Subgingival Periopathogens Assessment and Clinical Periodontal Evaluation of Gastric Cancer Patients—A Cross Sectional Pilot Study
Abstract
:1. Introduction
Aim
2. Results
2.1. Prevalence of Periopathogens
2.2. Correlations between Periodontal Status and Characteristics of Gastric Tumours
2.3. Correlations between Abundance of Subgingival Periopathogens in Gingival Crevicular Fluid and Characteristics of Gastric Tumours
3. Discussion
4. Materials and Methods
4.1. Study Design
4.2. Setting
4.3. Participants
4.4. Periodontal Examination
4.5. Gingival Crevicular Fluid Sampling
4.6. PCR Assessment
4.6.1. DNA Extraction
4.6.2. Quantification of Periopathogens
4.7. Histological Analysis of the Gastric Tissue
4.8. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
AT | Absent teeth |
BOP | Bleeding on probing |
CAL | Clinical attachment loss |
DG | Differentiation grade |
G | Gingivitis group |
GC | Gastric cancer |
p | Statistical significance |
P | Periodontitis group |
PD | Periodontal disease |
PPD | Probing pocket depth |
r | Correlation grade |
SD | Standard deviation |
SG | Patients from 1st Department of Surgery with gingivitis |
SP | Patients from 1st Department of Surgery with periodontitis |
TD | Tumour dimension |
References
- Papapanou, P.N.; Sanz, M.; Buduneli, N.; Dietrich, T.; Feres, M.; Fine, D.H.; Flemmig, T.F.; Garcia, R.; Giannobile, W.V.; Graziani, F.; et al. Periodontitis: Consensus report of workgroup 2 of the 2017 world workshop on the classification of periodontal and peri-implant diseases and conditions. J. Clin. Periodontol. 2018, 45 (Suppl. 20), S162–S170. [Google Scholar] [CrossRef] [PubMed]
- Sanz, M.; Herrera, D.; Kebschull, M.; Chapple, I.; Jepsen, S.; Berglundh, T.; Sculean, A.; Tonetti, M.S.; Aass, A.M.; On behalf of the EFP Workshop Participants and Methodological Consultants; et al. Treatment of stage I–III periodontitis—The EFP S3 level clinical practice guideline. J. Clin. Periodontol. 2020, 47, 4–60. [Google Scholar] [CrossRef] [PubMed]
- Van Dyke, T.E.; Dave, S. Risk factors for periodontitis. J. Int. Acad. Periodontol. 2005, 7, 3–7. [Google Scholar] [PubMed]
- Socransky, S.S.; Haffajee, A.D.; Cugini, M.A.; Smith, C.; Kent, R.L., Jr. Microbial complexes in subgingival plaque. J. Clin. Periodontol. 1998, 25, 134–144. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.W. Fusobacterium nucleatum: A commensal-turned pathogen. Curr. Opin. Microbiol. 2015, 23, 141–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ford, P.J.; Gemmell, E.; Chan, A.; Carter, C.L.; Walker, P.J.; Bird, P.S.; West, M.J.; Cullinan, M.; Seymour, G. Inflammation, heat shock proteins and periodontal pathogens in atherosclerosis: An immunohistologic study. Oral Microbiol. Immunol. 2006, 21, 206–211. [Google Scholar] [CrossRef] [PubMed]
- Pyysalo, M.J.; Pyysalo, L.M.; Pessi, T.; Karhunen, P.J.; Öhman, J.E. The connection between ruptured cerebral aneurysms and odontogenic bacteria. J. Neurol. Neurosurg. Psychiatry 2013, 84, 1214–1218. [Google Scholar] [CrossRef] [PubMed]
- Sparks Stein, P.; Steffen, M.J.; Smith, C.; Jicha, G.; Ebersole, J.L.; Abner, E.; Dawson, D. Serum antibodies to periodontal pathogens are a risk factor for Alzheimer’s disease. Alzheimer’s Dement. 2012, 8, 196–203. [Google Scholar] [CrossRef] [Green Version]
- Swidsinski, A.; Dörffel, Y.; Loening-Baucke, V.; Theissig, F.; Rückert, J.C.; Ismail, M.; Rau, W.A.; Gaschler, D.; Weizenegger, M.; Kühn, S.; et al. Acute appendicitis is characterised by local invasion with Fusobacterium nucleatum/necrophorum. Gut 2009, 60, 34–40. [Google Scholar] [CrossRef]
- Tahara, T.; Shibata, T.; Kawamura, T.; Okubo, M.; Ichikawa, Y.; Sumi, K.; Miyata, M.; Ishizuka, T.; Nakamura, M.; Nagasaka, M.; et al. Fusobacterium detected in colonic biopsy and clinicopathological features of ulcerative colitis in Japan. Dig. Dis. Sci. 2014, 60, 205–210. [Google Scholar] [CrossRef] [PubMed]
- Flanagan, L.; Schmid, J.; Ebert, M.; Soucek, P.; Kunicka, T.; Liška, V.; Bruha, J.; Neary, P.; DeZeeuw, N.; Tommasino, M.; et al. Fusobacterium nucleatum associates with stages of colorectal neoplasia development, colorectal cancer and disease outcome. Eur. J. Clin. Microbiol. Infect. Dis. 2014, 33, 1381–1390. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, Y.-Y.; Tung, S.-Y.; Pan, H.-Y.; Yen, C.-W.; Xu, H.-W.; Lin, Y.-J.; Deng, Y.-F.; Hsu, W.-T.; Wu, C.-S.; Li, C. Increased abundance of Clostridium and Fusobacterium in gastric microbiota of patients with gastric cancer in Taiwan. Sci. Rep. 2018, 8, 158. [Google Scholar] [CrossRef] [PubMed]
- Mima, K.; Nishihara, R.; Qian, Z.R.; Cao, Y.; Sukawa, Y.; Nowak, J.A.; Yang, J.; Dou, R.; Masugi, Y.; Song, M.; et al. Fusobacterium nucleatumin colorectal carcinoma tissue and patient prognosis. Gut 2016, 65, 1973–1980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hussan, H.; Clinton, S.K.; Roberts, K.; Bailey, M. Fusobacterium’s link to colorectal neoplasia sequenced: A systematic review and future insights. World J. Gastroenterol. 2017, 23, 8626–8650. [Google Scholar] [CrossRef] [PubMed]
- Proença, M.A.; Biselli, J.M.; Succi, M.; Severino, F.E.; Berardinelli, G.N.; Caetano, A.; Reis, R.M.; Hughes, D.J.; Silva, A.E. Relationship between Fusobacterium nucleatum, inflammatory mediators and microRNAs in colorectal carcinogenesis. World J. Gastroenterol. 2018, 24, 5351–5365. [Google Scholar] [CrossRef] [PubMed]
- Shang, F.-M.; Liu, H.-L. Fusobacterium nucleatum and colorectal cancer: A review. World J. Gastrointest. Oncol. 2018, 10, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Brennan, C.A.; Garrett, W.S. Fusobacterium nucleatum—Symbiont, opportunist and oncobacterium. Nat. Rev. Microbiol. 2019, 17, 156–166. [Google Scholar] [CrossRef] [PubMed]
- Boehm, E.T.; Thon, C.; Kupcinskas, J.; Steponaitiene, R.; Skieceviciene, J.; Canbay, A.; Malfertheiner, P.; Link, A. Fusobacterium nucleatum is associated with worse prognosis in Lauren’s diffuse type gastric cancer patients. Sci. Rep. 2020, 10, 16240. [Google Scholar] [CrossRef] [PubMed]
- Kageyama, S.; Takeshita, T.; Takeuchi, K.; Asakawa, M.; Matsumi, R.; Furuta, M.; Shibata, Y.; Nagai, K.; Ikebe, M.; Morita, M.; et al. Characteristics of the salivary microbiota in patients with various digestive tract cancers. Front. Microbiol. 2019, 10, 1780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.; Chen, X.; Yu, H.; Zhou, H.; Xu, S. Oral Microbiota as promising diagnostic biomarkers for gastrointestinal cancer: A systematic review. OncoTargets Ther. 2019, 12, 11131–11144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, J.; Zhou, M.; Salazar, C.R.; Hays, R.; Bedi, S.; Chen, Y.; Li, Y. Chronic Periodontal disease, periodontal pathogen colonization, and increased risk of precancerous gastric lesions. J. Periodontol. 2017, 88, 1124–1134. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rawla, P.; Barsouk, A. Epidemiology of gastric cancer: Global trends, risk factors and prevention. Gastroenterol. Rev. 2019, 14, 26–38. [Google Scholar] [CrossRef] [PubMed]
- Stewart, O.A.; Wu, F.; Chen, Y. The role of gastric microbiota in gastric cancer. Gut Microbes 2020, 11, 1220–1230. [Google Scholar] [CrossRef] [PubMed]
- Karimi, P.; Islami, F.; Anandasabapathy, S.; Freedman, N.D.; Kamangar, F. Gastric cancer: Descriptive epidemiology, risk factors, screening, and prevention. Cancer Epidemiol. Biomark. Prev. 2014, 23, 700–713. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, J.; Li, X.; Yin, J.; Li, Y.; Hou, B.; Zhang, Z. A screening method for gastric cancer by oral microbiome detection. Oncol. Rep. 2018, 39, 2217–2224. [Google Scholar] [CrossRef] [PubMed]
- Chrysanthakopoulos, N.A.; Oikonomou, A.A. A case-control study of the periodontal condition in gastric cancer patients. Stomatol. Dis. Sci. 2017, 1, 55–61. [Google Scholar] [CrossRef] [Green Version]
- Yin, X.-H.; Wang, Y.-D.; Luo, H.; Zhao, K.; Huang, G.-L.; Luo, S.-Y.; Peng, J.-X.; Song, J.-K. Association between tooth loss and gastric cancer: A meta-analysis of observational studies. PLoS ONE 2016, 11, e0149653. [Google Scholar] [CrossRef] [Green Version]
- Ndegwa, N.; Ploner, A.; Liu, Z.; Roosaar, A.; Axéll, T.; Ye, W. Association between poor oral health and gastric cancer: A prospective cohort study. Int. J. Cancer 2018, 143, 2281–2288. [Google Scholar] [CrossRef] [Green Version]
- Wolff, G.; Läuter, J. On epidemiology of gastric cancer (author’s transl). Arch. Fur Geschwulstforsch. 1976, 46, 1–14. [Google Scholar]
- Watabe, K.; Nishi, M.; Miyake, H.; Hirata, K. Lifestyle and gastric cancer: A case-control study. Oncol. Rep. 1998, 5, 1191–1194. [Google Scholar] [CrossRef] [PubMed]
- Abnet, C.C.; Kamangar, F.; Dawsey, S.M.; Stolzenberg-Solomon, R.Z.; Albanes, D.; Pietinen, P.; Virtamo, J.; Taylor, P.R. Tooth loss is associated with increased risk of gastric non-cardia adenocarcinoma in a cohort of Finnish smokers. Scand. J. Gastroenterol. 2005, 40, 681–687. [Google Scholar] [CrossRef] [PubMed]
- Michaud, D.S.; Liu, Y.; Meyer, M.; Giovannucci, E.; Joshipura, K. Periodontal disease, tooth loss, and cancer risk in male health professionals: A prospective cohort study. Lancet Oncol. 2008, 9, 550–558. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; Yu, P.; Wang, J.; Fan, J.; Qiao, Y.; Taylor, P.R. Association between tooth loss and upper gastrointestinal cancer: A 30-year follow-up of the Linxian Dysplasia Nutrition Intervention Trial Cohort. Thorac. Cancer 2019, 10, 966–974. [Google Scholar] [CrossRef] [PubMed]
- Momen-Heravi, F.; Babic, A.; Tworoger, S.S.; Zhang, L.; Wu, K.; Smith-Warner, S.A.; Ogino, S.; Chan, A.T.; Meyerhardt, J.; Giovannucci, E.; et al. Periodontal disease, tooth loss and colorectal cancer risk: Results from the Nurses’ Health Study. Int. J. Cancer 2017, 140, 646–652. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.; Lee, J.S.; Kim, J.; Lee, H.; Chang, Y.; Woo, H.G.; Kim, J.; Song, T. Oral health and gastrointestinal cancer: A nationwide cohort study. J. Clin. Periodontol. 2020, 47, 796–808. [Google Scholar] [CrossRef] [PubMed]
- Nwizu, N.N.; Marshall, J.R.; Moysich, K.; Genco, R.J.; Hovey, K.M.; Mai, X.; LaMonte, M.J.; Freudenheim, J.L.; Wactawski-Wende, J. Periodontal disease and incident cancer risk among postmenopausal women: Results from the women’s health initiative observational cohort. Cancer Epidemiol. Biomark. Prev. 2017, 26, 1255–1265. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lehrer, S.; Rheinstein, P.; Rosenzweig, K.E. Periodontal disease and incident cancer—Letter. Cancer Epidemiol. Biomark. Prev. 2018, 27, 614–615. [Google Scholar] [CrossRef] [Green Version]
- de Rezende, C.P.; Ramos, M.B.; Daguíla, C.H.; Dedivitis, R.A.; Rapoport, A. Oral health changes in patients with oral and oropharyngeal cancer. Braz. J. Otorhinolaryngol. 2008, 74, 596–600. [Google Scholar] [CrossRef] [Green Version]
- Matsuda, S.; Goi, T.; Yoshida, Y.; Yoshimura, H. Periodontal disease in preoperative patients with digestive cancer: A retrospective, single-institution experience in Fukui, Japan. BMC Oral Health 2021, 21, 3. [Google Scholar] [CrossRef]
- Güven, D.C.; Dizdar, Ö.; Akman, A.C.; Berker, E.; Yekedüz, E.; Ceylan, F.; Başpinar, B.; Akbiyik, I.; Aktaş, B.Y.; Yüce, D.; et al. Evaluation of cancer risk in patients with periodontal diseases. Turk. J. Med. Sci. 2019, 49, 826–831. [Google Scholar] [CrossRef]
- Nwizu, N.; Wactawski-Wende, J.; Genco, R.J. Periodontal disease and cancer: Epidemiologic studies and possible mechanisms. Periodontology 2000 2020, 83, 213–233. [Google Scholar] [CrossRef]
- Lo, C.-H.; Kwon, S.; Wang, L.; Polychronidis, G.; Knudsen, M.D.; Zhong, R.; Cao, Y.; Wu, K.; Ogino, S.; Giovannucci, E.L.; et al. Periodontal disease, tooth loss, and risk of oesophageal and gastric adenocarcinoma: A prospective study. Gut 2020, 70, 620–621. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.; Segers, S.; Hayes, R.B. Periodontal disease, Porphyromonas gingivalis serum antibody levels and orodigestive cancer mortality. Carcinogenesis 2012, 33, 1055–1058. [Google Scholar] [CrossRef] [Green Version]
- Gao, S.; Li, S.; Ma, Z.; Liang, S.; Xiaoshan, F.; Zhang, M.; Zhu, X.; Zhang, P.; Liu, G.; Zhou, F.; et al. Presence of Porphyromonas gingivalis in esophagus and its association with the clinicopathological characteristics and survival in patients with esophageal cancer. Infect. Agents Cancer 2016, 11, 3. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.-B.; Gao, Z.-Y.; Sun, C.-T.; Wen, H.; Gao, B.; Li, S.-B.; Tong, Q. The potential role of P.gingivalis in gastrointestinal cancer: A mini review. Infect. Agents Cancer 2019, 14, 23. [Google Scholar] [CrossRef]
- Yamamura, K.; Baba, Y.; Nakagawa, S.; Mima, K.; Miyake, K.; Nakamura, K.; Sawayama, H.; Kinoshita, K.; Ishimoto, T.; Iwatsuki, M.; et al. Human microbiome Fusobacterium nucleatum in esophageal cancer tissue is associated with prognosis. Clin. Cancer Res. 2016, 22, 5574–5581. [Google Scholar] [CrossRef] [Green Version]
- Gallimidi, A.B.; Fischman, S.; Revach, B.; Bulvik, R.; Maliutina, A.; Rubinstein, A.M.; Nussbaum, G.; Elkin, M. Periodontal pathogens Porphyromonas gingivalis and Fusobacterium nucleatum promote tumor progression in an oral-specific chemical carcinogenesis model. Oncotarget 2015, 6, 22613–22623. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, M.-F.; Lu, M.-S.; Hsieh, C.-C.; Chen, W.-C. Porphyromonas gingivalis promotes tumor progression in esophageal squamous cell carcinoma. Cell. Oncol. 2021, 44, 373–384. [Google Scholar] [CrossRef]
- Coker, O.O.; Dai, Z.; Nie, Y.; Zhao, G.; Cao, L.; Nakatsu, G.; Wu, W.K.; Wong, S.H.; Chen, Z.; Sung, J.J.Y.; et al. Mucosal microbiome dysbiosis in gastric carcinogenesis. Gut 2018, 67, 1024–1032. [Google Scholar] [CrossRef] [PubMed]
- Popa, P.; Streba, C.T.; Caliţă, M.; Iovănescu, V.F.; Florescu, D.N.; Ungureanu, B.S.; Stănculescu, A.D.; Ciurea, R.N.; Oancea, C.N.; Georgescu, D.; et al. Value of endoscopy with narrow-band imaging and probe-based confocal laser endomicroscopy in the diagnosis of preneoplastic lesions of gastrointestinal tract. Romanian J. Morphol. Embryol. 2021, 61, 759–767. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.W.; Ikegami, A.; Rajanna, C.; Kawsar, H.I.; Zhou, Y.; Li, M.; Sojar, H.T.; Genco, R.J.; Kuramitsu, H.K.; Deng, C.X. Identification and characterization of a novel adhesin unique to oral fusobacteria. J. Bacteriol. 2005, 187, 5330–5340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, P.; Liu, Y.; Wang, J.; Guo, Y.; Zhang, Y.; Xiao, S. Detection of Fusobacterium nucleatum and fada adhesin gene in patients with orthodontic gingivitis and non-orthodontic periodontal inflammation. PLoS ONE 2014, 9, e85280. [Google Scholar] [CrossRef] [PubMed]
- Kashani, N.; Abadi, A.B.; Rahimi, F.; Forootan, M. FadA-positive Fusobacterium nucleatum is prevalent in biopsy specimens of Iranian patients with colorectal cancer. New Microbes New Infect. 2020, 34, 100651. [Google Scholar] [CrossRef] [PubMed]
- Rubinstein, M.R.; Wang, X.; Liu, W.; Hao, Y.; Cai, G.; Han, Y.W. Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/β-catenin signaling via its FadA adhesin. Cell Host Microbe 2013, 14, 195–206. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dadashi, M.; Hajikhani, B.; Faghihloo, E.; Owlia, P.; Yaslianifard, S.; Goudarzi, M.; Nasiri, M.J.; Fallah, F. Proliferative effect of FadA recombinant protein from Fusobacterium nucleatum on SW480 colorectal cancer cell line. Infect. Disord.-Drug Targets 2021, 21, 623–628. [Google Scholar] [CrossRef] [PubMed]
- Kostic, A.D.; Gevers, D.; Pedamallu, C.S.; Michaud, M.; Duke, F.; Earl, A.M.; Ojesina, A.I.; Jung, J.; Bass, A.J.; Tabernero, J.; et al. Genomic analysis identifies association of Fusobacterium with colorectal carcinoma. Genome Res. 2012, 22, 292–298. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Castellarin, M.; Warren, R.L.; Freeman, J.D.; Dreolini, L.; Krzywinski, M.; Strauss, J.; Barnes, R.; Watson, P.; Allen-Vercoe, E.; Moore, R.A.; et al. Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma. Genome Res. 2012, 22, 299–306. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, T.; Guo, F.; Yu, Y.; Sun, T.; Ma, D.; Han, J.; Qian, Y.; Kryczek, I.; Sun, D.; Nagarsheth, N.; et al. Fusobacterium nucleatum promotes chemoresistance to colorectal cancer by modulating autophagy. Cell 2017, 170, 548–563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, F.; Liu, J.; Wang, F.; Zheng, G.; Wang, Q.; Liu, S.; Xu, G.; Guo, M.; Lian, X.; Zhang, H. Prognostic value of differentiation status in gastric cancer. BMC Cancer 2018, 18, 865. [Google Scholar] [CrossRef] [PubMed]
- Von Elm, E.; Altman, D.G.; Egger, M.; Pocock, S.J.; Gøtzsche, P.C.; Vandenbroucke, J.P. The strengthening the reporting of observational studies in epidemiology (STROBE) statement: Guidelines for reporting observational studies. J. Clin. Epidemiol. 2008, 61, 344–349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trombelli, L.; Farina, R.; Silva, C.O.; Tatakis, D.N. Plaque-induced gingivitis: Case definition and diagnostic considerations. J. Clin. Periodontol. 2018, 45 (Suppl. 20), S44–S67. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hyvärinen, K.; Laitinen, S.; Paju, S.; Hakala, A.; Suominen-Taipale, L.; Skurnik, M.; Könönen, E.; Pussinen, P. Detection and quantification of five major periodontal pathogens by single copy gene-based real-time PCR. Innate Immun. 2009, 15, 195–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Periodontal Status | F. nucleatum | P. gingivalis | T. denticola | T. forsythia | A. actinomycetemcomitans | fadA | AT | PPD | CAL | BOP |
---|---|---|---|---|---|---|---|---|---|---|
% (n) | Mean ± SD | |||||||||
G | 100 (10) | 60 (6) | 70 (7) | 90 (9) | 0 (0) | 0 (0) | 5.9 ± 1.72 | 1.37 ± 0.24 | 0 | 14.22 ± 2.22 |
P | 100 (14) | 85.71 (12) | 78.57 (11) | 100 (14) | 35.71 (5) | 92.85 (13) | 9.35 ± 2.92 | 6.27 ± 0.75 | 4.02 ± 0.74 | 47.49 ± 12.23 |
G | P | |
---|---|---|
DG | well/moderate/poor | well/moderate/poor |
% | 20/30/50 | 14.28/28.57/57.14 |
Pathogen * | Primer 5′→3′ | Probe 5′→3′ | Gene |
---|---|---|---|
A.actinomycetemcomitans | F: GCGAACGTTAGCGTTTTAC R: GGCAAATAAACGTGGGTGAC | AATTGCCCGCACCGAAACCCAAC 5′_Cy5→BHQ2_3′ | waaA |
P. gingivalis | F: TGGTTTCATGCAGCTTCTT R: TCGGCACCTTCGTAATTCTT | CGTACCTCATATCCCGAGGGGCTG 5′_HEX→BHQ1_3′ | waaA |
T. denticola | F: CCTTGAACAAAAACCGGAA R: GGGAAAAGCAGGAAGCATAA | GAGCTCTGAATAATTTTGATGCA 5′_Cy5→BHQ2_3′ | waaG |
T. forsythia | F: CTCGCTCGGTGAGTTTGAA R: ATGGCGAAAAGAACGTCAAC | CGATTCGCAAGCGTTATCCCGACT 5′_HEX→BHQ1_3′ | waaA |
F. nucleatum | F: AGAGTTTGATCCTGGCTCAG R: GTCATCGTGCACACAGAATTGCTG | 16S rRNA | |
fadA | F: CACAAGCTGACGCTGCTAGA R: TTACCAGCTCTTAAAGCTTG | fadA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nicolae, F.M.; Didilescu, A.C.; Șurlin, P.; Ungureanu, B.S.; Șurlin, V.M.; Pătrașcu, Ș.; Ramboiu, S.; Jelihovschi, I.; Iancu, L.S.; Ghilusi, M.; et al. Subgingival Periopathogens Assessment and Clinical Periodontal Evaluation of Gastric Cancer Patients—A Cross Sectional Pilot Study. Pathogens 2022, 11, 360. https://doi.org/10.3390/pathogens11030360
Nicolae FM, Didilescu AC, Șurlin P, Ungureanu BS, Șurlin VM, Pătrașcu Ș, Ramboiu S, Jelihovschi I, Iancu LS, Ghilusi M, et al. Subgingival Periopathogens Assessment and Clinical Periodontal Evaluation of Gastric Cancer Patients—A Cross Sectional Pilot Study. Pathogens. 2022; 11(3):360. https://doi.org/10.3390/pathogens11030360
Chicago/Turabian StyleNicolae, Flavia Mirela, Andreea Cristiana Didilescu, Petra Șurlin, Bogdan Silviu Ungureanu, Valeriu Marin Șurlin, Ștefan Pătrașcu, Sandu Ramboiu, Igor Jelihovschi, Luminita Smaranda Iancu, Mirela Ghilusi, and et al. 2022. "Subgingival Periopathogens Assessment and Clinical Periodontal Evaluation of Gastric Cancer Patients—A Cross Sectional Pilot Study" Pathogens 11, no. 3: 360. https://doi.org/10.3390/pathogens11030360