Detection of Virulence-Associated Genes among Brucella melitensis and Brucella abortus Clinical Isolates in Greece, 2001–2022
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates
2.2. Identification
2.3. Molecular Detection of Virulence Genes
2.4. Reference Strains
2.5. Statistical Evaluation
3. Results and Discussion
4. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Karagiannis, I.; Mellou, K.; Gkolfinopoulou, K.; Dougas, G.; Theocharopoulos, G.; Vourvidis, D.; Ellinas, D.; Sotolidou, M.; Papadimitriou, T.; Vorou, R. Outbreak investigation of brucellosis in Thassos, Greece, 2008. Euro Surveill. 2012, 17, 20116. [Google Scholar] [CrossRef] [PubMed]
- Pappas, G.; Papadimitriou, P.; Akritidis, N.; Christou, L.; Tsianos, E.V. The new global map of human brucellosis. Lancet Infect. Dis. 2006, 6, 91–99. [Google Scholar] [CrossRef] [PubMed]
- Mirnejad, R.; Jazi, F.M.; Mostafaei, S.; Sedighi, M. Molecular investigation of virulence factors of Brucella melitensis and Brucella abortus strains isolated from clinical and non-clinical samples. Microb. Pathog. 2017, 109, 8–14. [Google Scholar] [CrossRef] [PubMed]
- Arellano-Reynoso, B.; Lapaque, N.; Salcedo, S.; Briones, G.; Ciocchini, A.E.; Ugalde, R.; Moreno, E.; Moriyón, I.; Gorvel, J.P. Cyclic β-1,2-glucan is a Brucella virulence factor required for intracellular survival. Nat. Immunol. 2005, 6, 618–625. [Google Scholar] [CrossRef] [PubMed]
- Głowacka, P.; Żakowska, D.; Naylor, K.; Niemcewicz, M.; Bielawska-Drózd, A. Brucella virulence factors, pathogenesis and treatment. Pol. J. Microbiol. 2018, 67, 151–161. [Google Scholar] [CrossRef] [PubMed]
- Sangari, F.J.; Seoane, A.; Rodrıguez, M.C.; Aguero, J.; Garcıa Lobo, J.M. Characterization of the urease operon of Brucella abortus and assessment of its role in virulence of the bacterium. Infect. Immun. 2007, 75, 774–780. [Google Scholar] [CrossRef] [PubMed]
- Baily, G.G.; Krahn, J.B.; Drasar, B.S.; Stoker, N.G. Detection of B. melitensis and B. abortus by DNA amplification. J. Trop. Med. Hyg. 1992, 95, 271–275. [Google Scholar] [PubMed]
- García-Yoldi, D.; Marín, C.M.; de Miguel, M.J.; Muñoz, P.M.; Vizmanos, J.L.; López-Goñi, I. Multiplex PCR assay for the identification and differentiation of all Brucella species and the vaccine strains B. abortus S19 and R-B51 and B. melitensis REV-1. Clin. Chem. 2006, 52, 779–781. [Google Scholar] [CrossRef] [PubMed][Green Version]
- López-Goñi, I.; García-Yoldi, D.; Marín, C.M.; de Miguel, M.J.; Muñoz, P.M.; Blasco, J.M.; Jacques, I.; Grayon, M.; Cloeckaert, A.; Ferreira, A.C.; et al. Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. J. Clin. Microbiol. 2008, 46, 3484–3487. [Google Scholar] [CrossRef] [PubMed]
- Rahdar, H.A.; Golmohammadi, R.; Mirnejad, R.; Ataee, R.A.; Alishiri, G.H.; Kazemian, H. Diversity of virulence genes in Brucella melitensis and Brucella abortus detected from patients with rheumatoid arthritis. Microb. Pathog. 2018, 118, 247–250. [Google Scholar] [CrossRef] [PubMed]
- Hamdy, M.E.R.; Zaki, H.M. Detection of virulence-associated genes in Brucella melitensis biovar 3, the prevalent field strain in different animal species in Egypt. Open Vet. J. 2018, 8, 112–117. [Google Scholar] [CrossRef] [PubMed]
- Muñoz, P.M.; Mick, V.; Sacchini, L.; Janowicz, A.; de Miguel, M.J.; Cherfa, M.A.; Nevado, C.R.; Girault, G.; Andrés-Barranco, S.; Jay, M.; et al. Phylogeography and epidemiology of Brucella suis biovar 2 in wildlife and domestic swine. Vet. Microbiol. 2019, 233, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Taleski, V.; Zerva, L.; Kantardjiev, T.; Cvetnic, Z.; Erski-Biljic, M.; Nikolovski, B.; Bosnjakovski, J.; Katalinic-Jankovic, V.; Panteliadou, A.; Stojkoski, S.; et al. An overview of the epidemiology and epizootology of brucellosis in selected countries of Central and Southeast Europe. Vet. Microbiol. 2002, 90, 147–155. [Google Scholar] [CrossRef] [PubMed]
- Moreno, E.; Middlebrook, E.A.; Altamirano-Silva, P.; Al Dahouk, S.; Araj, G.F.; Arce-Gorvel, V.; Arenas-Gamboa, A.; Ariza, J.; Barquero-Calvo, E.; Battelli, G.; et al. If you’re not confused, you’re not paying attention: Ochrobactrum is not Brucella. J. Clin. Microbiol. 2023, 61, e0043823. [Google Scholar] [CrossRef] [PubMed]
- Dadar, M.; Alamian, S.; Brangsch, H.; Elbadawy, M.; Elkharsawi, A.R.; Neubauer, H.; Wareth, G. Determination of virulence-associated genes and antimicrobial resistance profiles in Brucella isolates recovered from humans and animals in Iran using NGS technology. Pathogens 2023, 12, 82. [Google Scholar] [CrossRef] [PubMed]
- Wareth, G.; El-Diasty, M.; Abdel-Hamid, N.H.; Holzer, K.; Hamdy, M.E.R.; Moustafa, S.; Shahein, M.A.; Melzer, F.; Beyer, W.; Pletz, M.W.; et al. Molecular characterization and antimicrobial susceptibility testing of clinical and non-clinical Brucella melitensis and Brucella abortus isolates from Egypt. One Health 2021, 13, 100255. [Google Scholar] [CrossRef] [PubMed]
- Brangsch, H.; Sandalakis, V.; Babetsa, M.; Boukouvala, E.; Ntoula, A.; Makridaki, E.; Christidou, A.; Psaroulaki, A.; Akar, K.; Gürbilek, S.E.; et al. Genotype diversity of brucellosis agents isolated from humans and animals in Greece based on whole-genome sequencing. BMC Infect. Dis. 2023, 23, 529. [Google Scholar] [CrossRef] [PubMed]
- Bandara, A.B.; Boyle, S.B.; Contreras-Rodriguez, A.; Martins, A.M.; Prasad, R.; Reilly, C.M. Brucella melitensis differs from B. suis in growth and urease activity in-vitro, and infectivity in Fisher-344 rats in-vivo. Adv. Infect. Dis. 2013, 3, 60–62. [Google Scholar] [CrossRef]
| Gene | Sequence | Amplicon (bp) | Reference |
|---|---|---|---|
| omp19 | F: 5′-TGATGGGAATTTCAAAAGCA-3 R: 5′-GTTTCCGGGTCAGATCAGC-3′ | 550 | [3] |
| wbkA | F: 5′-AATGACTTCCGCTGCCATAG-3′ R: 5′-ATGAGCGAGGACATGAGCTT-3′ | 931 | [3] |
| manA | F: 5′-TCGATCCAGAAACCCAGTTC-3′ R: 5′-CATACACCACGATCCACTGC-3′ | 271 | [10] |
| mviN | F: 5′-GCAGATCAACCTGCTCATCA-3′ R: 5′-GGCCATAGATCGCCAGAATA-3′ | 344 | [3] |
| ure | F: 5′-GCTTGCCCTTGAATTCCTTTGTGG-3′ R: 5′-ATCTGCGAATTTGCCGGACTCTAT-3′ | 2100 | [11] |
| perA | F: 5′-GGAACGGTGGCACTACATCT-3′ R: 5′-GGCTCTCTGTGTTCCGAGTT-3′ | 716 | [3] |
| cbg | F: 5′- GAATTCGCCAATGAGGAAAA-3′ R: 5′- ACGATATCGGATGCGAAAAG-3′ | 575 | [10] |
| virB | F: 5′- CGCTGATCTATAATTAAGGCTA -3′ R: 5′- TGCGACTGCCTCCTATCGTC-3′ | 881 | [10] |
| B. melitensis (No) | omp19 | wbkA | manA | mviN | ure | perA | cbg | virB |
|---|---|---|---|---|---|---|---|---|
| 305 | + | + | + | + | + | + | + | + |
| 7 | + | + | + | + | Negative | + | + | + |
| 2 | + | Negative | + | + | Negative | + | + | + |
| 1 | + | + | + | + | + | + | Negative | Negative |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Papaparaskevas, J.; Procopiou, A.; Routsias, J.; Vrioni, G.; Tsakris, A. Detection of Virulence-Associated Genes among Brucella melitensis and Brucella abortus Clinical Isolates in Greece, 2001–2022. Pathogens 2023, 12, 1274. https://doi.org/10.3390/pathogens12111274
Papaparaskevas J, Procopiou A, Routsias J, Vrioni G, Tsakris A. Detection of Virulence-Associated Genes among Brucella melitensis and Brucella abortus Clinical Isolates in Greece, 2001–2022. Pathogens. 2023; 12(11):1274. https://doi.org/10.3390/pathogens12111274
Chicago/Turabian StylePapaparaskevas, Joseph, Alexandra Procopiou, John Routsias, Georgia Vrioni, and Athanasios Tsakris. 2023. "Detection of Virulence-Associated Genes among Brucella melitensis and Brucella abortus Clinical Isolates in Greece, 2001–2022" Pathogens 12, no. 11: 1274. https://doi.org/10.3390/pathogens12111274
APA StylePapaparaskevas, J., Procopiou, A., Routsias, J., Vrioni, G., & Tsakris, A. (2023). Detection of Virulence-Associated Genes among Brucella melitensis and Brucella abortus Clinical Isolates in Greece, 2001–2022. Pathogens, 12(11), 1274. https://doi.org/10.3390/pathogens12111274

