Direct and Rapid Identification of Vibrio Cholerae Serogroup and Toxigenicity by a Novel Multiplex Real-Time Assay
by
Yong Yan
1,†, 
Li Zhan
2,†,
Guoying Zhu
1,†,
Junyan Zhang
2,
Ping Li
1,
Lixia Chen
1,
Peiyan He
1,
Jianyong Luo
1 and
Zhongwen Chen
1,* 1
Jiaxing Key Laboratory of Pathogenic Microbiology, Jiaxing Municipal Center for Disease Control and Prevention, Wenqiao Road 486, Jiaxing 314050, China
2
Institute of Microbiology, Zhejiang Provincial Center for Disease Control and Prevention, Binsheng Road 3399, Hangzhou 310051, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2022, 11(8), 865; https://doi.org/10.3390/pathogens11080865
Submission received: 5 July 2022
/
Revised: 24 July 2022
/
Accepted: 28 July 2022
/
Published: 30 July 2022
Abstract
:Molecular diagnostic assays for cholera detection have superior sensitivity to conventional assays and are now being accepted as the new standard method, especially the real-time PCR/RT-PCR. However, limited throughput capacity and long detection duration prevent them from detecting more specimens and more targets in one turnaround time simultaneously. In this study, we utilized nucleic acid extraction-free, direct RT-PCR and high-speed amplification to develop a novel multiplex assay, a quadplex direct one-tube real-time RT-PCR assay, for rapid detection of the serogroup and cholera toxin toxigenicity of Vibrio cholerae targeting the epsM, ctxA, rfb-O1, and rfb-O139 genes. Performance of the multiplex assay was evaluated by comparison with the monoplex real-time PCR assay according to the China Cholera Prevention Manual. Detection data from clinical specimens showed that the new assay had good diagnostic sensitivities for epsM (100%, n = 301), ctxA (100%, n = 125), rfb-O1 (100%, n = 85), and rfb-O139 (97.87%, n = 49). Analysis of the analytical sensitivities with serial dilutions of positive standards showed that the detection limits of the new assay for Vibrio cholerae epsM, ctxA, rfb-O1, and rfb-O139 were up to 200, 590, 115, and 1052 copies per mL lower than the monoplex real-time PCR (910, 345, and 1616 copies/mL respectively, for ctxA, rfb-O1, and rfb-O139). The results indicate that the multiplex assay is a rapid, sensitive, specific, and easy-to-use detection tool for Vibrio cholerae, especially suitable for rapid identification and screening detection of mass specimens.
1. Introduction
Cholera is a worldwide epidemic and older infectious disease. Since 1817, from its original reservoir in the Ganges delta in India, there have been seven worldwide pandemics. The past six were caused by Vibrio cholerae serogroup O1 biotype classical, and the current pandemic was caused by V. cholerae serogroup O1 biotype El Tor and spread across all continents [1,2,3]. The serogroup O139 of V. cholerae was found in Bangladesh in 1992 and caused some outbreaks in the past, but it has never being identified outside Asia [4]. There was no difference in the illness caused by the two serogroups due to the same virulence, mainly cholera toxin (CT) and similar encoding genes [4,5,6]. In recent years, the cholera toxin (CT)-producing or cholera toxin gene (ctx)-positive strains of V. cholerae non-O1/non-O139 serogroups have been extensively reported [7,8,9], as their pathogenicity and potential harm are worthy of attention. Diagnostic serums are often used to rapidly identify V. cholerae strains; however, it is sometimes difficult to distinguish them easily using the serum agglutination test alone, especially between the serotypes in the O1 serogroup.
At present, there are three main types of detection methods for V. cholerae: (1) Traditional isolation culture and identification methods, including pathogen isolation culture, serological diagnosis, biochemical identification, and phage lysis test. The whole detection takes a long time (the fastest takes 3 days), the operation is complicated, and the reagent consumption is large. (2) Time-of-flight mass spectrometry identification can analyze bacteria-specific proteins within a short time, only about ten minutes, but it requires isolating culture to obtain bacterial monoclonal strains. The entire detection process generally takes more than 24 h and can only reach the species level of V. cholerae, and the serogroup and toxigenicity cannot be identified. Especially, the instrument is expensive. (3) Molecular biological methods based on nucleic acid are popular and the use of PCR and real-time PCR instruments can shorten the detection time of V. cholerae to 6 h (real-time PCR can shorten it to <3 h [10,11,12,13]), but the problems faced are: inconsistent methods, many reports, and different target genes for research, so that the specificity and sensitivity are different [10,11,12,13,14,15]. Since the Cholera Prevention Manual (Sixth Edition) was issued by the Ministry of Health of China in 2013, the real-time PCR method [16] has been adopted by most grassroot units in China, but it is a single-target analysis and cannot identify non-O1/non-O139 serogroup strains, so the routine detection of V. cholerae species still depends on traditional isolation and identification methods, which still cannot meet the needs of cholera prevention and control for simpleness, precision, and high efficiency. Therefore, more rapid, specific, simple, and easy-to-promote technologies and methods undoubtedly have broad application spaces.
In this study, one-step multiplex reverse-transcription-PCR (RT-PCR), high-speed amplification, and direct PCR technology were utilized to develop a novel multiplex real-time RT-PCR assay for simultaneous detection of four targets, epsM, a species-specific gene in all strains of V. cholerae; ctxA encoding cholera toxin; and rfb-O1 and rfb-O139 encoding the O1 and O139 lipopolysaccharide antigens. Due to the use of the epsM gene in combination with rfb-O1 and rfb-O139, this assay could not identify V. cholerae O1 and O139 as causing the cholera epidemic but could identify V. cholerae non-O1/non-O139 serogroups, which are not rare in localized diarrhea. In addition, the assay had the characteristics of nucleic acid extraction-free, one-tube detection, and a shorter detection time, which made it faster and easier to use. The performance of this new assay was evaluated by comparing it with a previous monoplex real-time PCR assay based on the Cholera Prevention Manual, using practical specimens, isolated strains, and synthetical plasmids from target sequences of V. cholerae.
2. Results
2.1. Analysis of Analytical Performance
The analytical sensitivities of the previous monoplex real-time PCR and the new multiplex real-time RT-PCR were assessed by testing in duplicate 10-fold serial dilutions of positive standards ranging from 106 to 101 copies/mL of target DNA plasmids for each target. The standard curves were drawn by the log10 values of the standard concentrations versus the CT values for two real-time assays (Figure 1). From calculation using the curves at the pre-set cutoff value mentioned above, the detection limits of the monoplex real-time assay were determined to be 910, 345, and 1616 gene copies per mL (equivalent to 23, 9, and 40 copies per reaction) for ctxA, rfb-O1, and rfb-O139, respectively. The data of the multiplex real-time assay were 200, 590, 115, and 1052 copies per mL (equivalent to 5, 15, 3, and 26 copies per reaction) for epsM, ctxA, rfb-O1, and rfb-O139.
The analytical performance of the two assays was also assessed by testing the diagnosed specimens, isolated strains, and positive controls. As shown in Table 1, both assays were able to detect all target bacteria and no cross reactions were observed. In order to further examine the performance of the multiplex assay for mixed infection or complexed specimens, two mixtures, PC-Mix1 and PC-Mix2, containing four targets, respectively, prepared with positive controls and isolated strains, were tested in this study and each target was detected successfully with no interference signals from the others. The results showed that the new multiplex real-time assay had gratifying analytical specificity and multiplex detection capacity for all target genes, and Mix-PC1, the mixture in equal amounts with 105 gene copies per mL of the four positive controls, was more suitable as a unified positive control of the multiplex assay to obtain a satisfactory amplification plot (Figure 2).
2.2. Analysis of Diagnostic Performance
In total, 338 practical specimens were tested using the monoplex real-time PCR assay and new developed multiplex real-time assay to assess their diagnostic performance in clinical application. The diagnostic sensitivity and specificity of the new multiplex assay for each target gene were analyzed with software SPSS version 19.0, using the results of the monoplex assay as a comparator (Table 2). Due to the lack of the species target gene for Vibrio cholerae in the monoplex real-time PCR, ctxA was previously used as an alternative to detect V. cholerae, especially in epidemic periods of cholera. Results showed that the multiplex assay has good diagnostic sensitivities for epsM (100%, n = 301), ctxA (100%, n = 125), rfb-O1 (100%, n = 85), and rfb-O139 (97.87%, n = 49), and the Kappa values of the data for the ctxA, rfb-O1, and rfb-O139 genes were more than 0.95, suggesting great consistency in the diagnostic performance of both assays for the three targets. Additionally, we found that the new multiplex assay detected more positive specimens and O1-serogroup strains, with significant values for the V. cholerae species-specific epsM (χ2 = 175, p < 0.001) and rfb-O1 gene (χ2 = 4.167, p < 0.05), indicating that the new multiplex assay for the two targets had lower detection limits and higher sensitivities than the monoplex assay.
2.3. Analysis of Cost-Effectiveness
The reagent cost and turnaround time of the previous monoplex assay and our developed multiplex assay were calculated and are listed in Table 3. The monoplex real-time PCR assay, due to the need for bacterial nucleic acid extraction before target amplification and analysis, required at least 1.4 h (80 min) to test one plate if all three panels of the assay were set up in one 96-well plate (the number of tested specimens was less than 31 because at least 3 wells were needed for the positive, negative, and blank control). The new multiplex assay took at most 40 min to test one plate (up to 93 specimens, 3 wells for the positive, negative, and blank control) due to the lack of an extraction step of nucleic acids before target amplification.
A workload of two plates (i.e., 2 × 96 reactions) were tested to compare the multi-target and throughput capability of the two assays. The previous monoplex assay needed six times to spend up to 5.5 h (330 min) and CNY ¥17,280 (¥90/reaction) for all reactions when only one real-time PCR instrument was available while the new multiplex assay needed at most 1.3 h (80 min) and ¥5760 (¥30/reaction). Within these 6 h, just a 6-h clinical shift, one technician could use the new multiplex assay to test more specimens (4 plates × 93 = 372 specimens) with a real-time PCR instrument. Obviously, it is an easier and more cost-effective alternative to the previous monoplex assay.
3. Discussion
The epsM gene is a coding gene of exocrine protein system subunit M of Vibrio cholerae, which is species-specific [17,18,19]. In this study, it was selected as the target gene to discover all strains of V. cholerae regardless of whether they were from the O1\O139 serogroup or the non-O1\non-O139 serogroup. The former, usually an epidemic strain, is of great significance in the cholera epidemic while the latter, as a non-epidemic strain, is often found in localized diarrhea and environmental water [6,15]. It was noteworthy that the CT-producing and ctx-positive strains of the V. cholerae non-O1/non-O139 serogroups have been increasingly reported [7,8,9] and have also been found in Jiaxing, a water city threatened by cholera in the south of the Yangtze River, China. Therefore, our new developed multiplex assay can not only be used in the emergency detection of V. cholerae during an epidemic period but may also play an important role in routine surveillance during non-epidemic periods.
Some commercial kits for Vibrio cholerae are available in China at present and some multiplex real-time PCR assays have been reported in previous papers for ctxA, rfb-O1, rfb-O139, and other species-specific genes, such as hlyA, rtxA, ompW, rnpB, toxR, and so on [10,11,12,13,14,15]. However, they either involved complicated steps or included unsatisfactory/unsuitable targets or did not have the species-specific targets needed. Importantly, they were too expensive or/and time-consuming for routine detection in the clinical laboratory. In this study, the reaction system of our new multiplex assay used qRT-PCR reagents with the addition of mild cell-lysing agent and PCR enhancer. The former, Triton X-100, can gently lyse cells without affecting the activity of enzymes during the PCR reaction [20,21], and the latter, Betaine, can facilitate PCR reactions [22,23,24,25], which means that nucleic acid release and detection can be performed simultaneously in one closed tube, and higher sensitivity and specificity can be obtained because both DNA and RNA targets can be detected simultaneously. Since the reagent components, such as reverse transcriptase and DNA polymerase, support high-speed amplification with high tolerance against reaction inhibition, the entire detection time of this assay could be greatly shortened to within 40 min. This is the first report to describe a real one-tube multiplex assay based specifically on real-time RT-PCR, with no nucleic acid extraction, closed-tube detection, and high-speed amplification, for rapid identification of serogroup and CT-producing toxicity of V. cholerae.
Over the past ten years, real-time PCR had been adopted by our lab for the diagnosis and surveillance of infectious diarrhea due to the advantage of simultaneous amplification and analysis, without post-amplification manipulation [26,27]. However, all of the primers and probes provided by the Cholera Prevention Manual were designed specifically for a single target of V. cholerae. Although multiplex real-time PCR was also used in this work, the limited multiplex analysis performance was obvious mainly due to the unoptimized reaction system and adverse interactions between the primers and probes [28,29,30]. So, the previous real-time PCR assay for V. cholerae had to be divided into three panels, respectively, for the ctxA, rfb-O1, and rfb-O139 genes in this study. This made the limited throughput capacity more detrimental and tighter. In an epidemic period, the monoplex assay would require more plates, more technicians, and increased turnaround time; otherwise, the lab need to buy more machines in parallel to run a large number of samples within a limited work shift. Our study showed that the previous monoplex real-time assay would take four times the time and three times the cost of the new multiplex assay to finish the workload of two plates (2 × 96 reactions).
In view of the facts, the new multiplex assay was developed for rapid-turnaround, multi-target, and high-throughput detection of Vibrio cholerae. All of its primes and probes were newly designed and labeled with double black-hole quenching (DBQ) groups for the probes to reduce the interference from background fluorescence [31,32,33,34] This allowed the assay to perform continuous analysis in a plate queue and detect four targets simultaneously with great specificities and sensitivities. Usually, the detection limit of an assay is determined in the following ways: (1) To detect a series of concentrations of standard substances, the lowest concentration at which 95% of the positive samples (at a confidence of 95%) are detected is the limit of detection [35,36]. (2) The corresponding amount of three times the instrumental background signal produced from the blank control (at a signal-to-noise ratio of 3) is the detection limit [37,38,39]. However, real-time PCR has its particularity. Due to the different sensitivities of each target detection, the minimum detection limit of each target of a multiplex real-time PCR assay is different, so the corresponding positive judgment value, that is, the cutoff of CT, is inconsistent. In addition, when the amplification is late (e.g., CT over 38), it is prone to non-specific amplification, leading to false positives due to the attenuation of enzyme activity, the consumption of substrates, and the accumulation of non-specific products, such as primer dimers. In fact, a multiplex nucleic acid assay based on real-time PCR usually selects a CT value corresponding to the highest detection limit among all targets as its uniform cutoff before ensuring the specificity of the reaction (CT < 40) to ensure that all targets can be detected and facilitate the user to apply this assay. So, in this study, the CT value of 38 was selected as the cutoff, at which the corresponding values of the new multiplex assay for epsM, ctxA, rfb-O1, and rfb-O139 were 200, 590, 115, and 1052 copies per mL as their detection limits, and the values of the previous monoplex assay were 910, 345, and 1616 copies per mL for ctxA, rfb-O1, and rfb-O139, respectively. Statistically, it showed that the diagnostic sensitivity of the new multiplex assay was significantly higher than that of the previous monoplex assay due to the usage of the species-specific target, the epsM gene, for V. cholerae.
4. Material and Methods
4.1. Ethics Statement
Informed consent was obtained from all participants before this study was conducted. This study and all procedures were approved by Jiaxing Municipal Center for Disease Control and Prevention (Approval code: 2022-03) and carried out in accordance with the biosafety and ethical standards of the institutional and national research committee and the relevant laws and regulations of the People’s Republic of China.
4.2. Specimens and Positive Controls
In total, 338 cholera-related specimens and 22 isolated bacteria strains used in this study, mainly from Jiaxing Municipal Center for Disease Control and Prevention (Jiaxing CDC), submitted by various hospitals in Jiaxing from 2013 to 2020, and partially from Zhejiang Provincial Center for Disease Control and Prevention (Zhejiang CDC). These specimens were mostly anal swabs, a small number of vomit samples, collected in transport medium and stored at −20 °C, and some environmental water samples stored in bags at 4 °C. All of them were tested by commercial real-time PCR kits or previous in-house monoplex real-time PCR assay (see below) according to the Chinese Cholera Prevention Manual (Sixth Edition).
Additionally, all positive standards of Vibrio cholerae were prepared using target DNA plasmids (Escherichia coli pUC57 vector) synthesized by Shanghai Sangon Biotech Co., Ltd. (Sangon) according to the reference sequences (Table 4). The nucleic acid extraction was performed with a MagMAX™-96 Viral RNA/DNA Isolation Kit (Catalog#AM1836, Ambion, Waltham, MA, USA) on a KingFisher Flex system (Thermo Fisher Scientific Inc., Waltham, MA, USA). The DNA extracts were quantified and calibrated with a NanoDrop™ 2000 microspectrophermeter (Thermo Fisher Scientific Inc., Waltham, MA, USA) and adjusted to 1010 copies/mL of target DNA using an EASY Dilution for Real-Time PCR (Cat#D9160A,TaKaRa) as the original quantification standards in this study. The dilutions containing 108 copies/mL of DNAs were used as positive controls and 10-fold serial dilutions were used to determine the analytical sensitivity of the following assays. All of the original standards and dilutions were stored at −80 °C until analysis.
4.3. Bacterial Nucleic Acid Extraction
Before bacterial nucleic acid extraction, bacterial isolates and specimens were incubated in alkaline peptone water (pH 8.0) for 6 h at 36 °C, and bacteria solutions were adjusted to 0.5 MCF (McFarland concentration) with normal saline. In total, 75 μL of solution was used to extract bacterial nucleic acid using the MagMax™-96 RNA/DNA Isolation Kit on the KingFisher Flex system according to the manufacturer’s recommendation. The nucleic acid extracts were collected and stored at −80 °C before use. In addition, the epsM-positive control, containing 105 copies/μL of DNA of Vibrio cholerae species-specific gene, was added to the extraction procedure in order to monitor the DNA extraction efficiency by comparing the concentrations before and after the extraction.
4.4. Primers and Probes
The primers and TaqMan probes used in this study are listed in Table 5. Those targeting the epsM, ctxA, rfb-O1, and rfb-O139 genes for our multiplex real-time assay were newly designed by our lab and used double-quenching probes with two black-hole quenching (DBQ) groups. Others used in the previous monoplex real-time assay were consistent with the sequences and labeled fluorescence recommended in the Cholera Prevention Manual, targeting the ctxA, rfb-O1, and rfb-O139 genes. All of the forward primers, reverse primers, and probes were synthesized by Shanghai Generay Biotech Co., Ltd. (Generay, Shanghai, China).
4.5. Previous Monoplex Real-Time Assay
The monoplex real-time PCR assay adopted in our lab previously had three panels to, respectively, detect 3 target genes, ctxA, rfb-O1, and rfb-O139, of Vibrio cholerae based on universal reagent Taq Pro HS Universal U+ Probe Master Mix (Cat# QN114, Vazyme Biotech Co., Ltd., Nanjing, China), using the primers, probes, and cycling conditions recommended in the Cholera Prevention Manual and the kit instructions. The final 25 μL mixture for each reaction contained 5 μL of nucleic acid extract and the optimized concentrations of the primers (-F and -R) and TaqMan probes (Table 5). The cycling condition was 37°C for 2 min, 95 °C for 30 s, and 40 cycles of 95 °C for 10 s and 60 °C for 30 s, and the assay was performed in a CFX96™ Touch Real-time PCR System (Bio-Rad Laboratories Inc., Hercules, CA, USA). The qualitative result of the assay was determined as follows: the threshold cycle value (CT) < 35, positive; no amplification or CT > 38 (considered as an invalid amplification), negative; CT between 35 and 38, reserved, if still in the range between 35 and 38 after repeat, it was considered as positive. The average CT value was determined for each standard dilution in two replicates, and the detection limit of the assay for each target was estimated from the standard curve at the cutoff point of the CT value (the value was set to 38 in this study).
4.6. New Multiplex Real-Time Assay
A new one-step multiplex direct real-time RT-PCR assay for 4 targets, including epsM, ctxA, rfb-O1, and rfb-O139, was developed by our lab, based on a universal reagent HiScript®II U+ One Step qRT-PCR Probe Kit (Cat# Q222-CN, Vazyme Biotech Co., Ltd., Nanjing, China), in order to simultaneously amplify and detect the DNA and RNA targets of Vibrio cholerae. The novelty was that the mild cell-lysing agent Triton X-100 (0.32%vol) and PCR enhancer Betaine (1 M) were added into the PCR system to release bacterial nucleic acids and enhance the PCR reaction. The final 25 μL mixture for each reaction contained 5 μL of 0.5 MCF bacteria suspension and the optimized concentrations of the primers (-F and -R) and TaqMan probes (Table 5). The real-time RT-PCR was performed in the CFX96™ Touch Real-time PCR System under the cycling condition of 50 °C for 10 min, 95 °C for 30 s, and 40 cycles of 95 °C for 2 s and 60 °C for 20 s. The qualitative result and the detection limit of the assay were determined the same as the monoplex real-time PCR assay described above.
5. Conclusions
The one-tube direct multiplex real-time RT-PCR assay developed by our laboratory has obvious advantages of rapidity, specificity, and sensitivity and is suitable for emergency detection during cholera epidemics. Additionally, with a high-throughput capability to process large numbers of specimens simultaneously, significantly reducing the cost, it is also suitable for mass surveillance during non-epidemic periods. Furthermore, due to the flexibility and novelty in extraction-free, direct PCR and high-speed amplification, the assay can be expanded to rapidly detect other pathogen targets to adapt to local seasonal or emerging changes in other infectious diseases.
Author Contributions
Conceptualization, Z.C.; methodology, Y.Y. and G.Z.; validation, P.H.; formal analysis, P.L.; investigation, J.L.; resources, L.C. and J.Z.; data curation, Y.Y.; writing—original draft preparation, Y.Y.; funding acquisition, Y.Y.; writing—review and editing, L.Z.; supervision, Z.C. All authors have read and agreed to the published version of the manuscript.
Funding
This study was financially supported by Jiaxing Municipal Science and Technology Project (Grant No. 2020AY30024). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Institutional Review Board Statement
The study was conducted in accordance with the Declaration of Helsinki, and approved by the institutional review board, Academic and Ethical Review Committee of Jiaxing Center for Disease Control and Prevention (protocol code 2022-03).
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
The data presented in this study are available on request from the corresponding author. The data are not publicly available due to relative patent applications.
Acknowledgments
The authors are grateful to Man Liang of Nanjing Vazyme Biotech Co., Ltd and Lei Liu of Shanghai Generay Biotech Co., Ltd. for the technique support of real-time PCR products and services. The authors also thank the First Affiliated Hospital of Jiaxing University for providing clinical samples and relevant data.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
References
- Alam, M.; Islam, M.T.; Rashed, S.M.; Johura, F.T.; Bhuiyan, N.A.; Delgado, G.; Morales, R.; Mendez, J.L.; Navarro, A.; Watanabe, H.; et al. Vibrio cholerae classical biotype strains reveal distinct signatures in Mexico. J. Clin. Microbiol. 2012, 50, 2212–2216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ali, M.; Lopez, A.L.; You, Y.A.; Kim, Y.E.; Sah, B.; Maskery, B.; Clemens, J. The global burden of cholera. Bull. World Health Organ. 2012, 90, 209–218A. [Google Scholar] [CrossRef] [PubMed]
- Clemens, J.D.; Nair, G.B.; Ahmed, T.; Qadri, F.; Holmgren, J. Cholera. Lancet 2017, 390, 1539–1549. [Google Scholar] [CrossRef]
- World Health Organization. Cholera 30 March 2022. Available online: https://www.who.int/news-room/fact-sheets/detail/cholera (accessed on 30 June 2022).
- Harris, J.B.; LaRocque, R.C.; Qadri, F.; Ryan, E.T.; Calderwood, S.B. Cholera. Lancet 2012, 379, 2466–2476. [Google Scholar] [CrossRef] [Green Version]
- Singh, D.V.; Matte, M.H.; Matte, G.R.; Jiang, S.; Sabeena, F.; Shukla, B.N.; Sanyal, S.C.; Huq, A.; Colwell, R.R. Molecular analysis of Vibrio cholerae O1, O139, non-O1, and non-O139 strains: Clonal relationships between clinical and environmental isolates. Appl. Environ. Microbiol. 2001, 67, 910–921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takahashi, E.; Ochi, S.; Mizuno, T.; Morita, D.; Morita, M.; Ohnishi, M.; Koley, H.; Dutta, M.; Chowdhury, G.; Mukhopadhyay, A.K.; et al. Virulence of Cholera Toxin Gene-Positive Vibrio cholerae Non-O1/non-O139 Strains Isolated From Environmental Water in Kolkata, India. Front. Microbiol. 2021, 12, 726273. [Google Scholar] [CrossRef]
- Diep, T.T.; Nguyen, N.T.; Nguyen, T.N.; An, H.K.; Nguyen, T.Q.; Nguyen, V.H.; Nguyen, T.V.; Nguyen, T.N.; Izumiya, H.; Ohnishi, M.; et al. Isolation of New Delhi metallo-β-lactamase 1-producing Vibrio cholerae non-O1, non-O139 strain carrying ctxA, st and hly genes in southern Vietnam. Microbiol. Immunol. 2015, 59, 262–267. [Google Scholar] [CrossRef]
- Yamai, S.; Okitsu, T.; Shimada, T.; Katsube, Y. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Kansenshogaku zasshi. J. Jpn. Assoc. Infect. Dis. 1997, 71, 1037–1045. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gubala, A.J. Multiplex real-time PCR detection of Vibrio cholerae. J. Microbiol. Methods 2006, 65, 278–293. [Google Scholar] [CrossRef]
- Greig, D.R.; Hickey, T.J.; Boxall, M.D.; Begum, H.; Gentle, A.; Jenkins, C.; Chattaway, M.A. A real-time multiplex PCR for the identification and typing of Vibrio cholerae. Diagn. Microbiol. Infect. Dis. 2018, 90, 171–176. [Google Scholar] [CrossRef] [PubMed]
- Gubala, A.J.; Proll, D.F. Molecular-beacon multiplex real-time PCR assay for detection of Vibrio cholerae. Appl. Environ. Microbiol. 2006, 72, 6424–6428. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mantri, C.K.; Mohapatra, S.S.; Ramamurthy, T.; Ghosh, R.; Colwell, R.R.; Singh, D.V. Septaplex PCR assay for rapid identification of Vibrio cholerae including detection of virulence and int SXT genes. FEMS Microbiol. Lett. 2006, 265, 208–214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tebbs, R.S.; Brzoska, P.M.; Furtado, M.R.; Petrauskene, O.V. Design and validation of a novel multiplex real-time PCR assay for Vibrio pathogen detection. J. Food Prot. 2011, 74, 939–948. [Google Scholar] [CrossRef] [PubMed]
- Lyon, W.J. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure cultures, raw oysters, and synthetic seawater. Appl. Environ. Microbiol. 2001, 67, 4685–4693. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiao, D. Cholera Prevention Manual, 6th ed.; People’s Medical Publishing House (PMPH): Beijing, China, 2013; pp. 93–95. [Google Scholar]
- Sandkvist, M.; Keith, J.M.; Bagdasarian, M.; Howard, S.P. Two regions of EpsL involved in species-specific protein-protein interactions with EpsE and EpsM of the general secretion pathway in Vibrio cholerae. J. Bacteriol. 2000, 182, 742–748. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sandkvist, M.; Hough, L.P.; Bagdasarian, M.M.; Bagdasarian, M. Direct interaction of the EpsL and EpsM proteins of the general secretion apparatus in Vibrio cholerae. J. Bacteriol. 1999, 181, 3129–3135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Momtaz, H.; Dehkordi, F.S.; Rahimi, E.; Asgarifar, A. Detection of Escherichia coli, Salmonella species, and Vibrio cholerae in tap water and bottled drinking water in Isfahan, Iran. BMC Public Health 2013, 13, 556. [Google Scholar] [CrossRef] [Green Version]
- Cornett, J.B.; Shockman, G.D. Cellular lysis of Streptococcus faecalis induced with triton X-100. J. Bacteriol. 1978, 135, 153–160. [Google Scholar] [CrossRef] [Green Version]
- Ma, J.; Su, C.; Hu, S.; Chen, Y.; Shu, Y.; Yue, D.; Zhang, B.; Qi, Z.; Li, S.; Wang, X.; et al. The Effect of Residual Triton X-100 on Structural Stability and Infection Activity of Adenovirus Particles. Mol. Ther. Methods Clin. Dev. 2020, 19, 35–46. [Google Scholar] [CrossRef]
- Varadharajan, B.; Parani, M. DMSO and betaine significantly enhance the PCR amplification of ITS2 DNA barcodes from plants. Genome 2021, 64, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Ralser, M.; Querfurth, R.; Warnatz, H.J.; Lehrach, H.; Yaspo, M.L.; Krobitsch, S. An efficient and economic enhancer mix for PCR. Biochem. Biophys. Res. Commun. 2006, 347, 747–751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Green, M.R.; Sambrook, J. Polymerase Chain Reaction (PCR) Amplification of GC-Rich Templates. Cold Spring Harb. Protoc. 2019, 2019, pdb-prot095141. [Google Scholar] [CrossRef] [PubMed]
- Lajin, B.; Alachkar, A.; Alhaj Sakur, A. Betaine significantly improves multiplex tetra-primer ARMS-PCR methods. Mol. Biotechnol. 2013, 54, 977–982. [Google Scholar] [CrossRef] [PubMed]
- Schalasta, G.; Arents, A.; Schmid, M.; Braun, R.W.; Enders, G. Fast and type-specific analysis of herpes simplex virus types 1 and 2 by rapid PCR and fluorescence melting-curve-analysis. Infection 2000, 28, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Schalasta, G.; Roth, B.; Enders, G. Rapid typing of the codon 129 polymorphism of the human prion protein gene by combined real-time PCR and melting curve analysis. Clin. Lab. 2002, 48, 25–30. [Google Scholar]
- Yan, Y.; Luo, J.Y.; Chen, Y.; Wang, H.H.; Zhu, G.Y.; He, P.Y.; Guo, J.L.; Lei, Y.L.; Chen, Z.W. A multiplex liquid-chip assay based on Luminex xMAP technology for simultaneous detection of six common respiratory viruses. Oncotarget 2017, 8, 96913–96923. [Google Scholar] [CrossRef] [Green Version]
- Sharman, M.; Thomas, J.E.; Dietzgen, R.G. Development of a multiplex immunocapture PCR with colourimetric detection for viruses of banana. J. Virol. Methods 2000, 89, 75–88. [Google Scholar] [CrossRef]
- Yan, Y.; Wang, H.H.; Gao, L.; Ji, J.M.; Ge, Z.J.; Zhu, X.Q.; He, P.Y.; Chen, Z.W. A one-step multiplex real-time RT-PCR assay for rapid and simultaneous detection of human norovirus genogroup I, II and IV. J. Virol. Methods 2013, 189, 277–282. [Google Scholar] [CrossRef] [PubMed]
- Xiang, D.; Li, F.; Wu, C.; Shi, B.; Zhai, K. The G-BHQ synergistic effect: Improved double quenching molecular beacons based on guanine and Black Hole Quencher for sensitive simultaneous detection of two DNAs. Talanta 2017, 174, 289–294. [Google Scholar] [CrossRef]
- Hirotsu, Y.; Mochizuki, H.; Omata, M. Double-quencher probes improve detection sensitivity toward Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a reverse-transcription polymerase chain reaction (RT-PCR) assay. J. Virol. Methods 2020, 284, 113926. [Google Scholar] [CrossRef]
- Sangon Biotech (Shanghai) Co., Ltd. Sangon DBQ Series Double-Quenched Fluorescent Probes Are Launched. Available online: https://www.sangon.com/sales2021003.html (accessed on 30 June 2022).
- Integrated DNA Technologies, Inc. (IDT). Reduce qPCR Background and Improve qPCR Signal, ZEN™ and TAO™ Double-Quenched Probes. Available online: https://sg.idtdna.com/pages/education/decoded/article/zen (accessed on 30 June 2022).
- Stokdyk, J.P.; Firnstahl, A.D.; Spencer, S.K.; Burch, T.R.; Borchardt, M.A. Determining the 95% limit of detection for waterborne pathogen analyses from primary concentration to qPCR. Water Res. 2016, 96, 105–113. [Google Scholar] [CrossRef] [PubMed]
- Vaks, J.E.; Hemyari, P.; Rullkoetter, M.; Santulli, M.J.; Schoenbrunner, N. Verification of Claimed Limit of Detection in Molecular Diagnostics. J. Appl. Lab. Med. 2016, 1, 260–270. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faruk Hossain, M.; Slaughter, G. Flexible electrochemical uric acid and glucose biosensor. Bioelectrochemistry 2021, 141, 107870. [Google Scholar] [CrossRef] [PubMed]
- Kumar, D.R.; Dhakal, G.; Nguyen, V.Q.; Shim, J.J. Molecularly imprinted hornlike polymer@electrochemically reduced graphene oxide electrode for the highly selective determination of an antiemetic drug. Anal. Chim. Acta 2021, 1141, 71–82. [Google Scholar] [CrossRef] [PubMed]
- Tai, M.; Perumal, V.; Gopinath, S.; Raja, P.B.; Ibrahim, M.; Jantan, I.N.; Suhaimi, N.; Liu, W.W. Laser-scribed graphene nanofiber decorated with oil palm lignin capped silver nanoparticles: A green biosensor. Sci. Rep. 2021, 11, 5475. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Comparison of the analytical sensitivity of the new multiplex real-time assay (a) and previous monoplex real-time assay (b). Bacterial in vitro DNA plasmids of four targets were used as standards and the concentrations of each target in the standard curves were expressed in log10 copies/mL versus threshold cycle values (CT) for the two assays.
Figure 1.
Comparison of the analytical sensitivity of the new multiplex real-time assay (a) and previous monoplex real-time assay (b). Bacterial in vitro DNA plasmids of four targets were used as standards and the concentrations of each target in the standard curves were expressed in log10 copies/mL versus threshold cycle values (CT) for the two assays.
Figure 2.
Suitable unified positive control for new multiplex assay to obtain a satisfactory amplification plot. Targets are shown as pink for the epsM gene, green for ctxA, yellow for rfb-O1, and blue for rfb-O139. Mix-PC1, the mixture in equal amounts with 105 gene copies per mL of four positive controls (a); Mix-PC2, the mixture in equal amounts with 0.5 MCF (McFarland concentration) bacterial suspensions of O1 (No. 130605, ctx-positive) and O139 (No. 200513, ctx-negative) culture strains (b).
Figure 2.
Suitable unified positive control for new multiplex assay to obtain a satisfactory amplification plot. Targets are shown as pink for the epsM gene, green for ctxA, yellow for rfb-O1, and blue for rfb-O139. Mix-PC1, the mixture in equal amounts with 105 gene copies per mL of four positive controls (a); Mix-PC2, the mixture in equal amounts with 0.5 MCF (McFarland concentration) bacterial suspensions of O1 (No. 130605, ctx-positive) and O139 (No. 200513, ctx-negative) culture strains (b).
Table 1.
Qualitative results of 38 specimens or strains using the two real-time assays.
| Samples &. No. | Monoplex Assay | Multiplex Assay | ||||||
|---|---|---|---|---|---|---|---|---|
| CtxA | Rfb-O1 | Rfb-O139 | EpsM | CtxA | Rfb-O1 | Rfb-O139 | ||
| Feces of patientsa | FC1 | + c | − c | + | + | + | − | + |
| FC2 | + | − | + | + | + | − | + | |
| FC3 | + | − | + | + | + | − | + | |
| Anal swabs of patients a | AS1 | + | − | + | + | + | − | + |
| AS2 | + | − | + | + | + | − | + | |
| AS3 | + | − | + | + | + | − | + | |
| Foods from outbreaks a | FD1 | + | − | + | + | + | − | + |
| FD2 | + | − | + | + | + | − | + | |
| FD3 | + | − | + | + | + | − | + | |
| Waters from outbreaks a | WT1 | + | − | + | + | + | − | + |
| WT2 | + | − | + | + | + | − | + | |
| WT3 | + | − | + | + | + | − | + | |
| Waters from an epidemic spot in a 2013 outbreak | WA1 | + | + | − | + | + | + | − |
| WA2 | + | + | − | + | + | + | − | |
| WA5 | + | + | − | + | + | + | − | |
| WA6 | + | + | − | + | + | + | − | |
| Collected bacteria strains b | ||||||||
| V. cholerae O1,Ogawa serotype | ATCC14035 | + | + | − | + | + | + | − |
| V. cholerae O1,Ogawa serotype | 130605 | + | + | − | + | + | + | − |
| V. cholerae O1,Ogawa, ctx-negative | 200907 | − | + | − | + | − | + | − |
| V. cholerae O1,Inaba serotype | 200806 | + | + | − | + | + | + | - |
| V. cholerae O1,Inaba, ctx-negative | 190625 | − | + | − | + | − | + | − |
| V. cholerae O139(0511) | 180511 | + | − | + | + | + | − | + |
| V. cholerae O139(0618) | 180618 | + | − | + | + | + | − | + |
| V. cholerae O139, ctx-negative | 200513 | − | − | + | + | − | − | + |
| V. cholerae non-O1/non-O139,ctx-postive | 190524 | + | − | − | + | + | − | − |
| V. cholerae non-O1/non-O139 | 090717-203 | − | − | − | + | − | − | − |
| V. cholerae non-O1/non-O139 | 090717-207 | − | − | − | + | − | − | − |
| V. cholerae non-O1/non-O139 | 190626 | − | − | − | + | − | − | − |
| V. cholerae non-O1/non-O139 | 160517 | − | − | − | + | − | − | − |
| V. cholerae non-O1/non-O139 | 170626 | − | − | − | + | − | − | − |
| V. cholerae non-O1/non-O139 | 191016 | − | − | − | + | − | − | − |
| Vibrio mimicus | ATCC33653 | − | − | − | − | − | − | − |
| Vibrio parahaemolyticus | ATCC33847 | − | − | − | − | − | − | − |
| Aeromonas hydrophila | 8315 | − | − | − | − | − | − | − |
| Staphylococcus aureus | ATCC25923 | − | − | − | − | − | − | − |
| Escherichia coli | ATCC25922 | − | − | − | − | − | − | − |
| Salmonella anatum | ATCC50083 | − | − | − | − | − | − | − |
| Shigella flexneri | ATCC51573 | − | − | − | − | − | − | − |
| Positive Total | 22 | 9 | 15 | 31 | 22 | 9 | 15 | |
a From patients and environments in a diarrhea outbreak in 2018. b Strains collected between 2013 and 2020. c Symbols: +, positive; −, negative.
Table 2.
Consistency in the diagnostic performances of the two real-time assays.
| Target | Monoplex Assay | Multiplex Assay | Accordance Rate (%) | Kappa | χ2 | p | |||
|---|---|---|---|---|---|---|---|---|---|
| + | − | Sensitivity (%) | Specificity (%) | ||||||
| V. Choleraea | + | 124 | 0 | 100.00 | 17.29 | 47.63 | 0.133 | 175.006 | <0.001 |
| − | 177 | 37 | |||||||
| ctxA | + | 124 | 0 | 100.00 | 99.53 | 99.70 | 0.994 | 0.000 | 0.990 |
| − | 1 | 212 | |||||||
| rfb-O1 | + | 79 | 0 | 100.00 | 97.70 | 98.24 | 0.952 | 4.167 | <0.05 |
| − | 6 | 255 | |||||||
| rfb-O139 | + | 46 | 1 | 97.87 | 99.31 | 99.11 | 0.963 | 0.000 | 0.990 |
| − | 2 | 288 | |||||||
a Multiplex assay used the epsM gene as the species-specific target of V. cholerae. Monoplex assay used ctxA as the target previously.
Table 3.
Cost-effectiveness comparison of the previous monoplex assay and new multiplex assay.
| Assays | Time /Plate | Time (2 Plates) | Cost /Reaction a | Cost (2 Plates) a |
|---|---|---|---|---|
| Previous 3-panel monoplex assay | ||||
| DNA and RNA extraction | 30 min | 30 min | ¥30.0 | ¥5760.0 |
| First real-time PCR Panel 1(25 μL) for ctxA | 50 min | 50 min | ¥10.0 | ¥1920.0 |
| Vazyme qPCR reagents (UDG+) | ¥4.5 | |||
| Primers (forward and reverse, 1 target) | ¥0.5 | |||
| TaqMan fluorescent probe (1 target) | ¥5.0 | |||
| First real-time PCR Panel 2 (25 μL) for O1 target | 50 min | ¥10.0 | ¥1920.0 | |
| First real-time PCR Panel 3 (25 μL) for O139 target | 50 min | ¥10.0 | ¥1920.0 | |
| Second real-time PCR Panel 1–3 (25 μL) for 3 targets | 150 min | ¥30.0 | ¥5760.0 | |
| Total | 80 min | 330 min | ¥90.0 | ¥17,280.0 |
| New one-tube multiplex assay | ||||
| DNA and RNA extraction | 0 min | 0 min | ¥0.0 | ¥0.0 |
| Real-time RT-PCR (25 μL volume) | 40 min | 80 min | ¥30.0 | ¥5760.0 |
| Vazyme One Step qRT-PCR reagents (UDG+) | ¥8.0 | |||
| Primers (forward and reverse, 4 targets) | ¥2.0 | |||
| TaqMan fluorescent probe (4 targets) | ¥20.0 | |||
| Total | 40 min | 80 min | ¥30.0 | ¥5760.0 |
a Based on the purchase prices in China in 2021 and the condition in an ordinary lab with only one real-time PCR and a nucleic acid extraction instrument. These values do not include costs for common lab reagents, disposables, instruments, labor, and development.
Table 4.
Positive standards in this study.
| Positive Standards a | Sequence (5′-3′) | Reference Seq ID and Position(bp) b |
|---|---|---|
| epsM-PC | CGCAATTGGTCTCATGGATTGCGTATTTGCAAGAGCGCCAAGGGGTGAGCGTGGATGCGATTGATATTGACCGTGGTAAAGTGAACGGCGTTGTGGAAGTCAAACGTCTGCAACTGAAGC | DQ775328.1: 371–490 |
| ctxA-PC | AGTTCATTTTGGGGTGCTTGATGAACAATTACATCGTAATAGGGGCTACAGAGATAGATATTACAGTAACTTAGATATTGCTCCAGCAGCAGATGGTTATGGATTGGCAGGTTTCCCTCCGGAGCATAGAGCTTGGAGGGAAGAGCCGTG | AB699245.1: 441–590 |
| O1-PC | CGTTGGGAATAACTCAAGGCGATGAAGTGATTGTACCAACATTCACTTATGTTGCCTCGGTTAATACCATAGTCCAGTGTGGTGCGTTACCCGTTTTTGCTGAAATCGAAGGTGAGTCTCTACAAGTGAGCGTAGAGGAC | X59554.1: 5741–5880 |
| O139-PC | GATCGTGCTACGATGGCGTGTTCATTAGAAGGGCGGGTTCCCTTGTTAGACCACCGCATTGCTGAGTTTGCTGCCAGTTTGCCGATCCATTTGAAATACCGAGGTGGAAAGGGAAAGTGGCTTTTACGAGAAGTACTGTATCGTTATGTACCTAAAAAAT | AB012956.1: 34141–34300 |
a Each covers the amplified target regions of the two assays and serves as their common positive control. b Reference seq ID is the accession No. of the sequence in NCBI GenBank.
Table 5.
Primers and probes in this study.
| Target | Primer or Probe a | Sequence (5′-3′) | Reference Seq and Position(bp) b | Reaction Conc.(uM) |
|---|---|---|---|---|
| epsM | epsM-F | GGTCTCATGGATTGCGTATTTG | DQ775328.1:378–399 | 0.4 |
| epsM-R | GTTGCAGACGTTTGACTTCC | DQ775328.1:465–484(-) | 0.4 | |
| epsM-P c | ACGGTCAATATCAATCGCATCCACGCT | DQ775328.1:418–444(-) | 0.2 | |
| ctxA | ctxA-F | GGGTGCTTGATGAACAATTACA | AB699245.1:452–473 | 0.5 |
| ctxA-R | TTCCCTCCAAGCTCTATGC | AB699245.1:564–582(-) | 0.5 | |
| ctxA-P d | ACCTGCCAATCCATAACCATCTGCTGC | AB699245.1:526–552(-) | 0.25 | |
| m-ctxA-F | CTTCCCTCCAAGCTCTATGCTC | AB699245.1:562–583(-) | 0.2 | |
| m-ctxA-R | TACATCGTAATAGGGGCTACAGAG | AB699245.1:470–493 | 0.2 | |
| m-ctxA-P g | ACCTGCCAATCCATAACCATCTGCTGCTG | AB699245.1:524–552(-) | 0.2 | |
| rfb-O1 | O1-F | CAAGGCGATGAAGTGATTGTA | X59554.1:5755–5775 | 0.4 |
| O1-R | CGCTCACTTGTAGAGACTCA | X59554.1:5853–5872(-) | 0.4 | |
| O1-P e | ACGGGTAACGCACCACACTGGACTATG | X59554.1:5808–5834(-) | 0.2 | |
| m-O1-F | GGAATAACTCAAGGCGATGAAGTG | X59554.1:5746–5769 | 0.2 | |
| m-O1-R | TAGAGACTCACCTTCGATTTCAGC | X59554.1:5839–5862(-) | 0.2 | |
| m-O1-P g | AAACGGGTAACGCACCACACTGGACT | X59554.1:5811–5836(-) | 0.2 | |
| rfb-O139 | O139-F | GGTACATAACGATACAGTACTTCTC | AB012956.1:34268–34292(-) | 0.5 |
| O139-R | CGATGGCGTGTTCATTAGA | AB012956.1:34151–34169 | 0.5 | |
| O139-P f | CCTTGTTAGACCACCGCATTGCTGAGT | AB012956.1:34181–34207 | 0.25 | |
| m-O139-F | CGATGGCGTGTTCATTAGAAGG | AB012956.1:34151–34172 | 0.2 | |
| m-O139-R | TCCCTTTCCACCTCGGTATTTC | AB012956.1:34233–34252(-) | 0.2 | |
| m-O139-P g | CGGCAAACTGGCAGCAAACTCAGCA | AB012956.1:34200–34224(-) | 0.2 |
a -F, -R, and -P represents the forward primer, reverse primer, and TaqMan probe. Those with the m- prefix were only used for the monoplex real-time assay. b Reference seq ID is the accession No. of the sequence in NCBI GenBank. The sequences with minus marks are antisense. c,d,e,f Probes labeled, respectively, with FAM-DBQ1, HEX-DBQ1, ROX-DBQ2, and CY5-DBQ2 (5′-3′) for multiplex real-time assay. g Probes labeled with FAM-BHQ1 used for monoplex real-time assay.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Yan, Y.; Zhan, L.; Zhu, G.; Zhang, J.; Li, P.; Chen, L.; He, P.; Luo, J.; Chen, Z. Direct and Rapid Identification of Vibrio Cholerae Serogroup and Toxigenicity by a Novel Multiplex Real-Time Assay. Pathogens 2022, 11, 865. https://doi.org/10.3390/pathogens11080865
AMA Style
Yan Y, Zhan L, Zhu G, Zhang J, Li P, Chen L, He P, Luo J, Chen Z. Direct and Rapid Identification of Vibrio Cholerae Serogroup and Toxigenicity by a Novel Multiplex Real-Time Assay. Pathogens. 2022; 11(8):865. https://doi.org/10.3390/pathogens11080865
Chicago/Turabian StyleYan, Yong, Li Zhan, Guoying Zhu, Junyan Zhang, Ping Li, Lixia Chen, Peiyan He, Jianyong Luo, and Zhongwen Chen. 2022. "Direct and Rapid Identification of Vibrio Cholerae Serogroup and Toxigenicity by a Novel Multiplex Real-Time Assay" Pathogens 11, no. 8: 865. https://doi.org/10.3390/pathogens11080865
APA StyleYan, Y., Zhan, L., Zhu, G., Zhang, J., Li, P., Chen, L., He, P., Luo, J., & Chen, Z. (2022). Direct and Rapid Identification of Vibrio Cholerae Serogroup and Toxigenicity by a Novel Multiplex Real-Time Assay. Pathogens, 11(8), 865. https://doi.org/10.3390/pathogens11080865
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
