Methicillin-Resistant Staphylococcus aureus Membrane Vesicles Inhibit the Proliferation and Induce the Apoptosis of Epithelial Cells
Abstract
:1. Introduction
2. Methods
2.1. Isolates and Molecular Typing
2.2. Isolation and Analysis of MRSA MVs
2.3. Cell Culture, CCK-8 Assay, and Flow Cytometry
2.4. qPCR Array and Quantitative Real-Time PCR (qRT-PCR)
2.5. Western Blotting
2.6. Statistical Analysis
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lee, A.S.; de Lencastre, H.; Garau, J.; Kluytmans, J.; Malhotra-Kumar, S.; Peschel, A.; Harbarth, S. Methicillin-resistant Staphylococcus aureus. Nat. Rev. Dis. Prim. 2018, 4, 18033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kallen, A.J.; Mu, Y.; Bulens, S.; Reingold, A.; Petit, S.; Gershman, K.; Ray, S.M.; Harrison, L.H.; Lynfield, R.; Dumyati, G.; et al. Health care-associated invasive MRSA infections, 2005–2008. JAMA 2010, 304, 641–648. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chuang, Y.Y.; Huang, Y.C. Molecular epidemiology of community-associated meticillin-resistant Staphylococcus aureus in Asia. Lancet Infect. Dis. 2013, 13, 698–708. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Du, X.; Villaruz, A.E.; Diep, B.A.; Wang, D.; Song, Y.; Tian, Y.; Hu, J.; Yu, F.; Lu, Y.; et al. MRSA epidemic linked to a quickly spreading colonization and virulence determinant. Nat. Med. 2012, 18, 816–819. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Sun, K.; Luo, Q.; Duan, Y.; Chen, F. Emergence and spread of pvl-positive genotypic CA-MRSA ST59 with increased adhesion capacity from wounds in hospitals. J. Infect. 2019, 79, 612–625. [Google Scholar] [CrossRef] [PubMed]
- Kouyos, R.; Klein, E.; Grenfell, B. Hospital-community interactions foster coexistence between methicillin-resistant strains of Staphylococcus aureus. PLoS Pathog. 2013, 9, e1003134. [Google Scholar] [CrossRef] [Green Version]
- Kateete, D.P.; Bwanga, F.; Seni, J.; Mayanja, R.; Kigozi, E.; Mujuni, B.; Ashaba, F.K.; Baluku, H.; Najjuka, C.F.; Källander, K.; et al. CA-MRSA and HA-MRSA coexist in community and hospital settings in Uganda. Antimicrob. Resist. Infect. Control 2019, 8, 94. [Google Scholar] [CrossRef]
- Briaud, P.; Carroll, R.K. Extracellular Vesicle Biogenesis and Functions in Gram-Positive Bacteria. Infect. Immun. 2020, 88, e00433-20. [Google Scholar] [CrossRef] [PubMed]
- Rumbo, C.; Fernández-Moreira, E.; Merino, M.; Poza, M.; Mendez, J.A.; Soares, N.C.; Mosquera, A.; Chaves, F.; Bou, G. Horizontal transfer of the OXA-24 carbapenemase gene via outer membrane vesicles: A new mechanism of dissemination of carbapenem resistance genes in Acinetobacter baumannii. Antimicrob. Agents Chemother. 2011, 55, 3084–3090. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, Y.; Lin, H. Characterization and function of membrane vesicles in Gram-positive bacteria. Appl. Microbiol. Biotechnol. 2021, 105, 1795–1801. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Lee, E.-Y.; Kim, S.-H.; Kim, D.-K.; Park, K.-S.; Kim, K.P.; Kim, Y.-K.; Roh, T.-Y.; Gho, Y.S. Staphylococcus aureus extracellular vesicles carry biologically active β-lactamase. Antimicrob. Agents Chemother. 2013, 57, 2589–2595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Thompson, C.D.; Weidenmaier, C.; Lee, J.C. Release of Staphylococcus aureus extracellular vesicles and their application as a vaccine platform. Nat. Commun. 2018, 9, 1379. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Eagen, W.J.; Lee, J.C. Orchestration of human macrophage NLRP3 inflammasome activation by Staphylococcus aureus extracellular vesicles. Proc. Natl. Acad. Sci. USA 2020, 117, 3174–3184. [Google Scholar] [CrossRef] [PubMed]
- Bitto, N.J.; Cheng, L.; Johnston, E.L.; Pathirana, R.; Phan, T.K.; Poon, I.K.H.; O’Brien-Simpson, N.M.; Hill, A.F.; Stinear, T.P.; Kaparakis-Liaskos, M. Staphylococcus aureus membrane vesicles contain immunostimulatory DNA, RNA and peptidoglycan that activate innate immune receptors and induce autophagy. J. Extracell. Vesicles 2021, 10, e12080. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Cheng, H.; Yuan, W.; Zeng, F.; Shang, W.; Tang, D.; Xue, W.; Fu, J.; Zhou, R.; Zhu, J.; et al. Panton-Valentine leukocidin (PVL)-positive health care-associated methicillin-resistant Staphylococcus aureus isolates are associated with skin and soft tissue infections and colonized mainly by infective PVL-encoding bacteriophages. J. Clin. Microbiol. 2015, 53, 67–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, X.; Wang, W.-K.; Han, L.-Z.; Liu, Y.; Zhang, H.; Tang, J.; Liu, Q.-Z.; Huangfu, Y.-C.; Ni, Y.-X. Epidemiological and genetic diversity of Staphylococcus aureus causing bloodstream infection in Shanghai, 2009–2011. PLoS ONE 2013, 8, e72811. [Google Scholar] [CrossRef] [PubMed]
- Enright, M.C.; Day, N.P.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, M.; Liu, X.; Luo, Q.; Xu, L.; Chen, F. An efficient method to isolate lemon derived extracellular vesicles for gastric cancer therapy. J. Nanobiotechnol. 2020, 18, 100. [Google Scholar] [CrossRef]
- Yang, M.; Luo, Q.; Chen, X.; Chen, F. Bitter melon derived extracellular vesicles enhance the therapeutic effects and reduce the drug resistance of 5-fluorouracil on oral squamous cell carcinoma. J. Nanobiotechnol. 2021, 19, 259. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Luo, Q.; Ding, J.; Yang, M.; Zhang, R.; Chen, F. Zymosan promotes proliferation, Candida albicans adhesion and IL-1β production of oral squamous cell carcinoma in vitro. Infect. Agents Cancer 2020, 15, 51. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Chen, H.; Yin, Y.; van Dorp, L.; Shaw, L.P.; Gao, H.; Acman, M.; Yuan, J.; Chen, F.; Sun, S.; Wang, X.; et al. Drivers of methicillin-resistant Staphylococcus aureus (MRSA) lineage replacement in China. Genome Med. 2021, 13, 171. [Google Scholar] [CrossRef]
- Jin, Y.; Zhou, W.; Zhan, Q.; Zheng, B.; Chen, Y.; Luo, Q.; Shen, P.; Xiao, Y. Genomic Epidemiology and Characterization of Methicillin-Resistant Staphylococcus aureus from Bloodstream Infections in China. mSystems 2021, 6, e0083721. [Google Scholar] [CrossRef] [PubMed]
- Joshi, B.; Singh, B.; Nadeem, A.; Askarian, F.; Wai, S.N.; Johannessen, M.; Hegstad, K. Transcriptome Profiling of Staphylococcus aureus Associated Extracellular Vesicles Reveals Presence of Small RNA-Cargo. Front. Mol. Biosci. 2020, 7, 566207. [Google Scholar] [CrossRef] [PubMed]
- Jeon, H.; Oh, M.H.; Jun, S.H.; Kim, S.I.; Choi, C.W.; Kwon, H.I.; Na, S.H.; Kim, Y.J.; Nicholas, A.; Selasi, G.N.; et al. Variation among Staphylococcus aureus membrane vesicle proteomes affects cytotoxicity of host cells. Microb. Pathog. 2016, 93, 185–193. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Yu, W.-W.; Peng, J.; Xu, L.-F.; Zhao, C.-C.; Chang, W.-J.; Ma, X.-L. LukS-PV induces apoptosis in acute myeloid leukemia cells mediated by C5a receptor. Cancer Med. 2019, 8, 2474–2483. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer | Sequence |
---|---|---|
BAG3 | Forward | AGAGACGGTGTCAGGAAGGTTCAG |
Reverse | GTTGCTGGGCTGGAGTTCATAGAC | |
BAK1 | Forward | AGAGATGGTCACCTTACCTCT |
Reverse | GGTCTGGAACTCTGAGTCATAG | |
TLR2 | Forward | TGTCTTGTGACCGCAATGGTATCTG |
Reverse | TGCTAATGTAGGTGATCCTGTTGTTGG | |
GAPDH | Forward | CCTGCCAAATATGATGACAT |
Reverse | TCCACCACCCTGTTGCTGTA |
Isolate | Molecular Characteristics | Category | Note |
---|---|---|---|
Isolate 251 | pvl-positive t437-ST59-SCCmecIV | CA-MRSA | Pair one |
Isolate 320 | pvl-negative t030-ST239-SCCmecIII | HA-MRSA | |
Isolate 432 | pvl-negative t421-ST239-SCCmecIII | HA-MRSA | Pair Two |
Isolate 662 | pvl-positive t437-ST338-SCCmecV | CA-MRSA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; Zhang, J.; Yang, M.; Du, G.; Chen, F. Methicillin-Resistant Staphylococcus aureus Membrane Vesicles Inhibit the Proliferation and Induce the Apoptosis of Epithelial Cells. Pathogens 2022, 11, 1429. https://doi.org/10.3390/pathogens11121429
Chen X, Zhang J, Yang M, Du G, Chen F. Methicillin-Resistant Staphylococcus aureus Membrane Vesicles Inhibit the Proliferation and Induce the Apoptosis of Epithelial Cells. Pathogens. 2022; 11(12):1429. https://doi.org/10.3390/pathogens11121429
Chicago/Turabian StyleChen, Xu, Jingwei Zhang, Meng Yang, Guanhuan Du, and Fuxiang Chen. 2022. "Methicillin-Resistant Staphylococcus aureus Membrane Vesicles Inhibit the Proliferation and Induce the Apoptosis of Epithelial Cells" Pathogens 11, no. 12: 1429. https://doi.org/10.3390/pathogens11121429