Next Article in Journal
No Changes in the Occurrence of Methicillin-Resistant Staphylococcus aureus (MRSA) in South-East Austria during the COVID-19 Pandemic
Next Article in Special Issue
Searching for the Virulence-contributing Genes of the Magnaporthe oryzae by Transcriptome Analysis
Previous Article in Journal
Association of Ambient Temperature and Absolute Humidity with the Effective Reproduction Number of COVID-19 in Japan
Previous Article in Special Issue
The Green Synthesis of Silver Nanoparticles from Avena fatua Extract: Antifungal Activity against Fusarium oxysporum f.sp. lycopersici
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 11
10.3390/pathogens12111306
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Expression of Genes Involved in Anthracnose Resistance in Chili (Capsicum baccatum) ‘PBC80’-Derived Recombinant Inbred Lines

by
Wassana Kethom
1,
Paul W. J. Taylor
2 and
Orarat Mongkolporn
1,*
1
Department of Horticulture, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Kamphaeng Saen Campus, Nakhon Pathom 73140, Thailand
2
Faculty of Science, The University of Melbourne, Parkville, VIC 3010, Australia
*
Author to whom correspondence should be addressed.
Pathogens 2023, 12(11), 1306; https://doi.org/10.3390/pathogens12111306
Submission received: 27 August 2023 / Revised: 28 October 2023 / Accepted: 30 October 2023 / Published: 1 November 2023
(This article belongs to the Special Issue Fungal Pathogens of Crops)
Browse Figures
Versions Notes

Abstract

:
Chili anthracnose has long been a threat to chili production worldwide. Capsicum baccatum ‘PBC80’ has been identified as a source of resistance to anthracnose. Recently, a QTL for ripe fruit resistance from ‘PBC80’-derived RILs was located on chromosome 4 (123 Mb) and contained over 80 defense-related genes. To identify the genes most related to anthracnose resistance, a fine map of the QTL region was developed using single-marker analysis. Nine genes were selected from the new QTL (1.12 Mb) to study their expression after being challenged with Colletotrichum scovillei ‘MJ5’ in two different RIL genotypes (Resistance/Resistance or R/R and Susceptible/Susceptible or S/S) at 0, 6 and 12 h. Of the nine genes, LYM2, CQW23_09597, CLF, NFXL1, and PR-14 were significantly up-regulated, compared to the control, in the R/R genotype. ERF was up-regulated in both chili genotypes. However, the expression was relatively and constantly low in the S/S genotype. Most up-regulated genes reached the highest peak (2.3–4.5 fold) at 6 h, except for ERF, which had the highest peak at 12 h (6.4 fold). The earliest and highest expressed gene was a pathogen receptor, LYM2.

1. Introduction

Chili (Capsicum spp.) is an economically important global crop as a key vegetable and spice [1]. A complex of Colletotrichum species causes chili anthracnose. In Thailand, the most important species are Co. scovillei, Co. truncatum, and Co. siamense [2], with Co. scovillei being the most aggressive species [3]. Among the cultivated Capsicum species, C. annuum lacks resistance to anthracnose, while C. baccatum has resistance to the pathogen, especially Co. scovillei. Capsicum baccatum ‘PBC80’ accession has been used widely in Asia and Thailand as the resistant source in several chili-breeding programs [1].
Disease resistance in crop plants is generally controlled by a few genes that have large effects on the phenotype; however, quantitative variations are also observed [4,5]. Genetic studies for anthracnose resistance in chili with the hypersensitive reaction (HR) have mostly shown single genes controlling the resistance [6,7,8,9], but some variations were detected in the susceptible phenotypes. Such variations suggested that the resistance to anthracnose in chili was a quantitative trait. The resistance trait’s quantitative trait locus (QTL) refers to the trait’s genomic region, which is identified by a statistical QTL analysis aiming to link phenotype and genotype and explain the genetic basis of variation in the traits [4,5,10].
Mapping and QTL analyses of the resistance genes to anthracnose derived from the ‘PBC80’ have been achieved [9,11]. The most recent map developed by Kethom and Mongkolporn [11] was derived from the recombinant inbred lines (RILs) developed from an intraspecific C. baccatum cross ‘PBC80’ × ‘CA1316’. The resistance to anthracnose on ripe fruit was located on chromosome 4 within the QTL RA80f6_r1. The QTL RA80f6_r1 region is physically 123 Mb (22,920,913–146,776,687 bp), housing approximately 85 defense-related genes.
Pathogenesis-related proteins are expressed by the host at various time points during infection and are correlated with differential pathogenesis-related genes expressed by the pathogen. The crucial interactions between the fungal pathogen and the host plant occur as early as at the penetration stage of the cuticle and through to the infection/colonization stage. The resistance mechanism in host, C. baccatum ‘PBC80’, has been well defined as a hypersensitive reaction (HR) [8]. HR is often a consequence of the plant host recognition of the invasive pathogen, which results in rapid cell death around the infection site [12]. Pathogen recognition by cell-surface pattern recognition receptors (PRRs) is the earliest response event of a plant host that initially induces defense mechanisms to inhibit the pathogen invasion. Studies in rice [13] and coffee [14] revealed that plants could promptly recognize fungal infection and activate defense activities through the early expressions of the PRRs before a full development of fungal appressorium around 5–6 h after inoculation. In chili anthracnose, the causal pathogen Colletotrichum was demonstrated to produce appressoria as early as 6 h after inoculation [15]. Since the recognition receptors appeared to be the key genes to activate the HR response, the early response genes were consequently the targets of this study. The study was then planned to collect mRNA at an early stage of the infection within the first 24 h after inoculation.
This study aimed to identify genes involved in the QTL RA80f6_r1 for resistance to anthracnose from ‘PBC80’ through their mRNA expression post-inoculation. The QTL RA80f6_r1 was physically large and contained over 80 defense-related genes in the region. Therefore, this study tried to narrow the QTL region by incorporating more markers into the QTL area to achieve a fine map. As a result, the new QTL was physically smaller to accommodate searching targeted defense-related genes, which then had their expressions post-fruit inoculation investigated.

2. Materials and Methods

A graphical figure to explain the overall study methodology is exhibited in Figure 1.

2.1. Fine Mapping in the QTL Region and Selection of Defense-Related Genes

The QTL RA80f6_r1 previously identified by Kethom and Mongkolporn [11] was derived from homozygous recombinant inbred lines developed from a cross between C. baccatum ‘PBC80’ and ‘CA1316’. The QTL was located on chromosome 4 and contained eight molecular markers with a total physical distance of 123 Mb. A fine map of the QTL was attempted by adding more markers into the region. These additional markers were recruited from silico (insertion-deletion mutants) and SNPs (single nucleotide polymorphisms) within the DArTseq [16] genome database of the RIL population [11] by lowering the marker filtering criteria with ≥75% call rate and minimum allele frequency ≥ 0.1. All the recruited markers had known locations on the Capsicum chromosome.
The fine mapped QTL was then analyzed to identify markers closely linked to the resistance to anthracnose with single-marker analysis using QTL IciMapping 4.1 software (http://www.isbreeding.net (accessed on 16 August 2022); [17]). The quantitative phenotypic data derived from Kethom and Mongkolporn [11] were converted to binary data as 0 = resistance and 1 = susceptibility. Single-marker analysis based on a simple linear regression [10] was used to identify markers that were most linked to the resistance to anthracnose by showing the highest LOD scores.
Putative genes involved in the plant defense mechanisms were searched within 7 Mb up- and down-stream of the fine QTL region, and were selected for the gene expression study.

2.2. Selection of RILs with Resistance and Susceptibility to Anthracnose

Thirty-one RILs from a cross of C. baccatum ‘PBC80’ × ‘CA1316’ were grown in 30 cm plastic pots. Each line contained 1–2 plants. The chili plants were laid in a 32-mesh insect-proof house with 50 × 100 cm spacing, at the Tropical Vegetable Research and Development Center, Department of Horticulture, Faculty of Agriculture at Kamphaeng Saen, Kasetsart University, Nakhon Pathom, Thailand.
A fruit bioassay was performed to evaluate resistance to anthracnose. Three fruits each at mature green and ripe maturity stages were collected for inoculation. Each fruit was wounded and inoculated with Colletotrichum scovillei isolate MJ5 using a microinjector [10]. Anthracnose symptoms were evaluated at 9 days after inoculation. The anthracnose severity was evaluated based on a 0–9 disease score developed by [18], whereby the lesion size proportional to the fruit size was considered as follows: 0 = no infection, 1 = 1–2%, 3 = >2–5%, 5 = >5–15%, 7 = >15–25%, 9 = >25%.
Two RILs, anthracnose-resistance (R/R) and -susceptible (S/S) at both fruit stages, were selected.

2.3. Expression Study of the Putative Defense-Related Genes

2.3.1. Fruit Inoculation

The isolate MJ5 was cultured on potato dextrose agar (PDA; Difco, Becton, Dickinson and Company, Sparks, MD, USA) under near-UV for 7 days. When the fungus sporulated, sterilized water was added to the top of the culture and the culture surface was scraped to collect spores. The collected spores were filtered with sterilized muslin cloth. The spores were adjusted to a concentration of 1.0 × 106 spores/mL [18].
Fifteen ripe fruit were collected from each chili plant. Calyces were removed and fruit were surface sterilized in 1% (w/v) sodium hypochlorite solution for 5 min, and then rinsed twice with reverse osmosis water. The clean fruit were laid on a metal sieve in a plastic box half-filled with water. Of the 15 fruit, 9 were inoculated with sterilized water, and 6 were inoculated with the MJ5. Each fruit was injected twice in the middle of the pericarp. The injection wounds were 3 cm apart. Each injection contained 1 μL of either water or spore suspension. The plastic inoculation box lid was closed to maintain high humidity for 12 h.

2.3.2. RNA Extraction and cDNA Synthesis

Total RNA was extracted from the challenged fruit with either water or the MJ5 at 0 (only water inoculation was performed), 6, and 12 h after inoculation, using a modified CTAB-LiCl method [19]. The 1 cm2 fruit tissue surrounding the inoculation wound was excised and immediately dipped into liquid nitrogen. The frozen tissue was stored at −80 °C until required for RNA extraction. The quantity and quality of the extracted total RNA was measured with a Nanodrop 2000c spectrophotometer (Thermo Fischer Scientific, Waltham, MA, USA). The RNA was stored at −80 °C.
Before cDNA synthesis, the RNA samples were DNA cleaned by incubating the RNA with DNAse I, RNAse-free (New England Biolabs, Ipswich, MA, USA) at 37 °C for 40 min. One µg of the RNA was converted to cDNA with the RevertAid RT Reverse Transcription Kit (Thermo Fischer Scientific, Waltham, MA, USA). The cDNA quantity and quality were inspected using the Nanodrop 2000c spectrophotometer. The cDNA was diluted 15-fold with RNase-free water, and then transferred to −80 °C storage.

2.3.3. Designing the Primers Specific to the Targeted Defense-Related Genes

The nucleotide data of the selected putative defense-related genes were derived from the Capsicum baccatum ‘PBC81’ reference genome, GenBank database “www.ncbi.nlm.nih.gov (accessed on 15 August 2022)”. The secondary structure of each gene was inspected with mfold “http://www.unafold.org (accessed on 16 August 2022)”. The primers specific to the selected genes were designed with Primer3Plus “https://www.primer3plus.com (accessed on 16 August 2022)” (Table 1) by avoiding any expected secondary structure regions.

2.3.4. Gene Expression Analysis with qRT-PCR

A qRT-PCR reaction was prepared in a 15 µL volume with final concentrations of all ingredients as follows: 1× Maxima SYBR Green qPCR Master Mix (Thermo Fischer Scientific, Waltham, MA, USA), 0.4 µM each primer and 17 ng cDNA. The qRT-PCR was performed in a CFX Opus 96 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) with a thermal program as follows: initial denaturation at 95 °C for 10 min, denaturation at 95 °C for 15 s, annealing/extension at 54–59 °C for 60 s (varied by different primers). The thermal steps 2 and 3 were repeated for 40 cycles. The PCR product sizes were inspected with melting curve analysis and agarose gel electrophoresis. Each cDNA sample was performed in qRT-PCR thrice (technical replications).
Levels of relative expressions of the genes were calculated by the 2−ΔΔCt method [20] in comparison with two housekeeping genes, glyceraldehydes 3 phosphate dehydrogenase (GADPH) and elongation factor 1-alpha (EF-1α), and the control cDNA derived from the fruit inoculated with water at 0 h. Two-way analysis of variance (ANOVA) was performed, and means were compared by Tukey’s HSD test using the R software version R-4.2.2 [21].

3. Results

3.1. Fine Mapping and Defense-Related Gene Selection

An additional 80 molecular markers within the QTL RA80f6_r1 were discovered from the DArTseq genome data of the RIL ‘PBC80’ × ‘CA1316’ population [11]. Of the 80 markers, 69 were silico (insertion-deletion mutants) and 11 were SNPs. Single-marker analysis identified two closely linked markers to the anthracnose resistance loci, Silico09 (34,998,101 bp) and SNP309 (33,876,713 bp), with LOD 5.9 and 5.2, respectively. The physical distance between the Silico09 and SNP309 were 1.12 Mb (Figure 2, Table 2).
Gene searching in the new QTL RA80f6_r1 region found nine genes, six of which were defense related and three were unknown (Table 3).

3.2. Selection of the RILs with Resistance and Susceptibility to Anthracnose

Of the 31 RILs, 29 yielded fruit for anthracnose resistance bioassay. Four RILs showed resistance at both fruit stages (R/R), three were resistant at mature green fruit (R/S), eight were resistant at ripe fruit (S/R), and 12 were susceptible at both fruit stages (S/S) (Table 4). Two RILs G1-017130 and G1-017264 were selected with R/R and S/S phenotypes, respectively, (Figure 3, Table 4) for further gene expression study. Anthracnose severity scores of the ‘PBC80’, ‘CA1316’, and the RILs are displayed in Figure 4.

3.3. Gene Expression in the Chili Fruit Post Inoculation

The gene expression in the fruit after inoculation of the nine genes, including LYM2, ERF, HP596, HP597, CLF, HP601, ARF23, NFXL1, and PR-14 were investigated by the qRT-PCR technique. The R/R genotype had six significantly up-regulated genes, i.e., LYM2, ERF, HP597, CLF, NFXL1, and PR-14 compared to the control (water inoculation at 0 h; Figure 5). Only ERF up-regulated in both chili genotypes; However, the expression was relatively and constantly low in the S/S genotype. Most up-regulated genes reached the highest peak (2.3–4.5 fold) at 6 h and declined at 12 h, except for the ERF, which had the highest peak (6.4 fold) at 12 h.
Similar patterns of the gene expressions were also found in the chili fruit inoculated with water. The six genes, i.e., LYM2, ERF, HP597, CLF, NFXL1 and PR-14, significantly up-regulated in the R/R genotype and reached the highest peak at 6 h (1.51–3.74 fold) then declined at 12 h, except for the ERF that had the highest peak (4.98 fold) at 12 h (Figure 5). The expression levels of these genes in the water control were significantly lower than those in the fruit inoculated with MJ5 (Table 5).

4. Discussion

4.1. Defense Roles for the Identified Genes

The resistance to anthracnose derived from the ‘PBC80’ has been well documented [8,23]. The defense mechanism is known as a hypersensitive reaction (HR), whereby a form of rapid localized cell death occurs at the infection site to restrict pathogen spread [24]. Plants generally resist a pathogen invasion via two innate immune systems, i.e., cell-surface pattern recognition receptor (PRR)-mediated and intracellular nucleotide-binding leucine-rich repeat receptor (NLR)-mediated immunities [25]. Recent reports have shown that both PRR- and NLR-mediated immunities have mutual roles in HR [26,27,28,29,30], which is defined as pathogen recognition, ion influxes, reactive oxygen species (ROS) burst, lipid peroxidation, transcriptional reprogramming, and cell wall reinforcement [24].
LYM2 (LysM domain-containing GPI-anchored protein or chitin elicitor-binding protein (CEBiP)) is known as PRR. The PRR’s roles in plant defense are pathogen recognition and induction of a plasmodesmata closure, which is the first response by plants to stresses [31]. Once the pathogen is recognized, different signaling cascades in PRR-mediated immunity, i.e., ion influxes, ROS burst, and MAPK cascade are triggered. The recognition roles of LYM2 as PRR have been reported in rice and Arabidopsis [32,33,34]. Moreover, the induction of plasmodesmata closure by LYM2 was also reported in Arabidopsis after being infected by Botrytis cinerea [35]. The plasmodesmata closure could prohibit the pathogen spread to the neighboring cells.
NFXL1 (NF-X1-type zinc finger protein) is a transcription factor identified in Arabidopsis [36]. NFXL1 was reported in Arabidopsis for positive regulation of the production of H2O2, a member of ROS [37]. The accumulation of ROS is one of the earliest defense responses in plants upon pathogen recognition. The ROS’s involvement in the HR through promoting a cell wall reinforcement by forming a cross-linking between glycoproteins [38,39], signaling to stimulate other plant defense responses against pathogens [40,41,42], and participating in programmed cell death (PCD) via the ROS burst process [43,44,45,46].
CLF (Histone-lysine N-methyltransferase) has a role in epigenetic regulation of gene expressions through repressive chromatin to silence genes by DNA methylations of H3K27 on the histone H3 [47,48,49,50]. In a stress condition, CLF also suppresses the expressions of some genes to properly respond to the environments [51,52,53,54]. Recently, CLF was reported to promote a set of defense genes that induced the PCD against a pathogen effector in Arabidopsis [55].
ERF (Ethylene-responsive transcription factor) is a transcription factor in a subfamily of the APETALA2 (AP2)/ethylene-responsive-element-binding protein (EREBP) in plants [56]. ERF plays several different roles during plant development to regulate plant defense responses against abiotic and biotic stresses [57,58,59,60,61,62]. Therefore, ERF could promote HR by directly activating the expression of defense-related genes.
PR-14, or non-specific lipid-transfer protein 2 (LPT2) is primarily involved in various key processes of plant cytology, i.e., cell wall organization, cell membrane stabilization and signal transduction [63]. In plantdefense, LPT1 and LPT2 have been identified as pathogenesis-related (PR) proteins known as PR-14 [64]. PR proteins are basically against microorganisms. PR-14 was reported to exhibit antimicrobial activity in mung bean, rice, and wheat against various fungal pathogens, i.e., Fusarium solani, Fusarium oxysporum, Pythium aphanidermatum, Athelia rolfsii, Magnaporthe grisea, Rhizoctonia solani, Alternaria sp., Curvularia lunata, Bipolaris oryzae, Cylindrocladium scoparium, Botrytis cinerea and Sarocladium oryzae [65,66,67], by disrupting the pathogen cell membrane causing loss of membrane integrity [68,69].

4.2. Wound Response in Plant Defense Mechanism

Similar to the defense responses to the pathogen invasion, plants with abiotic (wound) stresses activate Ca2+ influx, ROS burst, phosphorylation, electrical signaling, the expression of defense-related genes, synthesis of phytohormone, and cell wall reinforcement soon after plant cells are injured [70,71,72]. The inoculation method in the study used a microinjector to wound the pericarp of the chili fruit simultaneously to deliver the inoculum. The fruit inoculated with water also had the same wound-response genes up-regulated as occurred in the ones inoculated with the MJ5 pathogen.

4.3. Speculative Roles of LYM2 in HR

HR is a rapid defense mechanism that requires gene receptors to first recognize a pathogen and quickly causes localized cell death in the infected area [12,26]. Several studies in Arabidopsis revealed that PRRs and NLRs worked together to trigger HR [26,73,74,75,76]. In the principle, PRRs act by recognizing the pathogen’s elicitor, and subsequently is suppressed by the pathogen’s activities to avoid defense elicitation [77]. NLRs’ role is to support PRRs after being suppressed [25,26]. Therefore, gene receptors appeared to play a key role as an HR trigger in plant defenses.
Recently, CbAR9, a NLR gene, was reported to be responsible for the HR in the ‘PBC80’ against anthracnose (Co. truncatum) [78]. CbAR9 was found highly expressed at 12 h after fruit inoculation [78]; however, the gene expression was not investigated earlier. LYM2 has been proven a PRR member [34,35] that showed the highest transcript level (4.53 fold) at the earliest hour (6 h) after fruit inoculation in this study, and thus may have had an important role to induce the HR in ‘PBC80’ chili as well. Based on both studies, CbAR9 and LYM2 seemed to involve in the HR in ‘PBC80’ as PRR and NLR receptors.

5. Conclusions

A fine map of the QTL RA80f6_r1 region was achieved by incorporating 80 new markers into the region. Single marker analysis identified two closely linked markers to the anthracnose resistance, Silico09 and SNP309, that were physically 1.12 Mb apart and housing six defense-related and three unknown genes. Five genes, including LYM2, CQW23_09597, CLF, NFXL1, and PR-14 significantly up-regulated in the resistant chili genotype. LYM2 was the most interesting gene with a receptor function and having the earliest and highest response.

Author Contributions

O.M. project administration. O.M. and P.W.J.T.: conceptualization, supervision, writing—review and editing. W.K.: methodology, data curation, formal analysis, writing—original draft preparation. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Office of the Ministry of Higher Education, Science, Research and Innovation; and the Thailand Science Research and Innovation through the Kasetsart University Reinventing University Program 2021 (Grant ID: RUP2.2/Con-CASAF PD01).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Mongkolporn, O. Capsicum: Breeding Strategies for Anthracnose Resistance; CRC Press: Boca Raton, FL, USA, 2018. [Google Scholar]
  2. Mongkolporn, O.; Taylor, P.W.J. Chili anthracnose: Colletotrichum taxonomy and pathogenicity. Plant Pathol. 2018, 67, 1255–1263. [Google Scholar] [CrossRef]
  3. Mongkolporn, O.; Montri, P.; Supakaew, T.; Taylor, P.W.J. Differential reactions on mature green and ripe chili fruit infected by three Colletotrichum species. Plant Dis. 2010, 94, 306–310. [Google Scholar] [CrossRef] [PubMed]
  4. St Clair, D.A. Quantitative disease resistance and quantitative resistance Loci in breeding. Annu. Rev. Phytopathol. 2010, 48, 247–268. [Google Scholar] [CrossRef] [PubMed]
  5. Pilet-Nayel, M.-L.; Moury, B.; Caffier, V.; Montarry, J.; Kerlan, M.-C.; Fournet, S.; Durel, C.-E.; Delourme, R. Quantitative resistance to plant pathogens in pyramiding strategies for durable crop protection. Front Plant Sci. 2017, 8, 1838. [Google Scholar] [CrossRef]
  6. Mahasuk, P.; Khumpeng, N.; Wasee, S.; Taylor, P.W.J.; Mongkolporn, O. Inheritance of resistance to anthracnose (Colletotrichum capsici) at seedling and fruiting stages in chili pepper (Capsicum spp.). Plant Breed. 2009, 128, 701–706. [Google Scholar] [CrossRef]
  7. Mahasuk, P.; Taylor, P.W.J.; Mongkolporn, O. Identification of two new genes conferring resistance to Colletotrichum acutatum in Capsicum baccatum L. Phytopathology 2009, 99, 1100–1104. [Google Scholar] [CrossRef]
  8. Mahasuk, P.; Chinthaisong, J.; Mongkolporn, O. Differential resistances to anthracnose in Capsicum baccatum as responding to two Colletotrichum pathotypes and inoculation methods. Breed. Sci. 2013, 63, 333–338. [Google Scholar] [CrossRef]
  9. Mahasuk, P.; Struss, D.; Mongkolporn, O. QTLs for resistance to anthracnose identified in two Capsicum sources. Mol. Breed. 2016, 36, 10. [Google Scholar] [CrossRef]
  10. Collard, B.C.; Jahufer, M.Z.Z.; Brouwer, J.B.; Pang, E.C.K. An introduction to markers, quantitative trait loci (QTL) mapping and marker-assisted selection for crop improvement: The basic concepts. Euphytica 2005, 142, 169–196. [Google Scholar] [CrossRef]
  11. Kethom, W.; Mongkolporn, O. New QTLs for anthracnose resistance identified in Capsicum baccatum ‘PBC80’-derived recombinant inbred lines. Euphytica 2021, 217, 218. [Google Scholar] [CrossRef]
  12. Pitsili, E.; Phukan, U.J.; Coll, N.S. Cell death in plant immunity. Cold Spring Harb. Perspect. Biol. 2020, 12, a036483. [Google Scholar] [CrossRef] [PubMed]
  13. Li, W.; Liu, Y.; Wang, J.; He, M.; Zhou, X.; Yang, C.; Yuan, C.; Wang, J.; Chern, M.; Yin, J.; et al. The durably resistant rice cultivar Digu activates defence gene expression before the full maturation of Magnaporthe oryzae appressorium. Mol. Plant Pathol. 2016, 17, 354–368. [Google Scholar] [CrossRef] [PubMed]
  14. Santos, M.d.L.; de Resende, M.L.V.; dos Santos Ciscon, B.A.; Freitas, N.C.; Pereira, M.H.d.B.; Reichel, T.; Mathioni, S.M. LysM receptors in Coffea arabica: Identification, characterization, and gene expression in response to Hemileia vastatrix. PLoS ONE 2022, 17, e0258838. [Google Scholar] [CrossRef] [PubMed]
  15. Auyong, A.S.; Ford, R.; Taylor, P.W. The role of cutinase and its impact on pathogenicity of Colletotrichum truncatum. J. Plant Pathol. Microbiol. 2015, 6, 259. [Google Scholar] [CrossRef]
  16. Cruz, V.M.V.; Kilian, A.; Dierig, D.A. Development of DArT marker platforms and genetic diversity assessment of the U.S. collection of the new oilseed crop Lesquerella and Related Species. PLoS ONE 2013, 8, e64062. [Google Scholar] [CrossRef]
  17. Wang, J.; Li, H.; Zhang, L.; Meng, L. Users’ Manual of QTL IciMapping; The Quantitative Genetics Group, Institute of Crop Science, Chinese Academy of Agricultural Sciences (CAAS): Beijing, China; Genetic Resources Program, International Maize and Wheat Improvement Center (CIMMYT): Texcoco, Mexico, 2016. [Google Scholar]
  18. Montri, P.; Taylor, P.W.J.; Mongkolporn, O. Pathotypes of Colletotrichum capsici, the causal agent of chili anthracnose, in Thailand. Plant Dis. 2009, 93, 17–20. [Google Scholar] [CrossRef]
  19. Chang, S.; Puryear, J.; Cairney, J. A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol. Rep. 1993, 11, 113–116. [Google Scholar] [CrossRef]
  20. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  21. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2013; Available online: http://www.R-project.org (accessed on 22 January 2023).
  22. Kim, S.; Park, J.; Yeom, S.-I.; Kim, Y.-M.; Seo, E.; Kim, K.-T.; Kim, M.-S.; Lee, J.M.; Cheong, K.; Shin, H.-S.; et al. New reference genome sequences of hot pepper reveal the massive evolution of plant disease-resistance genes by retroduplication. Genome Biol. 2017, 18, 210. [Google Scholar] [CrossRef]
  23. Kim, K.H.; Yoon, J.B.; Park, H.G.; Park, E.W.; Kim, Y.H. Structural modifications and programmed cell death of chili pepper fruit related to resistance responses to Colletotrichum gloeosporioides infection. Phytopathology 2004, 94, 1295–1304. [Google Scholar] [CrossRef]
  24. Balint-Kurti, P. The plant hypersensitive response: Concepts, control and consequences. Mol. Plant Pathol. 2009, 20, 1163–1178. [Google Scholar] [CrossRef] [PubMed]
  25. Ngou, B.P.M.; Ding, P.; Jones, J.D.G. Thirty years of resistance: Zig-zag through the plant immune system. Plant Cell. 2022, 34, 1447–1478. [Google Scholar] [CrossRef] [PubMed]
  26. Ngou, B.P.M.; Ahn, H.K.; Ding, P.; Jones, J.D.G. Mutual potentiation of plant immunity by cell-surface and intracellular receptors. Nature 2021, 592, 110–115. [Google Scholar] [CrossRef] [PubMed]
  27. Khatib, M.; Lafitte, C.; Esquerré-Tugayé, M.-T.; Bottin, A.; Rickauer, M. The CBEL elicitor of Phytophthora parasitica var. nicotianae activates defence in Arabidopsis thaliana via three different signalling pathways. New Phytol. 2004, 162, 501–510. [Google Scholar] [CrossRef]
  28. Ma, Z.; Song, T.; Zhu, L.; Ye, W.; Wang, Y.; Shao, Y.; Dong, S.; Zhang, Z.; Dou, D.; Zheng, X.; et al. A Phytophthora sojae glycoside hydrolase 12 protein is a major virulence factor during soybean infection and is recognized as a PAMP. Plant Cell. 2015, 27, 2057–2072. [Google Scholar] [CrossRef]
  29. Wang, Y.; Tyler, B.M.; Wang, Y. Defense and counterdefense during plant-pathogenic oomycete infection. Annu. Rev. Microbiol. 2019, 73, 667–696. [Google Scholar] [CrossRef]
  30. Kaku, H.; Nishizawa, Y.; Ishii-Minami, N.; Akimoto-Tomiyama, C.; Dohmae, N.; Takio, K.; Minami, E.; Shibuya, N. Plant cells recognize chitin fragments for defense signaling through a plasma membrane receptor. Proc. Natl. Acad. Sci. USA 2006, 103, 11086–11091. [Google Scholar] [CrossRef]
  31. Zhang, J.; Zhou, J.M. Plant immunity triggered by microbial molecular signatures. Mol. Plant 2010, 3, 783–793. [Google Scholar] [CrossRef]
  32. Hu, S.P.; Li, J.J.; Dhar, N.; Li, J.P.; Chen, J.Y.; Jian, W.; Dai, X.F.; Yang, X.Y. Lysin motif (LysM) proteins: Interlinking manipulation of plant immunity and fungi. Int. J. Mol. Sci. 2021, 22, 3114. [Google Scholar] [CrossRef]
  33. Liu, S.; Wang, J.; Han, Z.; Gong, X.; Zhang, H.; Chai, J. Molecular mechanism for fungal cell wall recognition by rice chitin receptor OsCEBiP. Structure 2016, 24, 1192–1200. [Google Scholar] [CrossRef]
  34. Narusaka, Y.; Shinya, T.; Narusaka, M.; Motoyama, N.; Shimada, H.; Murakami, K.; Shibuya, N. Presence of LYM2 dependent but CERK1 independent disease resistance in Arabidopsis. Plant Signal. Behav. 2013, 8, e25345. [Google Scholar] [CrossRef] [PubMed]
  35. Faulkner, C.; Petutschnig, E.; Benitez-Alfonso, Y.; Beck, M.; Robatzek, S.; Lipka, V.; Maule, A.J. LYM2-dependent chitin perception limits molecular flux via plasmodesmata. Proc. Natl. Acad. Sci. USA 2013, 110, 9166–9170. [Google Scholar] [CrossRef]
  36. Müssig, C.; Schröder, F.; Usadel, B.; Lisso, J. Structure and putative function of NFX1-like proteins in plants. Plant Biol. 2010, 12, 381–394. [Google Scholar] [CrossRef] [PubMed]
  37. Lisso, J.; Altmann, T.; Müssig, C. The AtNFXL1 gene encodes a NF-X1 type zinc finger protein required for growth under salt stress. FEBS Lett. 2006, 580, 4851–4856. [Google Scholar] [CrossRef]
  38. Levine, A.; Tenhaken, R.; Dixon, R.; Lamb, C. H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 1994, 79, 583–593. Available online: http://bit.ly/2W6ZR2x (accessed on 28 April 2023). [CrossRef] [PubMed]
  39. Lamb, C.; Dixon, R.A. The oxidative burst in plant disease resistance. Annu. Rev. Plant Biol. 1997, 48, 251–275. [Google Scholar] [CrossRef]
  40. Mittler, R.; Vanderauwera, S.; Suzuki, N.; Miller, G.; Tognetti, V.B.; Vandepoele, K.; Gollery, M.; Shulaev, V.; Van Breusegem, F. ROS signaling: The new wave? Trends Plant Sci. 2011, 16, 300–309. [Google Scholar] [CrossRef]
  41. Gilroy, S.; Białasek, M.; Suzuki, N.; Górecka, M.; Devireddy, A.R.; Karpiński, S.; Mittler, R. ROS, calcium, and electric signals: Key mediators of rapid systemic signaling in plants. Plant Physiol. 2016, 171, 1606–1615. [Google Scholar] [CrossRef]
  42. Pitzschke, A.; Hirt, H. Mitogen-activated protein kinases and reactive oxygen species signaling in plants. Plant Physiol. 2006, 141, 351–356. [Google Scholar] [CrossRef]
  43. Choi, H.W.; Kim, Y.J.; Lee, S.C.; Hong, J.K.; Hwang, B.K. Hydrogen peroxide generation by the pepper extracellular peroxidase CaPO2 activates local and systemic cell death and defence response to bacterial pathogens. Plant Physiol. 2007, 145, 890–904. Available online: http://bit.ly/2WcpE9w (accessed on 28 April 2023). [CrossRef]
  44. Doke, N.; Miura, Y.; Sanchez, L.M.; Park, H.J.; Noritake, T.; Yoshioka, H.; Kawakita, K. The oxidative burst protects plants against pathogen attack: Mechanism and role as an emergency signal for plant biodefence—A review. Gene 1996, 79, 45–51. Available online: http://bit.ly/2w6eNTP (accessed on 28 April 2023). [CrossRef]
  45. Lehmann, S.; Serrano, M.; L’Haridon, F.; Tjamos, S.E.; Metraux, J.-P. Reactive oxygen species and plant resistance to fungal pathogens. Phytochemistry 2015, 112, 54–62. [Google Scholar] [CrossRef] [PubMed]
  46. Shetty, N.P.; Lyngs, H.J.J.; Jensen, D.; Collinge, D.B.; Shekar, H.C. Roles of reactive oxygen species in interactions between plants and pathogens. Eur. J. Plant Pathol. 2008, 121, 267–280. Available online: http://bit.ly/2xsyju3 (accessed on 29 April 2023). [CrossRef]
  47. Köhler, C.; Grossniklaus, U. Epigenetic inheritance of expression states in plant development: The role of polycomb group proteins. Curr. Opin. Cell Biol. 2002, 14, 773–779. [Google Scholar] [CrossRef] [PubMed]
  48. Schatlowski, N.; Creasey, K.; Goodrich, J.; Schubert, D. Keeping plants in shape: Polycomb-group genes and histone methylation. Semin. Cell Dev. Biol. 2008, 19, 547–553. [Google Scholar] [CrossRef]
  49. Schatlowski, N.; Stahl, Y.; Hohenstatt, M.L.; Goodrich, J.; Schubert, D. The CURLY LEAF interacting protein BLISTER controls expression of polycomb-group target genes and cellular differentiation of Arabidopsis thaliana. Plant Cell. 2010, 22, 2291–2305. [Google Scholar] [CrossRef]
  50. Yu, Y.; Bu, Z.; Shen, W.-H.; Dong, A. An update on histone lysine methylation in plants. Prog. Nat. Sci. 2009, 19, 407–413. [Google Scholar] [CrossRef]
  51. Kang, H.; Fan, T.; Wu, J.; Zhu, Y.; Shen, W.-H. Histone modification and chromatin remodeling in plant response to pathogens. Front. Plant Sci. 2022, 13, 986940. [Google Scholar] [CrossRef] [PubMed]
  52. Kleinmanns, J.A.; Schatlowski, N.; David, H.; Daniel, S. BLISTER regulates polycomb-target genes, represses stress-regulated genes and promotes stress responses in Arabidopsis thaliana. Front. Plant Sci. 2017, 8, 1530. [Google Scholar] [CrossRef]
  53. Liu, C.; Cheng, J.; Zhuang, Y.; Ye, L.; Li, Z.; Wang, Y.; Qi, M.; Xu, L.; Zhang, Y. Polycomb repressive complex 2 attenuates ABA-induced senescence in Arabidopsis. Plant J. 2019, 97, 368–377. [Google Scholar] [CrossRef]
  54. Wood, C.C.; Robertson, M.; Tanner, G.; Peacock, W.J.; Dennis, E.S.; Helliwell, C.A. The Arabidopsis thaliana vernalization response requires a polycomb-like protein complex that also includes VERNALIZATION INSENSITIVE 3. Proc. Natl. Acad. Sci. USA 2006, 103, 14631–14636. [Google Scholar] [CrossRef] [PubMed]
  55. Tomaštíková, E.D.; Hafrén, A.; Trejo-Arellano, M.S.; Rasmussen, S.R.; Sato, H.; Santos-González, J.; Köhler, C.; Hennig, L.; Hofius, D. Polycomb repressive complex 2 and KRYPTONITE regulate pathogen-induced programmed cell death in Arabidopsis. Plant Physiol. 2021, 185, 2003–2021. [Google Scholar] [CrossRef] [PubMed]
  56. Singh, K.B.; Foley, R.C.; Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 2002, 5, 430–436. [Google Scholar] [CrossRef] [PubMed]
  57. Berrocal-Lobo, M.; Molina, A.; Solano, R. Constitutive expression of ETHYLENE-RESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic fungi. Plant J. 2002, 29, 23–32. [Google Scholar] [CrossRef]
  58. Berrocal-Lobo, M.; Molina, A. Ethylene Response Factor 1 mediates Arabidopsis resistance to the soilborne fungus Fusarium oxysporum. Mol. Plant-Microbe Interact. 2004, 17, 763–770. [Google Scholar] [CrossRef]
  59. Cheng, M.C.; Liao, P.M.; Kuo, W.W.; Lin, T.P. The Arabidopsis ETHYLENE RESPONSE FACTOR1 regulates abiotic stress-responsive gene expression by binding to different cis-acting elements in response to different stress signals. Plant Physiol. 2013, 162, 1566–1582. [Google Scholar] [CrossRef] [PubMed]
  60. Müller, M.; Munné-Bosch, S. Ethylene response factors: A key regulatory hub in hormone and stress signaling. Plant Physiol. 2015, 169, 32–41. [Google Scholar] [CrossRef]
  61. Xing, L.; Di, Z.; Yang, W.; Liu, J.; Li, M.; Wang, X.; Cui, C.; Wang, X.; Wang, X.; Zhang, R.; et al. Overexpression of ERF1-V from Haynaldia villosa can enhance the resistance of wheat to powdery mildew and increase the tolerance to salt and drought stresses. Front. Plant Sci. 2017, 8, 1948. [Google Scholar] [CrossRef]
  62. Yang, C.; Li, W.; Cao, J.; Meng, F.; Yu, Y.; Huang, J.; Jiang, L.; Liu, M.; Zhang, Z.; Chen, X.; et al. Activation of ethylene signaling pathways enhances disease resistance by regulating ROS and phytoalexin production in rice. Plant J. 2017, 89, 338–353. [Google Scholar] [CrossRef]
  63. Liu, F.; Zhang, X.; Lu, C.; Zeng, X.; Li, Y.; Fu, D.; Wu, G. Non-specific lipid transfer proteins in plants: Presenting new advances and an integrated functional analysis. J. Exp. Bot. 2015, 66, 5663–5681. [Google Scholar] [CrossRef]
  64. Van Loon, L.C.; Van Strien, E.A. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol. 1999, 55, 85–97. Available online: https://dspace.library.uu.nl/bitstream/handle/1874/1590/PMPP-van+Loon-1999.pdf?sequence=1 (accessed on 25 April 2023). [CrossRef]
  65. Wang, S.Y.; Wu, J.H.; Ng, T.B.; Ye, X.Y.; Rao, P.F. A non-specific lipid transfer protein with antifungal and antibacterial activities from the mung bean. Peptides 2004, 25, 1235–1242. [Google Scholar] [CrossRef]
  66. Patkar, R.N.; Chattoo, B.B. Transgenic indica rice expressing ns-LTP-like protein shows enhanced resistance to both fungal and bacterial pathogens. Mol. Breed. 2006, 17, 159–171. [Google Scholar] [CrossRef]
  67. Kirubakaran, S.I.; Begum, S.M.; Ulaganathan, K.; Sakthivel, N. Characterization of a new antifungal lipid transfer protein from wheat. Plant Physiol. Biochem. 2018, 46, 918–927. [Google Scholar] [CrossRef] [PubMed]
  68. Caaveiro, J.M.; Molina, A.; González-Mañas, J.M.; Rodríguez-Palenzuela, P.; Garcia-Olmedo, F.; Goñi, F.M. Differential effects of five types of antipathogenic plant peptides on model membranes. FEBS Lett. 1997, 410, 338–342. [Google Scholar] [CrossRef] [PubMed]
  69. Regente, M.C.; De La Canal, L. Purification, characterization and antifungal properties of a lipid-transfer protein from sunflower (Helianthus annuus) seeds. Physiol. Plant. 2000, 110, 158–163. [Google Scholar] [CrossRef]
  70. Savatin, D.V.; Gramegna, G.; Modesti, V.; Cervone, F. Wounding in the plant tissue: The defense of a dangerous passage. Front. Plant Sci. 2014, 5, 470. [Google Scholar] [CrossRef]
  71. Hou, S.; Liu, Z.; Shen, H.; Wu, D. Damage-associated molecular pattern-triggered immunity in plants. Front. Plant Sci. 2019, 10, 646. [Google Scholar] [CrossRef]
  72. Vega-Muñoz, I.; Duran-Flores, D.; Fernández-Fernández, A.D.; Heyman, J.; Ritter, A.; Stael, S. Breaking bad news: Dynamic molecular mechanisms of wound response in plants. Front. Plant Sci. 2020, 11, 610445. [Google Scholar] [CrossRef]
  73. Wu, Y.; Gao, Y.; Zhan, Y.; Kui, H.; Liu, H.; Yan, L.; Kemmerling, B.; Zhou, J.-M.; He, K.; Li, J. Loss of the common immune coreceptor BAK1 leads to NLR-dependent cell death. Proc. Natl. Acad. Sci. USA 2020, 117, 27044–27053. [Google Scholar] [CrossRef]
  74. Zhang, Z.; Wu, Y.; Gao, M.; Zhang, J.; Kong, Q.; Liu, Y.; Ba, H.; Zhou, J.; Zhang, Y. Disruption of PAMP-Induced MAP Kinase cascade by a Pseudomonas syringae effector activates plant immunity mediated by the NB-LRR protein SUMM2. Cell Host Microbe 2012, 11, 253–263. [Google Scholar] [CrossRef] [PubMed]
  75. Pruitt, R.N.; Locci, F.; Wanke, F.; Zhang, L.; Saile, S.C.; Joe, A.; Karelina, D.; Hua, C.; Fröhlich, K.; Wan, W.-L.; et al. The EDS1-PAD4-ADR1 node mediates Arabidopsis pattern-triggered immunity. Nature 2021, 598, 495–499. [Google Scholar] [CrossRef] [PubMed]
  76. Yuan, M.; Jiang, Z.; Bi, G.; Nomura, K.; Liu, M.; Wang, Y.; Cai, B.; Zhou, J.M.; He, S.Y.; Xin, X.F. Pattern-recognition receptors are required for NLR-mediated plant immunity. Nature 2021, 592, 105–109. [Google Scholar] [CrossRef] [PubMed]
  77. Jones, J.D.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef] [PubMed]
  78. Son, S.; Kim, S.; Lee, K.S.; Oh, J.; Choi, I.; Do, J.W.; Yoon, J.B.; Han, J.; Choi, D.; Park, S.R. Identification of the Capsicum baccatum NLR protein CbAR9 conferring disease resistance to anthracnose. Int. J. Mol. Sci. 2021, 22, 12612. [Google Scholar] [CrossRef]
Pathogens 12 01306 g001
Figure 1. A graphical summary of the study methodology.
Figure 1. A graphical summary of the study methodology.
Pathogens 12 01306 g001
Pathogens 12 01306 g002
Figure 2. Fine map of the QTL RA80f6_r1 after the addition of the silico and SNP markers (left); LOD values of all the markers in the QTL derived from single marker analysis (right), indicating SNP309 and Silico09 had the highest LODs (5.2 and 5.9, respectively).
Figure 2. Fine map of the QTL RA80f6_r1 after the addition of the silico and SNP markers (left); LOD values of all the markers in the QTL derived from single marker analysis (right), indicating SNP309 and Silico09 had the highest LODs (5.2 and 5.9, respectively).
Pathogens 12 01306 g002
Pathogens 12 01306 g003
Figure 3. Two selected RILs G1-017130 with R/R (top) and G1-017264 with S/S (bottom) phenotypes for the gene expression study.
Figure 3. Two selected RILs G1-017130 with R/R (top) and G1-017264 with S/S (bottom) phenotypes for the gene expression study.
Pathogens 12 01306 g003
Pathogens 12 01306 g004
Figure 4. Anthracnose severity scores on mature green and ripe fruit in Capsicum baccatum ‘PBC80’ and ‘CA1316’, and in the 29 RILs. The disease scores 0–7 are found in the RILs; score 0 = G1-017425, score 1 = G1-017325 (green) and G1-017473 (ripe), score 3 = G1-017579 (green) and G1-017540 (ripe), score 5 = G1-017541 (green) and G1-017233 (ripe) and score 7 = G1-017267.
Figure 4. Anthracnose severity scores on mature green and ripe fruit in Capsicum baccatum ‘PBC80’ and ‘CA1316’, and in the 29 RILs. The disease scores 0–7 are found in the RILs; score 0 = G1-017425, score 1 = G1-017325 (green) and G1-017473 (ripe), score 3 = G1-017579 (green) and G1-017540 (ripe), score 5 = G1-017541 (green) and G1-017233 (ripe) and score 7 = G1-017267.
Pathogens 12 01306 g004
Pathogens 12 01306 g005
Figure 5. Relative expression levels 0–12 h post fruit inoculation with MJ5 and water of the nine genes in two chili genotypes: R/R + water (grey), R/R + MJ5 (black), S/S + water (white), and S/S + MJ5 (dot). The vertical bars represent standard deviation of the means based on 2-way ANOVA; *, **, *** and **** indicate statistically significant differences compared to the same chili genotype inoculated with water at 0 h (control) at p < 0.05, p < 0.01, p < 0.001 and p < 0.0001, respectively, by Tukey’s HSD test.
Figure 5. Relative expression levels 0–12 h post fruit inoculation with MJ5 and water of the nine genes in two chili genotypes: R/R + water (grey), R/R + MJ5 (black), S/S + water (white), and S/S + MJ5 (dot). The vertical bars represent standard deviation of the means based on 2-way ANOVA; *, **, *** and **** indicate statistically significant differences compared to the same chili genotype inoculated with water at 0 h (control) at p < 0.05, p < 0.01, p < 0.001 and p < 0.0001, respectively, by Tukey’s HSD test.
Pathogens 12 01306 g005
Table 1. Sequences of the primers specific to the selected defense genes and housekeeping genes.
Table 1. Sequences of the primers specific to the selected defense genes and housekeeping genes.
Gene IDGene DescriptionForward/Reverse Primer 5′–3′Product Size (bp)
CQW23_09568LysM domain-containing GPI-anchored protein 2 (LYM2)CCCGATCTCTCTTCTCATACAAATGC
GGCAGACTTAAGATCCCATCCACAC		133
CQW23_09584Ethylene-responsive transcription factor (ERF)GGGAAGTTGAGATTGTGAGAAGCA
AGGGAGTGAGAATGAGAAGCTGG		172
CQW23_09596Hypothetical protein (HP596)TCTTTGTCTGAGGTTCCATCGG
ACCTTACTACTCTATGCCTTCAAAG		76
CQW23_09597Hypothetical protein (HP597)CCCAATGAAGAGGATGGCTCTGGT
GCAACATCGATTGAACCCCAGAAAC		200
CQW23_09600Histone-lysine N-methyltransferase (CLF)TTCCTCTGAAGATGCAACTGTG
AAGATCCTTCGTCAGATTCTCC		148
CQW23_09601Hypothetical protein (HP601)TCTTGCTGTGGATCTGTTGCTG
TCCTTGCTTTTTGTCTCTGCGG		96
CQW23_09609Auxin response factor 23 (ARF23)AAAGGTCCGAGCAATCAAAGGG
TGCCATCCCTCTCTCTAGAAGC		93
CQW23_09618NF-X1-type zinc finger protein (NFXL1)TGCTTTTGTGGGAAGAGGCAAG
GCAGGGACAACTTCTAGCTGGA		210
CQW23_09644Non-specific lipid-transfer protein 2 (PR-14)ACAAAGGCAAGGTTTCTGCTCTC
GCGATTACATCATCACAACCACCC		72
CQW23_20069Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)AGACCTTGGAGTTGCAGATGTG
TGAGACCGTGACAATGCTAACC		78
CQW23_12274Elongation factor 1-alpha (EF-1α)TCTCCGACGACAAACCTCAAGC
CGCCATTCCTGAATTGTGTGATAGGG		80
Table 2. Physical position and LOD values of the markers in relation to the resistance to anthracnose in the QTL RA80f6_r1 region by single-marker analysis.
Table 2. Physical position and LOD values of the markers in relation to the resistance to anthracnose in the QTL RA80f6_r1 region by single-marker analysis.
MarkerPhysical Position (bp)LOD 1PVE (%) 2Add 3
SNP30522,920,9134.8820.87−0.21
Silico0124,353,1704.1618.07−0.20
SNP30624,353,1904.1618.07−0.20
Silico0225,181,5032.149.78−0.15
Silico0327,298,0893.8716.92−0.19
Silico0427,762,7544.0517.67−0.20
SNP013228,348,5293.7516.48−0.19
Silico0528,350,2633.1714.10−0.18
Silico0631,275,8163.2214.33−0.18
Silico0731,813,2440.241.14−0.05
Silico0832,891,1831.537.08−0.13
SNP30933,876,7135.2222.14−0.22
SNP31034,133,6433.1514.02−0.17
SNP31134,378,5854.7420.34−0.21
Silico0934,998,1015.9124.67−0.23
Silico1039,171,6662.3810.80−0.15
Silico1140,015,4313.4515.26−0.18
Silico1240,678,8564.4619.27−0.20
SNP175541,686,9594.1618.07−0.20
Silico1342,390,8244.8820.87−0.21
Silico1443,749,9641.356.28−0.12
Silico1544,285,1681.707.83−0.13
Silico1646,002,8811.537.11−0.13
Silico1747,161,7821.205.62−0.11
Silico1847,414,3591.537.11−0.13
Silico1947,677,8870.160.79−0.04
Silico2047,681,9510.241.14−0.05
Silico2148,000,0950.090.43−0.03
Silico2248,586,6391.185.51−0.11
Silico2348,746,6374.0517.67−0.20
Silico2451,871,0963.4315.17−0.18
Silico2553,148,7832.9313.11−0.17
Silico2655,311,2092.3810.80−0.15
Silico2755,657,1653.1514.02−0.17
Silico2856,845,3510.411.95−0.07
SNP704965,265,1812.3810.80−0.15
Silico2965,700,0392.169.86−0.15
Silico3065,987,1910.000.04−0.01
Silico3168,981,1482.6411.91−0.16
Silico3271,888,2142.8712.87−0.17
Silico3372,249,4883.4815.36−0.19
Silico3475,024,6223.4415.20−0.18
Silico3578,008,8143.4415.20−0.18
Silico3678,028,3683.7316.38−0.19
Silico3778,035,4100.432.05−0.07
Silico3878,164,0972.169.86−0.15
BACSNP_4_6384,305,8043.1414.00−0.18
Silico3985,431,4463.1414.00−0.18
Silico4086,667,6023.1414.00−0.18
Silico4191,189,2552.3810.80−0.15
Silico4292,568,2271.938.86−0.14
Silico4392,939,1491.195.55−0.11
Silico44100,038,2922.3810.80−0.16
Silico45100,064,4993.7316.38−0.19
Silico46101,835,8801.968.97−0.14
Silico47102,448,0252.8912.94−0.17
Silico48103,063,2171.366.34−0.12
Silico49103,132,9772.4110.94−0.15
Silico50103,371,5312.8712.87−0.17
Silico51103,567,6753.1514.02−0.17
Silico52103,579,8981.968.97−0.14
Silico53104,238,2021.396.45−0.12
Silico54106,569,7592.169.86−0.15
Silico55111,192,8223.7316.38−0.19
BACSNP_4_60113,019,6742.169.86−0.15
Silico56114,140,8552.4110.94−0.15
Silico57115,808,6810.803.76−0.09
Silico58125,855,2063.1814.16−0.17
Silico59129,409,9573.1514.02−0.17
Silico60132,674,3601.597.35−0.13
Silico61133,136,4272.3810.80−0.15
Silico62134,969,2211.778.13−0.13
Silico63136,379,4543.4415.20−0.18
Silico64137,027,1392.8712.87−0.17
Silico65139,918,8882.009.15−0.14
Silico66142,635,2772.8912.94−0.17
Silico67144,664,4533.7416.43−0.19
Silico68144,808,6192.6411.89−0.17
Silico69144,901,3292.9313.11−0.17
SNP331146,776,6874.7420.34−0.21
1 LOD: LOD score calculated from single marker analysis. 2 PVE: Phenotypic variation explained by the marker. 3 Add: Estimated additive effect of the marker.
Table 3. Genes with known defense and unknown functions discovered in the new QTL RA80f6_r1 region.
Table 3. Genes with known defense and unknown functions discovered in the new QTL RA80f6_r1 region.
GenePhysical Position (bp) 1Gene Function 2
LYM227,166,666–27,169,869Involved in defense response as chitin-binding protein.
ERF31,226,500–31,227,246Transcriptional activator that may involve in disease resistance pathways.
HP59633,798,986–33,799,247Unknown.
HP59734,375,190–34,380,266Unknown.
CLF34,927,068–34,936,068Involved in chromosome silencing, histone methylation, regulation of gene expression by genetic imprinting, cell differentiation, etc.
HP60134,997,949–35,013,770Unknown.
ARF2336,381,979–36,386,588Transcriptional activator that may involve in disease resistance pathways.
NFXL136,512,044–36,515,448Promotes H2O2 production, defense response to bacterium, response to microbial phytotoxin, response to salt stress, salicylic acid biosynthetic process, etc.
PR-1440,270,316–40,270,594Transfer lipids across membranes. May play a role in plant defense or in the biosynthesis of cuticle layers.
1 Data from genome annotation of Capsicum baccatum ‘PBC81’ genome reference [22], National Center for Biotechnology Information “https://www.ncbi.nlm.nih.gov/genome/?term=capsicum+baccatum (accessed on 15 August 2022)”. 2 Information from UniProt “https://www.uniprot.org (accessed on 16 August 2022)”.
Table 4. Anthracnose severity scores on mature green and ripe fruit of the 29 RILs.
Table 4. Anthracnose severity scores on mature green and ripe fruit of the 29 RILs.
RIL CodeAnthracnose Severity Score (0–9)
Mature GreenRipe
G1-01713000
G1-01713505
G1-01714750
G1-01723355
G1-01725755
G1-01726153
G1-01726455
G1-01726757
G1-01732515
G1-01733950
G1-01739655
G1-01739900
G1-01741530
G1-01741630
G1-01742500
G1-01743151
G1-01743305
G1-01747301
G1-01753111
G1-01753950
G1-01754053
G1-01754155
G1-01754450
G1-01757930
G1-01758855
G1-01759355
G1-01762350
G1-01767955
G1-01784500
Table 5. Relative expression levels (means + SD) of the six up-regulated genes in the R/R and S/S chili genotypes at 6 and 12 h post fruit inoculation with water and MJ5.
Table 5. Relative expression levels (means + SD) of the six up-regulated genes in the R/R and S/S chili genotypes at 6 and 12 h post fruit inoculation with water and MJ5.
Genotype + InoculationLYM2ERF
6 h12 h6 h12 h
RR + water2.99 ± 0.28 bx1.47 ± 0.22 cy3.74 ± 0.51 cy4.98 ± 0.40 bx
RR + MJ54.53 ± 0.35 ax2.80 ± 0.44 by4.05 ± 0.33 bcy6.43 ± 0.71 ax
SS + water1.03 ± 0.26 cdx0.24 ± 0.10 ey2.03 ± 0.18 dex1.30 ± 0.10 efx
SS + MJ50.75 ± 0.16 dex0.67 ± 0.19 dex2.25 ± 0.42 dex2.30 ± 0.24 dx
Genotype + inoculationHP597CLF
6 h12 h6 h12 h
RR + water3.47 ± 0.30 ax1.62 ± 0.20 by1.52 ± 0.29 ax0.92 ± 0.23 cdy
RR + MJ53.70 ± 0.19 ax1.75 ± 0.20 by1.80 ± 0.17 ax1.43 ± 0.28 bcx
SS + water1.83 ± 0.24 bx0.58 ± 0.15 dy0.8 ± 0.11 cdx0.52 ± 0.12 dx
SS + MJ51.34 ± 0.29 bcx1.36 ± 0.16 bcx0.75 ± 0.06 cdx0.71 ± 0.15 cdx
Genotype + inoculationNFXL1PR-14
6 h12 h6 h12 h
RR + water2.25 ± 0.42 ax0.77 ± 0.07 cy2.68 ± 0.82 ax1.23 ± 0.06 by
RR + MJ52.31 ± 0.46 ax1.58 ± 0.42 abx2.98 ± 0.69 ax1.33 ± 0.28 by
SS + water0.62 ± 0.13 cx0.26 ± 0.04 cx1.02 ± 0.25 bx0.37 ± 0.04 bx
SS + MJ50.70 ± 0.22 cx0.40 ± 0.10 cx1.09 ± 0.04 bx0.68 ± 0.13 bx
Means followed by the same superscript letter (abcdef) within a column or the same subscript letter (xy) within a row of the same gene are not significantly different (p > 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kethom, W.; Taylor, P.W.J.; Mongkolporn, O. Expression of Genes Involved in Anthracnose Resistance in Chili (Capsicum baccatum) ‘PBC80’-Derived Recombinant Inbred Lines. Pathogens 2023, 12, 1306. https://doi.org/10.3390/pathogens12111306

AMA Style

Kethom W, Taylor PWJ, Mongkolporn O. Expression of Genes Involved in Anthracnose Resistance in Chili (Capsicum baccatum) ‘PBC80’-Derived Recombinant Inbred Lines. Pathogens. 2023; 12(11):1306. https://doi.org/10.3390/pathogens12111306

Chicago/Turabian Style

Kethom, Wassana, Paul W. J. Taylor, and Orarat Mongkolporn. 2023. "Expression of Genes Involved in Anthracnose Resistance in Chili (Capsicum baccatum) ‘PBC80’-Derived Recombinant Inbred Lines" Pathogens 12, no. 11: 1306. https://doi.org/10.3390/pathogens12111306

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop