Pacific Gulls (Larus pacificus) as Potential Vectors of Coxiella burnetii in an Australian Fur Seal Breeding Colony
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. DNA Extraction
2.3. Quantitative Polymerase Chain Reaction
3. Results
4. Discussion and Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bond, K.A.; Franklin, L.; Sutton, B.; Stevenson, M.; Firestone, S. Review of 20 years of human acute Q fever notifications in Victoria, 1994–2013. Aust. Vet. J. 2018, 96, 223–230. [Google Scholar] [CrossRef]
- Eldin, C.; Mélenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.-L.; Maurin, M.; Raoult, D. From Q fever to Coxiella burnetii infection: A paradigm change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef] [PubMed]
- González-Barrio, D.; Ruiz-Fons, F. Coxiella burnetii in wild mammals: A systematic review. Transbound. Emerg. Dis. 2019, 66, 662–671. [Google Scholar] [CrossRef] [PubMed]
- Minor, C.; Kersh, G.J.; Gelatt, T.; Kondas, A.V.; Pabilonia, K.L.; Weller, C.B.; Dickerson, B.R.; Duncan, C.G. Coxiella burnetii in northern fur seals and steller sea lions of Alaska. J. Wildl. Dis. 2013, 49, 441–446. [Google Scholar] [CrossRef]
- Gardner, B.R.; Stenos, J.; Hufschmid, J.; Arnould, J.P.; McIntosh, R.R.; Tadepalli, M.; Tolpinrud, A.; Marenda, M.; Lynch, M.; Stent, A. An old pathogen in a new environment—Implications of Coxiella burnetii in Australian fur seals (Arctocephalus pusillus doriferos). Front. Mar. Sci. 2022, 9, 809075. [Google Scholar] [CrossRef]
- McIntosh, R.R.; Sorrell, K.J.; Thalmann, S.; Mitchell, A.; Gray, R.; Schinagl, H.; Arnould, J.P.; Dann, P.; Kirkwood, R. Sustained reduction in numbers of Australian fur seal pups: Implications for future population monitoring. PLoS ONE 2022, 17, e0265610. [Google Scholar] [CrossRef]
- Gardner, B.; Arnould, J.; Hufschmid, J.; McIntosh, R.; Fromant, A.; Tadepalli, M.; Stenos, J. Understanding the zoonotic pathogen, Coxiella burnetii in Australian fur seal breeding colonies through environmental DNA and genotyping. Wildl. Res. 2022. [Google Scholar] [CrossRef]
- Reed, K.D.; Meece, J.K.; Henkel, J.S.; Shukla, S.K. Birds, migration and emerging zoonoses: West Nile virus, Lyme disease, influenza A and enteropathogens. J. Clin. Med. Res 2003, 1, 5–12. [Google Scholar] [CrossRef]
- Benskin, C.M.H.; Wilson, K.; Jones, K.; Hartley, I.R. Bacterial pathogens in wild birds: A review of the frequency and effects of infection. Biol. Rev. 2009, 84, 349–373. [Google Scholar] [CrossRef]
- Ahlstrom, C.A.; van Toor, M.L.; Woksepp, H.; Chandler, J.C.; Reed, J.A.; Reeves, A.B.; Waldenström, J.; Franklin, A.B.; Douglas, D.C.; Bonnedahl, J. Evidence for continental-scale dispersal of antimicrobial resistant bacteria by landfill-foraging gulls. Sci. Total Environ. 2021, 764, 144551. [Google Scholar] [CrossRef] [PubMed]
- Laviad-Shitrit, S.; Izhaki, I.; Halpern, M. Accumulating evidence suggests that some waterbird species are potential vectors of Vibrio cholerae. PLoS Pathog. 2019, 15, e1007814. [Google Scholar] [CrossRef] [PubMed]
- Duncan, C.; Savage, K.; Williams, M.; Dickerson, B.; Kondas, A.V.; Fitzpatrick, K.A.; Guerrero, J.L.; Spraker, T.; Kersh, G.J. Multiple strains of Coxiella burnetii are present in the environment of St. Paul Island, Alaska. Transbound. Emerg. Dis. 2013, 60, 345–350. [Google Scholar] [CrossRef]
- Leitch, T.N.; Dann, P.; Arnould, J.P. The diet of Pacific gulls (Larus pacificus) breeding at Seal Island in northern Bass Strait. Aust. J. Zool. 2014, 62, 216–222. [Google Scholar] [CrossRef]
- Fitzsimons, J.A. Birds depredating stingrays and skates (Chondrichthyes: Batoidea): New observations and a review of records. Mar. Ornithol. 2021, 49, 223–227. [Google Scholar]
- Ebani, V.V.; Mancianti, F. Potential Role of Birds in the Epidemiology of Coxiella burnetii, Coxiella-like Agents and Hepatozoon spp. Pathogens 2022, 11, 298. [Google Scholar] [CrossRef] [PubMed]
- Geeson, J.J.; Hobday, A.J.; Speakman, C.N.; Arnould, J.P. Environmental influences on breeding biology and pup production in Australian fur seals. R. Soc. Open Sci. 2022, 9, 211399. [Google Scholar] [CrossRef]
- Gilg, O.; Strøm, H.; Aebischer, A.; Gavrilo, M.V.; Volkov, A.E.; Miljeteig, C.; Sabard, B. Post-breeding movements of northeast Atlantic ivory gull Pagophila eburnea populations. J. Avian Biol. 2010, 41, 532–542. [Google Scholar] [CrossRef]
- Schneeberger, P.M.; Hermans, M.H.; van Hannen, E.J.; Schellekens, J.J.; Leenders, A.C.; Wever, P.C. Real-time PCR with serum samples is indispensable for early diagnosis of acute Q fever. Clin. Vaccine Immunol. 2010, 17, 286–290. [Google Scholar] [CrossRef]
- Guatteo, R.; Seegers, H.; Taurel, A.-F.; Joly, A.; Beaudeau, F. Prevalence of Coxiella burnetii infection in domestic ruminants: A critical review. Vet. Microbiol. 2011, 149, 1–16. [Google Scholar] [CrossRef]
- Tokarevich, N.; Panferova, Y.A.; Freylikhman, O.; Blinova, O.; Medvedev, S.; Mironov, S.; Grigoryeva, L.; Tretyakov, K.; Dimova, T.; Zaharieva, M. Coxiella burnetii in ticks and wild birds. Ticks Tick Borne Dis. 2019, 10, 377–385. [Google Scholar] [CrossRef]
- Marmion, B.; Sukocheva, O.; Storm, P.; Lockhart, M.; Turra, M.; Kok, T.; Ayres, J.; Routledge, H.; Graves, S. Q fever: Persistence of antigenic non-viable cell residues of Coxiella burnetii in the host—Implications for post Q fever infection fatigue syndrome and other chronic sequelae. QJM Int. J. Med. 2009, 102, 673–684. [Google Scholar] [CrossRef] [PubMed]
- Stewart, L.G.; Lavers, J.L.; Grant, M.L.; Puskic, P.S.; Bond, A.L. Seasonal ingestion of anthropogenic debris in an urban population of gulls. Mar. Pollut. Bull. 2020, 160, 111549. [Google Scholar] [CrossRef] [PubMed]
Assay | Primer/Probe | Sequence(5’–3’) | Final Concentration (NM) | Amplicon Size (BP) |
---|---|---|---|---|
com1 | com1_F | AAAACCTCCGCGTTGTCTTCA | 400 | 76 |
com1_R | GCTAATGATACTTTGGCAGCGTATTG | 400 | ||
com1_P | FAM a-AGAACTGCCCATTTTTGGCGGCCA-BHQ1 b | 200 | ||
htpAB | htpAB_F | GTGGCTTCGCGTACATCAGA | 400 | 114 |
htpAB_R | CATGGGGTTCATTCCAGCA | 400 | ||
htpAB_P | FAM-AGCCAGTACGGTCGCTGTTGTGGT-BHQ1 | 200 | ||
IS1111 | IS1111NL_F | AAAACGGATAAAAAGAGTCTGTGGTT | 300 | 70 |
IS1111NL_R | CCACACAAGCGCGATTCAT | 300 | ||
IS1111NL_P | Quasar 670 c-AAAGCACTCATTGAGCGCCGCG-BHQ2 d | 150 |
n | Com1 | htpAB | IS1111 | Both Com1 and htpAB | |
---|---|---|---|---|---|
Kanowna Island | |||||
Oral swab | 17 | 16 (94.1%) | 15 (88.2%) | 0 (0%) | 15 (88.2%) |
Cloacal swab | 17 | 13 (76.5%) | 13 (76.5%) | 0 (0%) | 7 (41.2%) |
Serum | 17 | 3 (17.7%) | 3 (17.7%) | 0 (0%) | 2 (11.8%) |
Seal Island | |||||
Oral swab | 17 | 0 (0%) | 1 (5.9%) | 0 (0%) | 0 (0%) |
Cloacal swab | 17 | 3 (17.7%) | 2 (11.8%) | 0 (0%) | 2 (11.8%) |
Serum | 11 | 0 (0%) | 0 (0%) | 0 (0%) | 0 (0%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gardner, B.R.; Hufschmid, J.; Stenos, J.; Tadepalli, M.; Sutton, G.; Fromant, A.; Eizenberg, Y.; Geeson, J.J.; Arnould, J.P.Y. Pacific Gulls (Larus pacificus) as Potential Vectors of Coxiella burnetii in an Australian Fur Seal Breeding Colony. Pathogens 2023, 12, 122. https://doi.org/10.3390/pathogens12010122
Gardner BR, Hufschmid J, Stenos J, Tadepalli M, Sutton G, Fromant A, Eizenberg Y, Geeson JJ, Arnould JPY. Pacific Gulls (Larus pacificus) as Potential Vectors of Coxiella burnetii in an Australian Fur Seal Breeding Colony. Pathogens. 2023; 12(1):122. https://doi.org/10.3390/pathogens12010122
Chicago/Turabian StyleGardner, Brett R., Jasmin Hufschmid, John Stenos, Mythili Tadepalli, Grace Sutton, Aymeric Fromant, Yonina Eizenberg, Johanna J. Geeson, and John P. Y. Arnould. 2023. "Pacific Gulls (Larus pacificus) as Potential Vectors of Coxiella burnetii in an Australian Fur Seal Breeding Colony" Pathogens 12, no. 1: 122. https://doi.org/10.3390/pathogens12010122
APA StyleGardner, B. R., Hufschmid, J., Stenos, J., Tadepalli, M., Sutton, G., Fromant, A., Eizenberg, Y., Geeson, J. J., & Arnould, J. P. Y. (2023). Pacific Gulls (Larus pacificus) as Potential Vectors of Coxiella burnetii in an Australian Fur Seal Breeding Colony. Pathogens, 12(1), 122. https://doi.org/10.3390/pathogens12010122