Identification of a Novel Polerovirus in Cocoa (Theobroma cacao) Germplasm and Development of Molecular Methods for Use in Diagnostics
Abstract
:1. Introduction
2. Materials and Methods
2.1. Analysis of Transcriptome Datasets
2.2. Sequence Analysis and Phylogeny
2.3. RNA Extraction and cDNA Synthesis
2.4. Primer Design and RT-PCR Amplification
3. Results
3.1. Detection of Polerovirus Sequences in Transcriptome Datasets
3.2. Discovery of Novel Cacao Polerovirus Genome
3.2.1. Genome Organization of CaPV
3.2.2. Similarity Analyses of CaPV and Selected Solemovirids
3.2.3. Phylogenetic Analysis
3.3. Confirmation of NGS-Assembled Genome
3.4. Screening of Germplasms
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Statista. Revenue of the Confectionery Market Worldwide from 2016 to 2027, by Segment. Available online: https://www.statista.com/forecasts/1309970/worldwide-confectionery-market-size-by-category (accessed on 20 September 2023).
- Muller, E.; Ravel, S.; Agret, C.; Abrokwah, F.; Dzahini-Obiatey, H.; Galyuon, I.; Kouakou, K.; Jeyaseelan, E.C.; Allainguillaume, J.; Wetten, A. Next Generation Sequencing Elucidates Cacao Badnavirus Diversity and Reveals the Existence of More than Ten Viral Species. Virus Res. 2018, 244, 235–251. [Google Scholar] [CrossRef]
- ICCO. Quarterly Bulletin of Cocoa Statistics, Vol. XLIX, No.2, Cocoa Year 2022/23. Available online: https://www.icco.org/wp-content/uploads/Production_QBCS-XLIX-No.-2.pdf (accessed on 20 September 2023).
- Chingandu, N.; Zia-Ur-Rehman, M.; Sreenivasan, T.N.; Surujdeo-Maharaj, S.; Umaharan, P.; Gutierrez, O.A.; Brown, J.K. Molecular Characterization of Previously Elusive Badnaviruses Associated with Symptomatic Cacao in the New World. Arch. Virol. 2017, 162, 1363–1371. [Google Scholar] [CrossRef] [PubMed]
- Puig, A.S.; Ramos-Sobrinho, R.; Keith, C.; Kitchen, N.; Gutierrez, O.A.; Goenaga, R.J. First Report of Cacao Mild Mosaic Virus (CaMMV) Associated with Symptomatic Commercial Cacao (Theobroma cacao L.) trees in Puerto Rico. Plant Dis. 2020, 104, 3089. [Google Scholar] [CrossRef]
- Puig, A.S. Detection of Cacao Mild Mosaic Virus (CaMMV) Using Nested PCR and Evidence of Uneven Distribution in Leaf Tissue. Agronomy 2021, 11, 1842. [Google Scholar] [CrossRef]
- Ullah, I.; Daymond, A.J.; Hadley, P.; End, M.J.; Umaharan, P.; Dunwell, J.M. Identification of Cacao Mild Mosaic Virus (CaMMV) and Cacao Yellow Vein-Banding Virus (CYVBV) in Cocoa (Theobroma cacao) Germplasm. Viruses 2021, 13, 2152. [Google Scholar] [CrossRef] [PubMed]
- Kandito, A.; Hartono, S.; Trisyono, Y.A.; Somowiyarjo, S. First Report of Cacao Mild Mosaic Virus Associated with Cacao Mosaic Disease in Indonesia. New Dis. Rep. 2022, 45, e12071. [Google Scholar] [CrossRef]
- Muller, E.; Ullah, I.; Dunwell, J.M.; Daymond, A.J.; Richardson, M.; Allainguillaume, J.; Wetten, A. Identification and Distribution of Novel Badnaviral Sequences Integrated in the Genome of Cacao (Theobroma cacao). Sci. Rep. 2021, 11, 8270. [Google Scholar] [CrossRef]
- Ullah, I.; Dunwell, J.M. Bioinformatic, Genetic and Molecular Analysis of Several Badnavirus Sequences Integrated in the Genomes of Diverse Cocoa (Theobroma cacao L.) Germplasm. Saudi J. Biol. Sci. 2023, 30, 103648. [Google Scholar] [CrossRef]
- Edula, S.R.; Bag, S.; Milner, H.; Kumar, M.; Suassuna, N.D.; Chee, P.W.; Kemerait, R.C.; Hand, L.C.; Snider, J.L.; Srinivasan, R.; et al. Cotton Leafroll Dwarf Disease: An Enigmatic Viral Disease in Cotton. Mol. Plant Pathol. 2023, 24, 513–526. [Google Scholar] [CrossRef]
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Adriaenssens, E.M.; Alfenas-Zerbini, P.; Davison, A.J.; Dempsey, D.M.; Dutilh, B.E.; García, M.L.; et al. Changes to Virus Taxonomy and to the International Code of Virus Classification and Nomenclature Ratified by the International Committee on Taxonomy of Viruses (2021). Arch. Virol. 2021, 166, 2633–2648. [Google Scholar] [CrossRef]
- Osman, T.A.; Coutts, R.H.; Buck, K.W. In Vitro Synthesis of Minus-Strand RNA by an Isolated Cereal Yellow Dwarf Virus RNA-Dependent RNA Polymerase Requires VPg and a Stem-Loop Structure at the 3’ End of the Virus RNA. J. Virol. 2006, 80, 10743–10751. [Google Scholar] [CrossRef] [PubMed]
- Delfosse, V.C.; Barrios-Barón, M.P.; Distéfano, A.J. What we Know about Poleroviruses: Advances in Understanding the Functions of Polerovirus Proteins. Plant Pathol. 2021, 70, 1047–1061. [Google Scholar] [CrossRef]
- Silva, J.M.F.; Al Rwahnih, M.; Blawid, R.; Nagata, T.; Fajardo, T.V.M. Discovery and Molecular Characterization of a Novel Enamovirus, Grapevine Enamovirus-1. Virus Genes 2017, 53, 667–671. [Google Scholar] [CrossRef] [PubMed]
- Adegbola, R.O.; Keith, C.V.; Gutierrez, O.A.; Goenaga, R.J.; Brown, J.K. A Previously Undescribed Polerovirus (Solemoviridae) Infecting Theobroma cacao Germplasm. Plant Dis. 2023, 107, 975. [Google Scholar] [CrossRef]
- Ramos-Sobrinho, R.; Ferro, M.M.M.; Lima, G.S.A.; Nagata, T. First Report of Cotton Leafroll Dwarf Virus Infecting Cacao (Theobroma cacao L.) Trees in Brazil. Plant Dis. 2022, 107, 1251. [Google Scholar] [CrossRef]
- Csorba, T.; Kontra, L.; Burgyán, J. Viral Silencing Suppressors: Tools Forged to Fine-Tune Host-Pathogen Coexistence. Virology 2015, 479–480, 85–103. [Google Scholar] [CrossRef]
- Sivakumaran, K.; Fowler, B.C.; Hacker, D.L. Identification of Viral Genes Required for Cell-to-Cell Movement of Southern Bean Mosaic Virus. Virology 1998, 252, 376–386. [Google Scholar] [CrossRef]
- Prüfer, D.; Tacke, E.; Schmitz, J.; Kull, B.; Kaufmann, A.; Rohde, W. Ribosomal Frameshifting in Plants: A Novel Signal Directs the −1 Frameshift in the Synthesis of the Putative Viral Replicase of Potato Leafroll Luteovirus. EMBO J. 1992, 11, 11–17. [Google Scholar] [CrossRef]
- Brierley, I.; Gilbert, R.J.C.; Pennell, S. Pseudoknot-Dependent Programmed -1 Ribosomal Frameshifting: Structures, Mechanisms and Models. In Recoding: Expansion of Decoding Rules Enriches Gene Expression; Atkins, J., Gesteland, R., Eds.; Springer: New York, NY, USA, 2010; Volume 24, pp. 149–174. [Google Scholar] [CrossRef]
- Veidt, I.; Lot, H.; Leiser, M.; Scheidecker, D.; Guilley, H.; Richards, K.; Jonard, G. Nucleotide Sequence of Beet Western Yellows Virus RNA. Nucleic Acids Res. 1988, 16, 9917–9932. [Google Scholar] [CrossRef]
- Smirnova, E.; Firth, A.E.; Miller, W.A.; Scheidecker, D.; Brault, V.; Reinbold, C.; Rakotondrafara, A.M.; Chung, B.Y.W.; Ziegler-Graff, V. Discovery of a Small non-AUG-initiated ORF in Poleroviruses and Luteoviruses that is Required for Long-distance Movement. PLoS Pathog. 2015, 11, e1004868. [Google Scholar] [CrossRef]
- Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A Virus Classification Tool Based on Pairwise Sequence Alignment and Identity Calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef] [PubMed]
- Stamatakis, A. RAxML Version 8: A Tool for Phylogenetic Analysis and Post-Analysis of Large Phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Ullah, I.; Wang, Y.; Eide, D.J.; Dunwell, J.M. Evolution, and Functional Analysis of Natural Resistance-Associated Macrophage Proteins (NRAMPs) from Theobroma cacao and their Role in Cadmium Accumulation. Sci. Rep. 2018, 8, 14412. [Google Scholar] [CrossRef] [PubMed]
- Hämälä, T.; Guiltinan, M.J.; Marden, J.H.; Maximova, S.N.; Depamphilis, C.W.; Tiffin, P. Gene Expression Modularity Reveals Footprints of Polygenic Adaptation in Theobroma cacao. Mol. Biol. Evol. 2020, 37, 110–123. [Google Scholar] [CrossRef]
- Ullah, I.; (University of Reading, Reading, UK); Guiltinan, M.; (The Pennsylvania State University, Pennsylvania, PA, USA). Personal communication, 1 September 2023.
- aus dem Siepen, M.; Pohl, J.O.; Koo, B.J.; Wege, C.; Jeske, H. Poinsettia Latent Virus is not a Cryptic Virus, but a Natural Polerovirus–Sobemovirus Hybrid. Virology 2005, 336, 240–250. [Google Scholar] [CrossRef]
- Sõmera, M.; Fargette, D.; Hébrard, E.; Sarmiento, C. ICTV Report Consortium, 2021. ICTV Virus Taxonomy Profile: Solemoviridae 2021. J. Gen. Virol. 2021, 102, 001707. [Google Scholar] [CrossRef]
- Muller, A. Deficiency Symptoms in Cacao Seedlings Observed in Pot Experiments with the Bouma-Janssen Method. Neth. J. Agri. Sci. 1979, 27, 211–220. [Google Scholar] [CrossRef]
- Sedhain, N.P.; Bag, S.; Morgan, K.; Carter, R.; Triana, P.; Whitaker, J.; Kemerait, R.C.; Roberts, P.M. Natural Host Range, Incidence on Overwintering Cotton and Diversity of Cotton Leafroll Dwarf Virus in Georgia USA. Crop Prot. 2021, 144, 105604. [Google Scholar] [CrossRef]
- Hoffmann, K.; Verbeek, M.; Romano, A.; Dullemans, A.M.; Van den Heuvel, J.F.J.M.; Van der Wilk, F. Mechanical Transmission of Poleroviruses. J. Virol. Methods 2001, 91, 197–201. [Google Scholar] [CrossRef]
- Kavi Sidharthan, V.; Nagendran, K.; Baranwal, V.K. Exploration of Plant Transcriptomes Reveals Five Putative Novel Poleroviruses and an Enamovirus. Virus Genes 2022, 58, 244–253. [Google Scholar] [CrossRef] [PubMed]
Specificity | Primer Location | Primer Name | Primer Sequence | Coordinates (nt) | Amplicon Size (bp) |
---|---|---|---|---|---|
Cacao polerovirus | 5′ UTR | CLN_F | CGACCGTATCATTGCTTGTG | 33–52 | 5794 |
3′ UTR | CLN_R | CCATGCCTGTGGGTTTTAAG | 5807–5826 | ||
RdRP (ORF2) | P2_F | GTACCCTCCTAGCCCAGACC | 3106–3125 | 150 | |
P2_R | CTGGGGATTCTAAGGCATCA | 3236–3255 | |||
MP (ORF4) | P4_F | AGGGAGCAACAGCTTCACA | 3954–3972 | 201 | |
P4_R | GAGATGGAGCCTGATGTCGT | 4135–4154 | |||
P5 (ORF5) | P5_F | CAAGGAGTGCTGGTCGTACA | 4990–5009 | 212 | |
P5_R | GGGGTTTGATTTACCGGTTT | 5182–5203 | |||
Theobroma cacao | ACP1_Exon2 | ACP_F | GAAGCAGCCTCTCATTTAATTTG | 1148–1170 | * 90 |
ACP1_Exon3 | ACP_R | CACATACCTTATCCACAGTCTCT | 1754–1776 | ** 629 |
Run | Station/GPS Coordinates | Accession | Genetic Group | Size (Mb) | Reads Mapped | Coverage (X) |
---|---|---|---|---|---|---|
SRR9938230 | CATIE/9.87675, −83.65673333 | IMC 60 | Iquitos | 1008 | 153 | 14.1 |
SRR23566402 | Experimental Greenhouse J, PSU | IMC60_S62 | 544 | 93 | 13.8 | |
SRR9938245 | CATIE/9.876666667, −83.65666667 | PA 16 | Maranon | 845 | 135 | 12.0 |
SRR23566388 | Experimental Greenhouse J, PSU | PA16_S70 | 456 | 75 | 13.9 | |
SRR9938323 | CATIE/9.876466667, −83.65663333 | NA 34 | Iquitos | 1010 | 64 | 5.7 |
SRR23566397 | Experimental Greenhouse J, PSU | NA34_S80 | 548 | 39 | 6.4 | |
SRR9938250 | CATIE/9.87575, −83.65738333 | GU 123/V | Guiana | 1168 | 54 | 5.0 |
SRR23566375 | Experimental Greenhouse J, PSU | GU123V_S57 | 634 | 39 | 5.1 | |
SRR9938307 | CATIE/9.8771, −83.65805 | NA 70 | Nanay | 990 | 51 | 4.6 |
SRR23566396 | Experimental Greenhouse J, PSU | NA70_S81 | 538 | 37 | 5.7 | |
SRR9938308 | CATIE/9.877016667, −83.6576 | NA 33 | Nanay | 2443 | 51 | 4.4 |
SRR23566398 | Experimental Greenhouse J, PSU | NA33_S79 | 1290 | 21 | 4.2 | |
SRR9938223 | CATIE/9.8757, −83.65738333 | GU 257/E | Guiana | 1068 | 41 | 3.6 |
SRR23566373 | Experimental Greenhouse J, PSU | GU257E_S52 | 576 | 31 | 4.5 | |
SRR9938227 | CATIE/9.875166667, −83.65623333 | SPEC 54/1 | Iquitos | 1099 | 32 | 2.9 |
SRR23566379 | Experimental Greenhouse J, PSU | SPEC54/1_S63 | 596 | 28 | 3.2 | |
SRR9938231 | CATIE/9.876783333, −83.65706667 | AMAZ 12 | Iquitos | 1139 | 30 | 2.8 |
SRR23566405 | Experimental Greenhouse J, PSU | AMAZ12_S64 | 613 | 9 | 1.2 | |
SRR9938234 | CATIE/9.8769, −83.65676667 | IMC 57 | Iquitos | 1016 | 28 | 2.5 |
SRR23566403 | Experimental Greenhouse J, PSU | IMC57_S67 | 522 | 7 | 0.8 | |
SRR9938218 | CATIE/9.87695, −83.65716667 | NA 916 | Nanay | 955 | 26 | 2.4 |
SRR23566391 | Experimental Greenhouse J, PSU | NA916_S77 | 518 | 20 | 2.4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ullah, I.; Kamran, M.; Dunwell, J.M. Identification of a Novel Polerovirus in Cocoa (Theobroma cacao) Germplasm and Development of Molecular Methods for Use in Diagnostics. Pathogens 2023, 12, 1284. https://doi.org/10.3390/pathogens12111284
Ullah I, Kamran M, Dunwell JM. Identification of a Novel Polerovirus in Cocoa (Theobroma cacao) Germplasm and Development of Molecular Methods for Use in Diagnostics. Pathogens. 2023; 12(11):1284. https://doi.org/10.3390/pathogens12111284
Chicago/Turabian StyleUllah, Ihsan, Muhammad Kamran, and Jim M. Dunwell. 2023. "Identification of a Novel Polerovirus in Cocoa (Theobroma cacao) Germplasm and Development of Molecular Methods for Use in Diagnostics" Pathogens 12, no. 11: 1284. https://doi.org/10.3390/pathogens12111284