Assay for Evaluating the Abundance of Vibrio cholerae and Its O1 Serogroup Subpopulation from Water without DNA Extraction
Abstract
:1. Introduction
2. Results
2.1. Analytical Validation
2.2. Limit of Detection (LOD)
2.3. Assay Precision and Efficiency
2.4. Analysis of Environmental Water Samples
3. Discussion
4. Materials and Methods
4.1. Preparation of Bacterial Cultures
4.2. Collection and Processing of Environmental Samples
4.3. Amplification Using the Chai Open qPCR Platform
4.4. Standard Curve for the qPCR Assay
4.5. Determination of the LOD and qPCR Efficiency
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huang, J.; Zhu, Y.; Wen, H.; Zhang, J.; Huang, S.; Niu, J.; Li, Q. Quadruplex real-time PCR assay for detection and identification of Vibrio cholerae O1 and O139 strains and determination of their toxigenic potential. Appl. Environ. Microbiol. 2009, 75, 6981–6985. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albert, M.J.; Siddique, A.K.; Islam, M.S.; Faruque, A.S.; Ansaruzzaman, M.; Faruque, S.M.; Sack, R.B. Large outbreak of clinical cholera due to Vibrio cholerae non-O1 in Bangladesh. Lancet 1993, 341, 704. [Google Scholar]
- Bakhshi, B.; Barzelighi, H.M.; Adabi, M.; Lari, A.R.; Pourshafie, M. A molecular survey on virulence associated genotypes of non-O1 non-O139 Vibrio cholerae in aquatic environment of Tehran, Iran. Water Res. 2009, 43, 1441–1447. [Google Scholar] [CrossRef] [PubMed]
- Chhotray, G.; Pal, B.; Khuntia, H.; Chowdhury, N.; Chakraborty, S.; Yamasaki, S.; Ramamurthy, T.; Takeda, Y.; Bhattacharya, S.; Nair, G.B.J.E.; et al. Incidence and molecular analysis of Vibrio cholerae associated with cholera outbreak subsequent to the super cyclone in Orissa, India. Epidemiol. Infect. 2002, 128, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Jesudason, M.; Samuel, R.; John, T.J. Reappearance of Vibrio cholerae 01 and concurrent prevalence of 01 and 0139 in Vellore, South India. Lancet 1994, 344, 335–336. [Google Scholar] [CrossRef]
- European Centre for Disease Prevention and Control (ECDC). Cholera Worldwide Overview. Available online: https://www.ecdc.europa.eu/en/all-topics-z/cholera/surveillance-and-disease-data/cholera-monthly (accessed on 13 February 2022).
- Centers for Disease Control and Prevention; National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); Division of Foodborne, Waterborne, and Environmental Diseases (DFWED). Cholera-Vibrio Cholerae Infection. Available online: https://www.cdc.gov/cholera/general/index.html (accessed on 13 February 2022).
- Geng, M.-J.; Zhang, H.-Y.; Yu, L.-J.; Lv, C.-L.; Wang, T.; Che, T.-L.; Xu, Q.; Jiang, B.-G.; Chen, J.-J.; Hay, S.I.; et al. Changes in notifiable infectious disease incidence in China during the COVID-19 pandemic. Nat. Commun. 2021, 12, 6923. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Wang, M.; Huang, X.; Xie, M.; Pan, L.; Liu, H.; Liu, Z.; Zhou, P. Changes in Incidence of Notifiable Infectious Diseases in China Under the Prevention and Control Measures of COVID-19. Front. Public Health 2021, 9, 1548. [Google Scholar] [CrossRef]
- Hibiya, K.; Iwata, H.; Kinjo, T.; Shinzato, A.; Tateyama, M.; Ueda, S.; Fujita, J. Incidence of common infectious diseases in Japan during the COVID-19 pandemic. PLoS ONE 2022, 17, e0261332. [Google Scholar] [CrossRef]
- WHO. Ending Cholera—A Global Roadmap to 2030; World Health Organization: Geneva, Switzerland, 2019; pp. 1–32. [Google Scholar]
- Ratnayake, R.; Finger, F.; Edmunds, W.J.; Checchi, F. Early detection of cholera epidemics to support control in fragile states: Estimation of delays and potential epidemic sizes. BMC Med. 2020, 18, 397. [Google Scholar] [CrossRef]
- Reuters. Yemen Cholera Outbreak Accelerates to 10,000+ Cases Per Week; WHO: Geneva, Switzerland, 2018. [Google Scholar]
- WHO. Cholera Situation in Yemen, December 2020; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
- Bliem, R.; Schauer, S.; Plicka, H.; Obwaller, A.; Sommer, R.; Steinrigl, A.; Alam, M.; Reischer, G.H.; Farnleitner, A.H.; Kirschner, A. A novel triplex quantitative PCR strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Appl. Environ. Microbiol. 2015, 81, 3077–3085. [Google Scholar] [CrossRef] [Green Version]
- Blackstone, G.M.; Nordstrom, J.L.; Bowen, M.D.; Meyer, R.F.; Imbro, P.; DePaola, A. Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey of Mobile Bay. J. Microbiol. Methods 2007, 68, 254–259. [Google Scholar] [CrossRef]
- Islam, M.; Hasan, M.; Miah, M.; Yunus, M.; Zaman, K.; Albert, M. Isolation of Vibrio cholerae O139 synonym Bengal from the aquatic environment in Bangladesh: Implications for disease transmission. Appl. Environ. Microbiol. 1994, 60, 1684–1686. [Google Scholar] [CrossRef] [Green Version]
- Ramamurthy, T.; Garg, S.; Sharma, R.; Bhattacharya, S.; Nair, G.B.; Shimada, T.; Takeda, T.; Karasawa, T.; Kurazano, H.; Pal, A.J.T.L. Emergence of novel strain of Vibrio cholerae with epidemic potential in southern and eastern India. Lancet 1993, 341, 703–704. [Google Scholar] [CrossRef]
- Islam, M.T.; Alam, M.; Boucher, Y. Emergence, ecology and dispersal of the pandemic generating Vibrio cholerae lineage. Int. Microbiol. 2017, 20, 106–115. [Google Scholar]
- Bliem, R.; Reischer, G.; Linke, R.; Farnleitner, A.; Kirschner, A. Spatiotemporal dynamics of Vibrio cholerae in turbid alkaline lakes as determined by quantitative PCR. Appl. Environ. Microbiol. 2018, 84, e00317-18. [Google Scholar] [CrossRef] [Green Version]
- Glass, R.I.; Becker, S.; Huq, M.I.; Stoll, B.J.; Khan, M.; Merson, M.H.; Lee, J.V.; Black, R.E. Endemic cholera in rural Bangladesh, 1966–1980. Am. J. Epidemiol. 1982, 116, 959–970. [Google Scholar] [CrossRef]
- Kaper, J.; Morris, J.L.M. Cholera. Clin. Microbiol. Rev. 1995, 8, 48–86. [Google Scholar] [CrossRef]
- Faruque, S.M.; Albert, M.J.; Mekalanos, J.J. Epidemiology, genetics, and ecology of toxigenic Vibrio cholerae. Microbiol. Mol. Biol. Rev. 1998, 62, 1301–1314. [Google Scholar] [CrossRef] [Green Version]
- Colwell, R.R. Viable but nonculturable bacteria: A survival strategy. J. Infect. Chemother. 2000, 6, 121–125. [Google Scholar] [CrossRef]
- Huq, A.; Colwell, R.R.; Chowdhury, M.A.R.; Xu, B.; Moniruzzaman, S.M.; Islam, M.S.; Yunus, M.; Albert, M.J. Coexistence of Vibrio cholerae 01 and 0139 Bengal in plankton in Bangladesh. Lancet 1995, 345, 1249. [Google Scholar] [CrossRef]
- Epstein, P.R. Algal blooms in the spread and persistence of cholera. Biosystems 1993, 31, 209–221. [Google Scholar] [CrossRef]
- Islam, M.S.; Zaman, M.H.; Islam, M.S.; Ahmed, N.; Clemens, J.D. Environmental reservoirs of Vibrio cholerae. Vaccine 2020, 38, A52–A62. [Google Scholar] [CrossRef]
- Lee, K. The global dimensions of cholera. Glob. Chang. Hum. Health 2001, 2, 6–17. [Google Scholar] [CrossRef]
- Piarroux, R.; Barrais, R.; Faucher, B.; Haus, R.; Piarroux, M.; Gaudart, J.; Magloire, R.; Raoult, D. Understanding the cholera epidemic, Haiti. Emerg. Infect. Dis. 2011, 17, 1161. [Google Scholar] [CrossRef]
- Zuckerman, J.N.; Rombo, L.; Fisch, A. The true burden and risk of cholera: Implications for prevention and control. Lancet Infect. Dis. 2007, 7, 521–530. [Google Scholar] [CrossRef]
- Orata, F.D.; Keim, P.S.; Boucher, Y. The 2010 cholera outbreak in Haiti: How science solved a controversy. PLoS Pathog. 2014, 10, e1003967. [Google Scholar] [CrossRef]
- Guillaume, Y.; Ternier, R.; Vissieres, K.; Casseus, A.; Chery, M.J.; Ivers, L.C. Responding to cholera in Haiti: Implications for the national plan to eliminate cholera by 2022. J. Infect. Dis. 2018, 218, S167–S170. [Google Scholar] [CrossRef]
- Pan American Health Organization (PAHO). Haiti Reaches One-Year Free of Cholera. Available online: https://www3.paho.org/hq/index.php?option=com_content&view=article&id=15684:haiti-reaches-one-year-free-of-cholera&Itemid=1926&lang=en (accessed on 28 January 2022).
- Satcher, D. Emerging infections: Getting ahead of the curve. Emerg. Infect. Dis. 1995, 1, 1–6. [Google Scholar] [CrossRef]
- Poirier, M.J.; Izurieta, R.; Malavade, S.S.; McDonald, M.D. Re-emergence of Cholera in the Americas: Risks, Susceptibility, and Ecology. J. Glob. Infect. Dis. 2012, 4, 162–171. [Google Scholar] [CrossRef]
- Almagro-Moreno, S.; Taylor, R.K. Cholera: Environmental reservoirs and impact on disease transmission. Microbiol. Spectr. 2013, 1, 1–2. [Google Scholar] [CrossRef] [Green Version]
- Colwell, R.; Brayton, P.; Grimes, D.; Roszak, D.; Huq, S.; Palmer, L. Viable but non-culturable Vibrio cholerae and related pathogens in the environment: Implications for release of genetically engineered microorganisms. Nat. Biotechnol. 1985, 3, 817. [Google Scholar] [CrossRef]
- Naser, I.B.; Shishir, T.A.; Faruque, S.N.; Hoque, M.M.; Hasan, A.; Faruque, S.M. Environmental prevalence of toxigenic Vibrio cholerae O1 in Bangladesh coincides with V. cholerae non-O1 non-O139 genetic variants which overproduce autoinducer-2. PLoS ONE 2021, 16, e0254068. [Google Scholar] [CrossRef] [PubMed]
- Hasan, J.; Huq, A.; Tamplin, M.L.; Siebeling, R.J.; Colwell, R.R. A novel kit for rapid detection of Vibrio cholerae O1. J. Clin. Microbiol. 1994, 32, 249–252. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Colwell, R.R. Nonculturable but still viable and potentially pathogenic. Zentbl. Bacteriol. 1993, 279, 154–158. [Google Scholar] [CrossRef]
- Benenson, A.S.; Islam, M.R.; Greenough, W.B., III. Rapid identification of Vibrio cholerae by darkfield microscopy. Bull. World Health Organ. 1964, 30, 827. [Google Scholar]
- Alam, M.; Hasan, N.A.; Sultana, M.; Nair, G.B.; Sadique, A.; Faruque, A.; Endtz, H.P.; Sack, R.; Huq, A.; Colwell, R. Diagnostic limitations to accurate diagnosis of cholera. J. Clin. Microbiol. 2010, 48, 3918–3922. [Google Scholar] [CrossRef] [Green Version]
- Almeida, R.; Hickman-Brenner, F.; Sowers, E.; Puhr, N.; Farmer, J.; Wachsmuth, I. Comparison of a latex agglutination assay and an enzyme-linked immunosorbent assay for detecting cholera toxin. J. Clin. Microbiol. 1990, 28, 128–130. [Google Scholar] [CrossRef] [Green Version]
- Harris, J.R.; Cavallaro, E.C.; De Nóbrega, A.A.; Dos S. Barrado, J.C.B.; Bopp, C.; Parsons, M.B.; Djalo, D.; da S. Fonseca, F.G.; Ba, U.; Semedo, A.; et al. Field evaluation of Crystal VC® Rapid Dipstick test for cholera during a cholera outbreak in Guinea-Bissau. Trop. Med. Int. Health 2009, 14, 1117–1121. [Google Scholar] [CrossRef]
- Moyenuddin, M.; Rahman, K.M.; Sack, D.A. The aetiology of diarrhoea in children at an urban hospital in Bangladesh. Trans. R. Soc. Trop. Med. Hyg. 1987, 81, 299–302. [Google Scholar] [CrossRef]
- Xu, H.-S.; Roberts, N.; Adams, L.; West, P.; Siebeling, R.; Huq, A.; Huq, M.; Rahman, R.; Colwell, R. An indirect fluoresent antibody staining procedure for detection of Vibrio cholerae serovar 01 cells in aquatic environmental samples. J. Microbiol. Methods 1984, 2, 221–231. [Google Scholar] [CrossRef]
- Girard, L.; Peuchet, S.; Servais, P.; Henry, A.; Charni-Ben-Tabassi, N.; Baudart, J. Spatiotemporal Dynamics of Total Viable Vibrio spp. in a NW Mediterranean Coastal Area. Microbes Environ. 2017, 32, 210–218. [Google Scholar] [CrossRef] [Green Version]
- Schauer, S.; Sommer, R.; Farnleitner, A.H.; Kirschner, A.K.T. Rapid and sensitive quantification of Vibrio cholerae and Vibrio mimicus cells in water samples by use of catalyzed reporter deposition fluorescence in situ hybridization combined with solid-phase cytometry. Appl. Environ. Microbiol. 2012, 78, 7369–7375. [Google Scholar] [CrossRef] [Green Version]
- Rudko, S.P.; Reimink, R.L.; Peter, B.; White, J.; Hanington, P.C. Democratizing water monitoring: Implementation of a community-based qPCR monitoring program for recreational water hazards. PLoS ONE 2020, 15, e0229701. [Google Scholar] [CrossRef]
- Kirchberger, P.C.; Orata, F.D.; Barlow, E.J.; Kauffman, K.M.; Case, R.J.; Polz, M.F.; Boucher, Y. A small number of phylogenetically distinct clonal complexes dominate a coastal Vibrio cholerae population. Appl. Environ. Microbiol. 2016, 82, 5576–5586. [Google Scholar] [CrossRef] [Green Version]
- Heidelberg, J.F.; Eisen, J.A.; Nelson, W.C.; Clayton, R.A.; Gwinn, M.L.; Dodson, R.J.; Haft, D.H.; Hickey, E.K.; Peterson, J.D.; Umayam, L. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 2000, 406, 477–483. [Google Scholar] [CrossRef] [Green Version]
- Chun, J.; Grim, C.J.; Hasan, N.A.; Lee, J.H.; Choi, S.Y.; Haley, B.J.; Taviani, E.; Jeon, Y.S.; Kim, D.W.; Lee, J.H.; et al. Comparative genomics reveals mechanism for short-term and long-term clonal transitions in pandemic Vibrio cholerae. Proc. Natl. Acad. Sci. USA 2009, 106, 15442–15447. [Google Scholar] [CrossRef] [Green Version]
- Yang, N.; Liu, M.; Luo, X.; Pan, J. Draft genome sequence of Strain ATCC 17802(T), the type strain of Vibrio parahaemolyticus. Mar Genom. 2015, 24 Pt 3, 203–205. [Google Scholar] [CrossRef]
- Li, Z.; Chen, H.; Chen, X.; Zhou, T.; Zhao, L.; Zhang, C.; Jin, W. Genome sequence of the human-pathogenic bacterium Vibrio vulnificus type strain ATCC 27562. J. Bacteriol. 2012, 194, 6954–6955. [Google Scholar] [CrossRef] [Green Version]
- Stine, O.C.; Sozhamannan, S.; Gou, Q.; Zheng, S.; Morris, J.G., Jr.; Johnson, J.A. Phylogeny of Vibrio cholerae based on recA sequence. Infect. Immun. 2000, 68, 7180–7185. [Google Scholar] [CrossRef] [Green Version]
- Fouz, B.; Roig, F.J.; Amaro, C. Phenotypic and genotypic characterization of a new fish-virulent Vibrio vulnificus serovar that lacks potential to infect humans. Microbiology 2007, 153, 1926–1934. [Google Scholar] [CrossRef] [Green Version]
- Haley, B.J.; Grim, C.J.; Hasan, N.A.; Choi, S.-Y.; Chun, J.; Brettin, T.S.; Bruce, D.C.; Challacombe, J.F.; Detter, J.C.; Han, C.S. Comparative genomic analysis reveals evidence of two novel Vibrio species closely related to V. cholerae. BMC Microbiol. 2010, 10, 154. [Google Scholar] [CrossRef] [Green Version]
- Kirchberger, P.C.; Turnsek, M.; Hunt, D.E.; Haley, B.J.; Colwell, R.R.; Polz, M.F.; Tarr, C.L.; Boucher, Y. Vibrio metoecus sp. nov., a close relative of Vibrio cholerae isolated from coastal brackish ponds and clinical specimens. Int. J. Syst. Evol. Microbiol. 2014, 64, 3208–3214. [Google Scholar] [CrossRef]
- Orata, F.D.; Kirchberger, P.C.; Méheust, R.; Barlow, E.J.; Tarr, C.L.; Boucher, Y. The dynamics of genetic interactions between Vibrio metoecus and Vibrio cholerae, two close relatives co-occurring in the environment. Genome Biol. Evol. 2015, 7, 2941–2954. [Google Scholar] [CrossRef] [Green Version]
- Davis, B.R.; Fanning, G.R.; Madden, J.M.; Steigerwalt, A.G.; Bradford, H.B.; Smith, H.L.; Brenner, D.J. Characterization of biochemically atypical Vibrio cholerae strains and designation of a new pathogenic species, Vibrio mimicus. J. Clin. Microbiol. 1981, 14, 631–639. [Google Scholar] [CrossRef] [Green Version]
- Taniguchi, K.; Nakamura, A.; Tsurubuchi, K.; O’Hara, K.; Sawai, T. Identification of Escherichia coli clinical isolates producing macrolide 2′-phosphotransferase by a highly sensitive detection method. FEMS Microbiol. Lett. 1998, 167, 191–195. [Google Scholar] [CrossRef]
- McGilvray, D.; Umbarger, H.E. Regulation of transaminase C synthesis in Escherichia coli: Conditional leucine auxotrophy. J. Bacteriol. 1974, 120, 715–723. [Google Scholar] [CrossRef] [Green Version]
- Ohman, D.E.; Cryz, S.J.; Iglewski, B.H. Isolation and characterization of Pseudomonas aeruginosa PAO mutant that produces altered elastase. J. Bacteriol. 1980, 142, 836–842. [Google Scholar] [CrossRef] [Green Version]
- Lee, D.G.; Urbach, J.M.; Wu, G.; Liberati, N.T.; Feinbaum, R.L.; Miyata, S.; Diggins, L.T.; He, J.; Saucier, M.; Deziel, E.; et al. Genomic analysis reveals that Pseudomonas aeruginosa virulence is combinatorial. Genome Biol. 2006, 7, R90. [Google Scholar] [CrossRef] [Green Version]
- Takemura, A.F.; Chien, D.M.; Polz, M.F. Associations and dynamics of Vibrionaceae in the environment, from the genus to the population level. Front. Microbiol. 2014, 5, 38. [Google Scholar] [CrossRef] [Green Version]
- Colwell, R.R.; Huq, A. Vibrios in the Environment: Viable but Nonculturable Vibrio cholerae. In Vibrio cholerae and Cholera; American Society of Microbiology: Washington, DC, USA, 1994; pp. 117–133. [Google Scholar]
- Alam, M.; Sultana, M.; Nair, G.B.; Siddique, A.; Hasan, N.A.; Sack, R.B.; Sack, D.A.; Ahmed, K.; Sadique, A.; Watanabe, H. Viable but nonculturable Vibrio cholerae O1 in biofilms in the aquatic environment and their role in cholera transmission. Proc. Natl. Acad. Sci. USA 2007, 104, 17801–17806. [Google Scholar] [CrossRef] [Green Version]
- Colwell, R.R.; Brayton, P.; Herrington, D.; Tall, B.; Huq, A.; Levine, M.M. Viable but non-culturable Vibrio cholerae O1 revert to a cultivable state in the human intestine. World J. Microbiol. Biotechnol. 1996, 12, 28–31. [Google Scholar] [CrossRef] [PubMed]
- Faruque, S.M.; Islam, M.J.; Ahmad, Q.S.; Faruque, A.; Sack, D.A.; Nair, G.B.; Mekalanos, J. Self-limiting nature of seasonal cholera epidemics: Role of host-mediated amplification of phage. Proc. Natl. Acad. Sci. USA 2005, 102, 6119–6124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hussain, N.A.S.; Kirchberger, P.C.; Case, R.J.; Boucher, Y.F. Modular Molecular Weaponry Plays a Key Role in Competition within an Environmental Vibrio cholerae Population. Front. Microbiol. 2021, 12, 671092. [Google Scholar] [CrossRef] [PubMed]
- Huq, A.; Colwell, R.R.; Rahman, R.; Ali, A.; Chowdhury, M.; Parveen, S.; Sack, D.; Russek-Cohen, E. Detection of Vibrio cholerae O1 in the aquatic environment by fluorescent-monoclonal antibody and culture methods. Appl. Environ. Microbiol. 1990, 56, 2370–2373. [Google Scholar] [CrossRef] [Green Version]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [Green Version]
- Schmid-Hempel, P.; Frank, S.A. Pathogenesis, virulence, and infective dose. J. PLoS Pathog. 2007, 3, e147. [Google Scholar] [CrossRef] [Green Version]
- Kothary, M.H.; Babu, U.S. Infective dose of foodborne pathogens in volunteers: A review. J. Food Saf. 2001, 21, 49–68. [Google Scholar] [CrossRef]
- Alam, M.; Sultana, M.; Nair, G.B.; Sack, R.B.; Sack, D.A.; Siddique, A.K.; Ali, A.; Huq, A.; Colwell, R.R. Toxigenic Vibrio cholerae in the aquatic environment of Mathbaria, Bangladesh. Appl. Environ. Microbiol. 2006, 72, 2849–2855. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, F.; Fakhruddin, A.N.M.; Imam, M.D.T.; Khan, N.; Abdullah, A.T.M.; Khan, T.A.; Rahman, M.M.; Uddin, M.N. Assessment of roadside surface water quality of Savar, Dhaka, Bangladesh using GIS and multivariate statistical techniques. Appl. Water Sci. 2017, 7, 3511–3525. [Google Scholar] [CrossRef] [Green Version]
- Nasreen, T.; Hussain, N.A.S.; Islam, M.T.; Orata, F.D.; Kirchberger, P.C.; Case, R.J.; Alam, M.; Yanow, S.K.; Boucher, Y.F. Simultaneous Quantification of Vibrio metoecus and Vibrio cholerae with Its O1 Serogroup and Toxigenic Subpopulations in Environmental Reservoirs. Pathogens 2020, 9, 1053. [Google Scholar] [CrossRef]
- Rashid, M.u.; Rahman, Z.; Burrowes, V.; Perin, J.; Mustafiz, M.; Monira, S.; Saif-Ur-Rahman, K.; Bhuyian, S.I.; Mahmud, M.T.; Sack, R.B. Rapid dipstick detection of Vibrio cholerae in household stored and municipal water in Dhaka, Bangladesh: CHoBI7 trial. Trop. Med. Int. Health 2017, 22, 205–209. [Google Scholar] [CrossRef] [Green Version]
- George, C.M.; Monira, S.; Sack, D.A.; Rashid, M.-U.; Saif-Ur-Rahman, K.; Mahmud, T.; Rahman, Z.; Mustafiz, M.; Bhuyian, S.I.; Winch, P.J.; et al. Randomized controlled trial of hospital-based hygiene and water treatment intervention (CHoBI7) to reduce cholera. Emerg. Infect. Dis. 2016, 22, 233. [Google Scholar] [CrossRef]
- Aktar, P.; Moonajilin, M.S. Assessment of Water Quality Status of Turag River due to Industrial Effluent. Int. J. Eng. Inf. Syst. 2017, 1, 105–118. [Google Scholar]
- Sakib, S.N.; Reddi, G.; Almagro-Moreno, S. Environmental role of pathogenic traits in Vibrio cholerae. J. Bacteriol. 2018, 200, e00795-17. [Google Scholar] [CrossRef] [Green Version]
- Jutla, A.; Whitcombe, E.; Hasan, N.; Haley, B.; Akanda, A.; Huq, A.; Alam, M.; Sack, R.B.; Colwell, R. Environmental factors influencing epidemic cholera. Am. J. Trop. Med. Hyg. 2013, 89, 597–607. [Google Scholar] [CrossRef]
- Vezzulli, L.; Stauder, M.; Grande, C.; Pezzati, E.; Verheye, H.M.; Owens, N.J.; Pruzzo, C. gbpA as a novel qPCR target for the species-specific detection of Vibrio cholerae O1, O139, non-O1/non-O139 in environmental, stool, and historical continuous plankton recorder samples. PLoS ONE 2015, 10, e0123983. [Google Scholar] [CrossRef]
- Sultana, M.; Nusrin, S.; Hasan, N.A.; Sadique, A.; Ahmed, K.U.; Islam, A.; Hossain, A.; Longini, I.; Nizam, A.; Huq, A.; et al. Biofilms comprise a component of the annual cycle of Vibrio cholerae in the bay of Bengal estuary. mBio 2018, 9, e00483-18. [Google Scholar] [CrossRef] [Green Version]
- Pia, H.I.; Aktar, M.; Sarkar, S.; Rahman, A.; Rayhan, A.B.M.S.; Islam, M.M.; Hassan, M. Assessment of water quality varies between pre-monsoon and post-monsoon season of the typical contaminated river of Bangladesh. A case study of Shitalakhya river, Dhaka. Int. J. Agric. Environ. Biores. 2018, 3, 129–141. [Google Scholar]
- Staff Correspondent. 6 Rivers around Dhaka: Water turning untreatable? The Daily Star, 5 December 2016. [Google Scholar]
- LatLong.net. Gabtoli, Dhaka, Bangladesh. Available online: https://www.latlong.net/place/gabtoli-dhaka-bangladesh-22624.html (accessed on 1 June 2019).
- Herigstad, B.; Hamilton, M.; Heersink, J. How to optimize the drop plate method for enumerating bacteria. J. Microbiol. Methods 2001, 44, 121–129. [Google Scholar] [CrossRef]
- Pfaffl, M. Quantification strategies in real-time PCR. In A–Z of Quantitative PCR; International University Line (IUL): La Jolla, CA, USA, 2004; pp. 87–112. [Google Scholar]
Species | No. of Strains | Strain | Target Genes | Source | Reference | |
---|---|---|---|---|---|---|
viuB | rfbO1 | |||||
V. cholerae | ||||||
V. cholerae non-O1 | 17 | OYP1G01 | + | − | Environmental | This study |
OYP2A12 | + | − | Environmental | This study | ||
OYP2E01 | + | − | Environmental | This Study | ||
OYP3B05 | + | − | Environmental | [50] | ||
OYP3F10 | + | − | Environmental | This study | ||
OYP4B01 | + | − | Environmental | This study | ||
OYP4C07 | + | − | Environmental | [50] | ||
OYP4G08 | + | − | Environmental | This study | ||
OYP4H06 | + | − | Environmental | This study | ||
OYP4H11 | + | − | Environmental | This study | ||
OYP6D06 | + | − | Environmental | This study | ||
OYP6E07 | + | − | Environmental | This study | ||
OYP6F08 | + | − | Environmental | This study | ||
OYP6F10 | + | − | Environmental | This study | ||
OYP7C09 | + | − | Environmental | This study | ||
OYP8C06 | + | − | Environmental | This study | ||
OYP8F12 | + | − | Environmental | This study | ||
V. cholerae O1 | 8 | N16961 | + | + | Clinical | [51] |
V52 | + | + | Clinical | [52] | ||
EDC-728 | + | + | Environmental | This study | ||
EDC-753 | + | + | Environmental | This study | ||
EDC-754 | + | + | Environmental | This study | ||
EDC-755 | + | + | Environmental | This study | ||
EDC-772 | + | + | Environmental | This study | ||
EDC-805 | + | + | Environmental | This study | ||
Other Vibrio species | ||||||
V. parahaemolyticus | 1 | ATCC 17802 | − | − | Clinical | [53] |
V. vulnificus | 3 | ATCC 27562 | − | − | Clinical | [54] |
MO6-24 | − | − | Clinical | [55] | ||
CECT 5769 | − | − | Environmental | [56] | ||
V. metoecus | 10 | RC341 | − | − | Environmental | [57] |
OP3H | − | − | Environmental | [58] | ||
OYP4D01 | − | − | Environmental | [59] | ||
OYP4E03 | − | − | Environmental | This study | ||
OYP5B04 | − | − | Environmental | [59] | ||
OYP5B06 | − | − | Environmental | [59] | ||
OYP5H08 | − | − | Environmental | This study | ||
OYP8G05 | − | − | Environmental | This study | ||
OYP8G09 | − | − | Environmental | This study | ||
OYP8G12 | − | − | Environmental | This study | ||
V. mimicus | 3 | ATCC 33653 | − | − | Clinical | [60] |
ATCC 33654 | − | − | Environmental | [60] | ||
ATCC 33655 | − | − | Clinical | [60] | ||
Other bacterial species | ||||||
Escherichia coli | 2 | CU1 | − | − | Clinical | [61] |
CU2 | − | − | Clinical | [62] | ||
Pseudomonas aeruginosa | 2 | PA103 | − | − | Clinical | [63] |
PA14 | − | − | Clinical | [64] |
Assay for Total V. cholerae (viuB) | Assay for V. cholerae O1 (rfbO1) | |||||||
---|---|---|---|---|---|---|---|---|
No. of CFU/Reaction | Intra-Assay Mean | %CV 1 | Inter-Assay Mean (Cq) | %CV | Intra-Assay Mean | %CV | Inter-Assay Mean (Cq) | %CV |
300,000 | 19.45 | 0.03 | 19.47 | 0.07 | 19.55 | 0.03 | 19.50 | 0.21 |
30,000 | 22.75 | 0.05 | 22.78 | 0.20 | 22.53 | 0.01 | 22.56 | 0.11 |
3000 | 25.94 | 0.02 | 25.92 | 0.07 | 25.94 | 0.01 | 25.93 | 0.07 |
300 | 29.12 | 0.01 | 29.08 | 0.19 | 29.23 | 0.02 | 29.28 | 0.13 |
30 | 32.57 | 0.02 | 32.56 | 0.08 | 32.63 | 0.01 | 32.62 | 0.03 |
3 | 35.83 | 0.01 | 35.85 | 0.07 | 35.83 | 0.01 | 35.85 | 0.03 |
1 | No amplification | |||||||
0 |
Target Gene | Primer and Probe | Sequence (5′-3′) | Amplicon Size (bp) | References |
---|---|---|---|---|
viuB | Probe | 56-FAM/TCATTTGGC/ZEN/CAGAGCATAAACCGGT/3IABkFQ | 77 | [77] |
Forward primer | TCGGTATTGTCTAACGGTAT | |||
Reverse Primer | CGATTCGTGAGGGTGATA | |||
rfbO1 | Probe | 56-FAM/AGAAGTGTG/ZEN/TGGGCCAGGTAAAGT/3IABkFQ | 113 | [77] |
Forward primer | GTAAAGCAGGATGGAAACATATTC | |||
Reverse primer | TGGGCTTACAAACTCAAGTAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nasreen, T.; Hussain, N.A.S.; Ho, J.Y.; Aw, V.Z.J.; Alam, M.; Yanow, S.K.; Boucher, Y.F. Assay for Evaluating the Abundance of Vibrio cholerae and Its O1 Serogroup Subpopulation from Water without DNA Extraction. Pathogens 2022, 11, 363. https://doi.org/10.3390/pathogens11030363
Nasreen T, Hussain NAS, Ho JY, Aw VZJ, Alam M, Yanow SK, Boucher YF. Assay for Evaluating the Abundance of Vibrio cholerae and Its O1 Serogroup Subpopulation from Water without DNA Extraction. Pathogens. 2022; 11(3):363. https://doi.org/10.3390/pathogens11030363
Chicago/Turabian StyleNasreen, Tania, Nora A.S. Hussain, Jia Yee Ho, Vanessa Zhi Jie Aw, Munirul Alam, Stephanie K. Yanow, and Yann F. Boucher. 2022. "Assay for Evaluating the Abundance of Vibrio cholerae and Its O1 Serogroup Subpopulation from Water without DNA Extraction" Pathogens 11, no. 3: 363. https://doi.org/10.3390/pathogens11030363
APA StyleNasreen, T., Hussain, N. A. S., Ho, J. Y., Aw, V. Z. J., Alam, M., Yanow, S. K., & Boucher, Y. F. (2022). Assay for Evaluating the Abundance of Vibrio cholerae and Its O1 Serogroup Subpopulation from Water without DNA Extraction. Pathogens, 11(3), 363. https://doi.org/10.3390/pathogens11030363