we analyzed. As reported by Chen et al. [39], although the bap protein was first linked to the ability of staphylococci to produce biofilms, the gene encoding this protein is located on the SPIbov2 pathogenicity island, which is found in only a few S. aureus strains of bovine origin. Perhaps such strains have not occurred thus far in the area under analysis.
Additionally, it should be mentioned here that the number of nonbiofilm-forming strains decreased with the increasing incubation time. These results are consistent with those obtained by Oliverira et al. [43], in which, in addition to the demonstration of a large number of staphylococci showing the ability to produce this structure, a correlation between the result and reading time was also observed. We agree with the suggestion of those authors that different strains may have different times of biofilm production and that interpreting the results only after 24 h can significantly affect the results.
For the strains we analyzed, we used two genotyping methods to check the relatedness of the S. aureus strains isolated from dairy cattle in northeastern Poland. For the strains we analyzed, the combined method distinguished 14 types, of which 35.7% were classified as type 2. These results suggest moderate genetic variability in the area we analyzed, which is good information in the context of developing targeted preventive measures or new therapies. According to Kasela et al. [44], the use of two genotyping techniques simultaneously yields more accurate and reliable typing results for the staphylococci analyzed. This can be seen in our results, in which using only one method, 9 types (with the MP PCR method) or 10 types (with the MLFV method) were distinguished, while 14 types were distinguished using a combined analysis of the two techniques. That kind of approach seems to be reasonable solution in case of staphylococci, which are quite clonal bacteria. In that case, the use of pulsed-field gel electrophoresis (PFGE), considered to be the gold standard for bacteria differentiation, does not allow for tracing epidemiological links between Staphylococcus strains [45] as its discriminatory power is not high enough.
As mentioned earlier, staphylococci demonstrate the ability to adapt to new conditions. Therefore, monitoring their mechanisms of virulence and antibiotic resistance is extremely important, as it allows us to complete our knowledge of the pathogenesis of this pathogen and thus may contribute to the development of new more effective therapies and prevention programs in the future. In summary, in the area we analyzed, the staphylococcal isolates showed lower antibiotic resistance than virulence. Among the virulence factors, biofilm formation was dominant, and new prevention programs should be focused on this, especially since it not only affects the virulence of a given bacterium but also decreases the effectiveness of applied active substances used for the treatment of cattle.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/pathogens11121404/s1. Table S1. Primer sets used for the identification of Staphylococcus aureus, and antimicrobial resistance determinants in staphylococci isolated from subclinical cases of bovine mastitis in Poland; Table S2. Primer sets used biofilm production and other virulence factors in Staphylococcus aureus isolated from subclinical cases of bovine mastitis in Poland. Figure S1. MP-PCR HindIII profiles of Staphylococcus genomes. Figure S2. MLVF-PCR profiles of Staphylococcus genomes: marker 100bp, S. aureus_058PP2016-084PP2016, S. aureus_089PP2016-091PP2016, S. CNS_002PP201.

Author Contributions

Conceptualization, E.K.-Ł., P.S., E.A.W. and A.K.S.; collection of samples, E.K.-Ł. and J.M.; investigation, E.K.-Ł. and M.S., P.S.; writing, E.K.-Ł., A.K.S., J.M., P.S. and E.A.W.; data analysis, E.K.-Ł., J.M., P.S. and M.S. All authors have read and agreed to the published version of the manuscript.

Funding

Project financially supported by the Minister of Education and Science under the program entitled “Regional Initiative of Excellence” for the years 2019–2023, Project No. 010/RID/2018/19, amount of funding 12,000,000 PLN.

Institutional Review Board Statement

Ethical review and approval were waived for this study, due to milk samples were collected during the routine veterinary screening of animals by their owners.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, Z.; Chen, Y.; Li, X.; Wang, X.; Li, H. Detection of Antibiotic Resistance, Virulence Gene, and Drug Resistance Gene of. Microbiol. Spectr. 2022, 10, e0047122. [Google Scholar] [CrossRef] [PubMed]
  2. Artursson, K.; Söderlund, R.; Liu, L.; Monecke, S.; Schelin, J. Genotyping of Staphylococcus aureus in bovine mastitis and correlation to phenotypic characteristics. Vet. Microbiol. 2016, 193, 156–161. [Google Scholar] [CrossRef] [PubMed]
  3. Brahma, U.; Suresh, A.; Murthy, S.; Bhandari, V.; Sharma, P. Antibiotic Resistance and Molecular Profiling of the Clinical Isolates of. Microorganisms 2022, 10, 833. [Google Scholar] [CrossRef] [PubMed]
  4. Wang, D.; Wang, Z.; Yan, Z.; Wu, J.; Ali, T.; Li, J.; Lv, Y.; Han, B. Bovine mastitis Staphylococcus aureus: Antibiotic susceptibility profile, resistance genes and molecular typing of methicillin-resistant and methicillin-sensitive strains in China. Infect Genet Evol 2015, 31, 9–16. [Google Scholar] [CrossRef] [PubMed]
  5. Campos, B.; Pickering, A.C.; Rocha, L.S.; Aguilar, A.P.; Fabres-Klein, M.H.; de Oliveira Mendes, T.A.; Fitzgerald, J.R.; de Oliveira Barros Ribon, A. Diversity and pathogenesis of Staphylococcus aureus from bovine mastitis: Current understanding and future perspectives. BMC Vet. Res. 2022, 18, 115. [Google Scholar] [CrossRef]
  6. Messina, J.A.; Thaden, J.T.; Sharma-Kuinkel, B.K.; Fowler, V.G. Impact of Bacterial and Human Genetic Variation on Staphylococcus aureus Infections. PLoS Pathog. 2016, 12, e1005330. [Google Scholar] [CrossRef] [Green Version]
  7. Dziva, F.; Wint, C.; Auguste, T.; Heeraman, C.; Dacon, C.; Yu, P.; Koma, L.M. First identification of methicillin-resistant Staphylococcus pseudintermedius strains among coagulase-positive staphylococci isolated from dogs with otitis externa in Trinidad, West Indies. Infect. Ecol. Epidemiol. 2015, 5, 29170. [Google Scholar] [CrossRef]
  8. Hudzicki, J. Kirby-Bauer Disk Diffusion Susceptibility Test Protocol, American Society for Microbiology. Available online: https://asm.org/getattachment/2594ce26-bd44-47f6-8287-0657aa9185ad/Kirby-Bauer-Disk-Diffusion-Susceptibility-Test-Protocol-pdf.pdf (accessed on 10 November 2022).
  9. CLSI (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 5th ed.; CLSI Document VET01-S; CLSI: Pittsburgh, PA, USA, 2020. [Google Scholar]
  10. Ebrahimi, A.; Moatamedi, A.; Lotfalian, S.; Mirshokraei, P. Biofilm formation, hemolysin production and antimicrobial susceptibilities of Streptococcus agalactiae isolated from the mastitis milk of dairy cows in Shahrekord district, Iran. Vet. Res. Forum 2013, 4, 269–272. [Google Scholar]
  11. Stepanović, S.; Vuković, D.; Hola, V.; di Bonaventura, G.; Djukić, S.; Cirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef]
  12. Sabat, A.; Krzyszton-Russjan, J.; Strzalka, W.; Filipek, R.; Kosowska, K.; Hryniewicz, W.; Travis, J.; Potempa, J. New method for typing Staphylococcus aureus strains: Multiple-locus variable-number tandem repeat analysis of polymorphism and genetic relationships of clinical isolates. J. Clin. Microbiol. 2003, 41, 1801–1804. [Google Scholar] [CrossRef] [Green Version]
  13. Phuc Nguyen, M.C.; Woerther, P.L.; Bouvet, M.; Andremont, A.; Leclercq, R.; Canu, A. Escherichia coli as reservoir for macrolide resistance genes. Emerg. Infect. Dis. 2009, 15, 1648–1650. [Google Scholar] [CrossRef]
  14. Shopsin, B.; Mathema, B.; Alcabes, P.; Said-Salim, B.; Lina, G.; Matsuka, A.; Martinez, J.; Kreiswirth, B.N. Prevalence of agr specificity groups among Staphylococcus aureus strains colonizing children and their guardians. J. Clin. Microbiol. 2003, 41, 456–459. [Google Scholar] [CrossRef] [Green Version]
  15. Khodabandeh, M.; Mohammadi, M.; Abdolsalehi, M.R.; Alvandimanesh, A.; Gholami, M.; Bibalan, M.H.; Pournajaf, A.; Kafshgari, R.; Rajabnia, R. Analysis of Resistance to Macrolide-Lincosamide-Streptogramin B Among. Osong Public Health Res. Perspect. 2019, 10, 25–31. [Google Scholar] [CrossRef]
  16. Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef]
  17. Morvan, A.; Moubareck, C.; Leclercq, A.; Hervé-Bazin, M.; Bremont, S.; Lecuit, M.; Courvalin, P.; le Monnier, A. Antimicrobial resistance of Listeria monocytogenes strains isolated from humans in France. Antimicrob. Agents Chemother. 2010, 54, 2728–2731. [Google Scholar] [CrossRef] [Green Version]
  18. Poyart, C.; Celli, J.; Trieu-Cuot, P. Conjugative transposition of Tn916-related elements from Enterococcus faecalis to Escherichia coli and Pseudomonas fluorescens. Antimicrob. Agents Chemother. 1995, 39, 500–506. [Google Scholar] [CrossRef] [Green Version]
  19. Vesterholm-Nielsen, M.; Olhom Larsen, M.; Elmerdahl Olsen, J.; Moller Aarestrup, F. Occurrence of the blaZ gene in penicillin resistant Staphylococcus aureus isolated from bovine mastitis in Denmark. Acta. Vet. Scand. 1999, 40, 279–286. [Google Scholar] [CrossRef]
  20. Geha, D.J.; Uhl, J.R.; Gustaferro, C.A.; Persing, D.H. Multiplex PCR for identification of methicillin-resistant staphylococci in the clinical laboratory. J. Clin. Microbiol. 1994, 32, 1768–1772. [Google Scholar] [CrossRef] [Green Version]
  21. Adesiji, Y.O.; Deekshit, V.K.; Karunasagar, I. Antimicrobial-resistant genes associated with Salmonella spp. isolated from human, poultry, and seafood sources. Food Sci. Nutr. 2014, 2, 436–442. [Google Scholar] [CrossRef]
  22. Noguchi, N.; Hase, M.; Kitta, M.; Sasatsu, M.; Deguchi, K.; Kono, M. Antiseptic susceptibility and distribution of antiseptic-resistance genes in methicillin-resistant Staphylococcus aureus. FEMS Microbiol. Lett. 1999, 172, 247–253. [Google Scholar] [CrossRef]
  23. Tsen, H.Y.; Chen, T.R. Use of the polymerase chain reaction for specific detection of type A, D and E enterotoxigenic Staphylococcus aureus in foods. Appl. Microbiol. Biotechnol. 1992, 37, 685–690. [Google Scholar] [CrossRef] [PubMed]
  24. Ote, I.; Taminiau, B.; Duprez, J.N.; Dizier, I.; Mainil, J.G. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. Vet. Microbiol. 2011, 153, 285–292. [Google Scholar] [CrossRef] [PubMed]
  25. Stephan, R.; Annemüller, C.; Hassan, A.A.; Lämmler, C. Characterization of enterotoxigenic Staphylococcus aureus strains isolated from bovine mastitis in north-east Switzerland. Vet. Microbiol. 2001, 78, 373–382. [Google Scholar] [CrossRef] [PubMed]
  26. Solati, S.M.; Tajbakhsh, E.; Khamesipour, F.; Gugnani, H.C. Prevalence of virulence genes of biofilm producing strains of Staphylococcus epidermidis isolated from clinical samples in Iran. AMB Express 2015, 5, 134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Arciola, C.R.; Campoccia, D.; Gamberini, S.; Cervellati, M.; Donati, E.; Montanaro, L. Detection of slime production by means of an optimised Congo red agar plate test based on a colourimetric scale in Staphylococcus epidermidis clinical isolates genotyped for ica locus. Biomaterials 2002, 23, 4233–4239. [Google Scholar] [CrossRef]
  28. Seo, Y.S.; Lee, D.Y.; Rayamahji, N.; Kang, M.L.; Yoo, H.S. Biofilm-forming associated genotypic and phenotypic characteristics of Staphylococcus spp. isolated from animals and air. Res. Vet. Sci. 2008, 85, 433–438. [Google Scholar] [CrossRef]
  29. Vautor, E.; Abadie, G.; Pont, A.; Thiery, R. Evaluation of the presence of the bap gene in Staphylococcus aureus isolates recovered from human and animals species. Vet. Microbiol. 2008, 127, 407–411. [Google Scholar] [CrossRef] [Green Version]
  30. Kaczorek-Łukowska, E.; Małaczewska, J.; Wójcik, R.; Duk, K.; Blank, A.; Siwicki, A.K. Streptococci as the new dominant aetiological factors of mastitis in dairy cows in north-eastern Poland: Analysis of the results obtained in 2013–2019. Ir. Vet. J. 2021, 74, 2. [Google Scholar] [CrossRef]
  31. Kerro Dego, O.; van Dijk, J.E.; Nederbragt, H. Factors involved in the early pathogenesis of bovine Staphylococcus aureus mastitis with emphasis on bacterial adhesion and invasion. A review. Vet. Q. 2002, 24, 181–198. [Google Scholar] [CrossRef]
  32. Rainard, P.; Foucras, G.; Fitzgerald, J.R.; Watts, J.L.; Koop, G.; Middleton, J.R. Knowledge gaps and research priorities in Staphylococcus aureus mastitis control. Transbound Emerg. Dis. 2018, 65 (Suppl. 1), 149–165. [Google Scholar] [CrossRef] [Green Version]
  33. Martini, C.L.; Lange, C.C.; Brito, M.A.; Ribeiro, J.B.; Mendonça, L.C.; Vaz, E.K. Characterisation of penicillin and tetracycline resistance in Staphylococcus aureus isolated from bovine milk samples in Minas Gerais, Brazil. J. Dairy Res. 2017, 84, 202–205. [Google Scholar] [CrossRef]
  34. Waage, S.; Bjorland, J.; Caugant, D.A.; Oppegaard, H.; Tollersrud, T.; Mørk, T.; Aarestrup, F.M. Spread of Staphylococcus aureus resistant to penicillin and tetracycline within and between dairy herds. Epidemiol. Infect. 2002, 129, 193–202. [Google Scholar] [CrossRef]
  35. Eidaroos, N.H.; Youssef, A.I.; El-Sebae, A.; Enany, M.E.; Farid, D.S. Genotyping of enterotoxigenic methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Staphylococcus aureus (VRSA) among commensal rodents in North Sinai, Egypt. J. Appl. Microbiol. 2022, 132, 2331–2341. [Google Scholar] [CrossRef]
  36. Tiwari, H.K.; Sen, M.R. Emergence of vancomycin resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India. BMC Infect. Dis. 2006, 6, 156. [Google Scholar] [CrossRef] [Green Version]
  37. Doern, G.V.; Brecher, S.M. The Clinical Predictive Value (or Lack Thereof) of the Results of In Vitro Antimicrobial Susceptibility Tests. In. J. Clin. Microbiol. 2011, 49, 11–14. [Google Scholar] [CrossRef] [Green Version]
  38. Barkema, H.W.; Green, M.J.; Bradley, A.J.; Zadoks, R.N. Invited review: The role of contagious disease in udder health. J. Dairy Sci. 2009, 92, 4717–4729. [Google Scholar] [CrossRef] [Green Version]
  39. Chen, Q.; Xie, S.; Lou, X.; Cheng, S.; Liu, X.; Zheng, W.; Zheng, Z.; Wang, H. Biofilm formation and prevalence of adhesion genes among Staphylococcus aureus isolates from different food sources. Microbiologyopen 2020, 9, e00946. [Google Scholar] [CrossRef] [Green Version]
  40. Gajewska, J.; Chajęcka-Wierzchowska, W. Biofilm Formation Ability and Presence of Adhesion Genes among Coagulase-Negative and Coagulase-Positive Staphylococci Isolates from Raw Cow’s Milk. Pathogens 2020, 9, 654. [Google Scholar] [CrossRef]
  41. Kot, B.; Sytykiewicz, H.; Sprawka, I. Expression of the Biofilm-Associated Genes in Methicillin-Resistant. Int. J. Mol. Sci. 2018, 19, 3487. [Google Scholar] [CrossRef] [Green Version]
  42. Shivaee, A.; Rajabi, S.; Farahani, H.E.; Imani Fooladi, A.A. Effect of sub-lethal doses of nisin on Staphylococcus aureus toxin production and biofilm formation. Toxicon 2021, 197, 1–5. [Google Scholar] [CrossRef]
  43. Oliveira, M.; Nunes, S.F.; Carneiro, C.; Bexiga, R.; Bernardo, F.; Vilela, C.L. Time course of biofilm formation by Staphylococcus aureus and Staphylococcus epidermidis mastitis isolates. Vet. Microbiol. 2007, 124, 187–191. [Google Scholar] [CrossRef] [PubMed]
  44. Kasela, M.; Malma, A.; Nowakowicz-Dębek, B.; Ossowski, M. Genotypic methods for epidemiological typing of Staphylococcus aureus. Postepy Hig. Med. Dosw. 2019, 73, 245–255. [Google Scholar] [CrossRef]
  45. Wakita, Y.; Shimizu, A.; Hájek, V.; Kawano, J.; Yamashita, K. Characterization of Staphylococcus intermedius from pigeons, dogs, foxes, mink, and horses by pulsed-field gel electrophoresis. J. Vet. Med. Sci. 2002, 64, 237–243. [Google Scholar] [CrossRef] [PubMed]
Table
Table 1. Antibiotic resistance results for Staphylococcus aureus strains analyzed (n = 28). Legend: amoxicillin + clavulanic acid 20 + 10 µg (AMC), enrofloxacin 5 µg (ENR), clindamycin 2 µg (CL), tetracycline 30 µg (TE), erythromycin 15 µg (E), ceftriaxone 30 µg (CEQ), cloxacillin 5 µg (OB), neomycin 30 µg (N), penicillin G 10U (P), marbofloxacin (MAR), ceftiofur 30 µg (EFT), bacitracin 10 µg (B), cefamandole 30 µg (MA), cefoperazone 75 µg (CFP), gentamycin 10 µg (CN), oxytetracycline 30 µg (OT), penicillin/novobiocin 40 µg (PNV), trimethoprim/Sulfamethoxazole 1:19 25 µg (SXT), ubrolexin (CFX), rifampicin 5 µg (RD), Cefapirin 30 µg (CPR), oxacillin (OX), cefoxitin (FOX), vancomycin (VAN), ND: not detected, red (R): resistance, orange (I): intermediate, green: sensitive, ND: not detected.
Table 1. Antibiotic resistance results for Staphylococcus aureus strains analyzed (n = 28). Legend: amoxicillin + clavulanic acid 20 + 10 µg (AMC), enrofloxacin 5 µg (ENR), clindamycin 2 µg (CL), tetracycline 30 µg (TE), erythromycin 15 µg (E), ceftriaxone 30 µg (CEQ), cloxacillin 5 µg (OB), neomycin 30 µg (N), penicillin G 10U (P), marbofloxacin (MAR), ceftiofur 30 µg (EFT), bacitracin 10 µg (B), cefamandole 30 µg (MA), cefoperazone 75 µg (CFP), gentamycin 10 µg (CN), oxytetracycline 30 µg (OT), penicillin/novobiocin 40 µg (PNV), trimethoprim/Sulfamethoxazole 1:19 25 µg (SXT), ubrolexin (CFX), rifampicin 5 µg (RD), Cefapirin 30 µg (CPR), oxacillin (OX), cefoxitin (FOX), vancomycin (VAN), ND: not detected, red (R): resistance, orange (I): intermediate, green: sensitive, ND: not detected.
STRAIN ID/ANTIMICROBIALAMCENRCLTEOTECEQOBNPPNVMARSXTEFTCNCFPMABRDCPRVANFOXOXCONFIRMED ANTIBIOTIC RESISTANCE GENES
287 ND
494 tet(K), blaZ
522 tet(K), blaZ
294 blaZ
292 blaZ
476 tet(K), blaZ
342 tet(K), blaZ
510 tet(K), blaZ
321 tet(K), blaZ
165 blaZ
398 blaZ
322 tet(K), blaZ
377 tet(K), blaZ
536 tet(K), blaZ
312 tet(K), blaZ
360 blaZ
399 tet(K), blaZ
493 tet(K), blaZ
535 tet(K), blaZ
390 tet(K), blaZ
509 blaZ
495 tet(K), blaZ
227 blaZ
397 blaZ
556 tet(K), blaZ
545 blaZ
544 tet(K), blaZ
228 tet(K), blaZ
R%00018250000577000000000000
I%0504046714000754040700110000
Table
Table 2. Biofilm production capacity of Staphylococcus aureus (n = 28) from subclinical mastitis samples from the northeast region of Poland after 24, 48 and 72 h with virulence pattern and PCR MP and MLVF profile. Color green: no biofilm, orange: weak biofilm, blue: medium biofilm, red: strong biofilm, ND: no profile in PCR MP and MLVF analysis.
Table 2. Biofilm production capacity of Staphylococcus aureus (n = 28) from subclinical mastitis samples from the northeast region of Poland after 24, 48 and 72 h with virulence pattern and PCR MP and MLVF profile. Color green: no biofilm, orange: weak biofilm, blue: medium biofilm, red: strong biofilm, ND: no profile in PCR MP and MLVF analysis.
Strain ID244872CONFIRMED VIRULENCE GENESMP PCRMLVFCombined
287 lukM, lukD, clfA, icaD, clfB, sdrC, eno411
494 lukM, lukD, clfA, icaD, clfB, sdrC eno422
522 lukM, lukD, clfA, icaD, clfB, sdrC, eno411
294 lukM, clfA, icaD, clfB, sdrC, eno463
292 lukD, clfA, icaD, clfB, sdrC, eno411
476 lukM, lukD, clfA, icaD, clfB, sdrC eno411
342 lukM, lukD, clfA, icaD, clfB, sdrC, eno224
510 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
321 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
165 lukM, lukD, clfA, icaD, clfB, sdrC, eno475
398 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
322 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
377 lukM, lukD, clfA, icaD, clfB, sdrC, eno116
536 lukM, lukD, clfA, icaD, clfB, sdrC, sea, seo, eno797
312 lukM, lukD, clfA, icaD, clfB, sdrC, eno438
360 lukM, lukD, clfA, icaD, clfB, eno219
399 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
493 lukM, lukD, clfA, icaD, clfB, eno422
535 seo, sen, LukM, lukD, clfA, icaD, clfB, eno797
390 lukM, lukD, clfA, icaD, clfB, sdrC, eno4410
509 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
495 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
227 lukM, lukD, clfA, icaD, clfB, sdrC, eno5511
397 lukM, lukD, clfA, icaD, clfB, sdrC, eno422
556 lukM, lukD, clfA, icaD, clfB, sdrC, eno9212
545 lukM, lukD, clfA, icaD, clfB, sdrC, eno411
544 clfA, icaD, clfB, sdrC, eno81013
228 lukM, lukD, clfA, icaD, clfB, sdrC, enoND814
no biofilm n [%]9 (30)4 (13)3 (10)Number of pattern types91014
Number of strains without a profile100
weak biofilm16 (53)17 (57)13 (43)
moderate biofilm4 (13)5 (17)11 (37)
strong biofilm 1 (3)3 (10)3 (10)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kaczorek-Łukowska, E.; Małaczewska, J.; Sowińska, P.; Szymańska, M.; Wójcik, E.A.; Siwicki, A.K. Staphylococcus aureus from Subclinical Cases of Mastitis in Dairy Cattle in Poland, What Are They Hiding? Antibiotic Resistance and Virulence Profile. Pathogens 2022, 11, 1404. https://doi.org/10.3390/pathogens11121404

AMA Style

Kaczorek-Łukowska E, Małaczewska J, Sowińska P, Szymańska M, Wójcik EA, Siwicki AK. Staphylococcus aureus from Subclinical Cases of Mastitis in Dairy Cattle in Poland, What Are They Hiding? Antibiotic Resistance and Virulence Profile. Pathogens. 2022; 11(12):1404. https://doi.org/10.3390/pathogens11121404

Chicago/Turabian Style

Kaczorek-Łukowska, Edyta, Joanna Małaczewska, Patrycja Sowińska, Marta Szymańska, Ewelina Agnieszka Wójcik, and Andrzej Krzysztof Siwicki. 2022. "Staphylococcus aureus from Subclinical Cases of Mastitis in Dairy Cattle in Poland, What Are They Hiding? Antibiotic Resistance and Virulence Profile" Pathogens 11, no. 12: 1404. https://doi.org/10.3390/pathogens11121404

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop