Nested PCR-Based Rapid Detection of Phytoplasma Leaf Wilt Disease of Coconut in Sri Lanka and Systemic Movement of the Pathogen
Abstract
:1. Introduction
2. Materials and Methods
2.1. Pathogen Detection Using Nested PCR
2.2. Assessment of Tissue Types for Pathogen Screening
2.3. Screening for Other Fastidious Prokaryotes
2.4. Pathogen Movement within Palms and the Latent Period
3. Results
3.1. Pathogen Detection Using Nested PCR
3.2. Selection of a Tissue Type for Pathogen Detection
3.3. Pathogen Movement within Palms and the Latent Period
3.4. Screening for Other Fastidious Prokaryotes
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Doi, Y.; Teranaka, M.; Yora, K.; Asuyama, H. Mycoplasma- or PLT Group-like Microorganisms Found in the Phloem Elements of Plants Infected with Mulberry Dwarf, Potato Witches’ Broom, Aster Yellows, or Paulownia Witches’ Broom. Jpn. J. Phytopathol. 1967, 33, 259–266. [Google Scholar] [CrossRef]
- Palmano, S.A. Comparison of different phytoplasma DNA extraction methods using competitive PCR. Phytopathol. Mediterr. 2001, 40, 99–107. [Google Scholar] [CrossRef]
- IPPC. Diagnostic protocols for regulated pests. Int. Stand. Phytosanit. Meas. 2016, 27, 1–12. [Google Scholar]
- Harrison, N.A.; Elliott, M.L. Lethal Yellowing of Palms. In Plant Health; CABI: Wallingford, UK, 2008. [Google Scholar] [CrossRef]
- Myrie, W.; Yankey, E.N.; Pilet, F.; Dickinson, M.; Oropeza, C.; Bertaccini, A. Overview of lethal yellowing disease in the world. Phytopathog. Mollicutes 2022, 12, 66. [Google Scholar] [CrossRef]
- Seemüller, E.; Marcone, C.; Lauer, U.; Ragozzino, A.; Göschl, M. Current status of molecular classification of the phytoplasmas. J. Plant Pathol. 1998, 80, 3–26. [Google Scholar] [CrossRef]
- Perera, L.; Meegahakumbura, M.K.; Wijesekara, H.T.R.; Fernando, W.B.S.; Dickinson, M. A phytoplasma is associated with the Weligama coconut leaf wilt disease in Sri Lanka. J. Plant Pathol. 2012, 94, 205–209. [Google Scholar]
- Kumara, A.D.N.T.; Perera, L.; Meegahakumbura, M.K.; Aratchige, N.S.; Fernando, L.C.P. Identification of putative vectors of Weligama coconut leaf wilt disease in Sri Lanka. In New Horizons in Insect Science: Towards Sustainable Pest Management; Springer: Berlin/Heidelberg, Germany, 2015; pp. 137–146. [Google Scholar]
- De Silva, P.H.P.R.; Aratchige, N.S.; Ranasinghe, C.S.; Kantha, A.A.F.L. Diseased palm removals as a strategy for the successful management of Weligama coconut leaf wilt phytoplasma disease of coconut in SriLanka. Phytopathog. Mollicutes 2021, 11, 79–85. [Google Scholar] [CrossRef]
- Gundersen, D.E.; Lee, M.I. Ultrasensitive detection of phytoplasmas by nested PCR using two universal primers. Phytopathol. Mediterr. 1996, 35, 144–151. [Google Scholar]
- Lorenz, K.H.; Schneider, B.; Ahrens, U.; Seemuller, E. Detection of the apple Proliferation and Pear Decline Phytoplasmas by PCR Amplification of Ribosomal and Nonribosomal DNA. Phytopathology 1995, 85, 771–776. [Google Scholar] [CrossRef]
- Deng, S.; Hiruki, C. Amplification of 16S rRNA genes from culturable and non-culturable mollicutes. J. Microbiol. Methods 1991, 14, 53–61. [Google Scholar] [CrossRef]
- Smart, C.D.; Schneider, B.; Blomquist, Ç.L.; Guerra, L.J.; Harrison, N.A.; Ahrens, U.; Lorenz, E.; Seemüller, K.H.; Kirkpatrick, B.C. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region. Appl. Environ. Microbiol. 1996, 62, 2988–2993. [Google Scholar] [CrossRef] [PubMed]
- Christensen, N.M.; Nicolaisen, M.; Hansen, M.; Schulz, A. Distribution of phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Mol. Plant-Microbe Interact. 2004, 17, 1175–1184. [Google Scholar] [CrossRef] [Green Version]
- Skrzeczkowski, L.J.; Howell, W.E.; Eastwell, K.C.; Cavileer, T.D. Bacterial sequences interfering in detection of phytoplasma by PCR using primers derived from the Ribosomal RNA Operon. Acta Hortic. 2001, 550, 417–424. [Google Scholar] [CrossRef]
- Kanatiwela-de Silva, C.; Damayanthi, M.; de Silva, N.; Wijesekera, R.; Dickinson, M.; Weerakoon, D.; Udagama, P. Immunological detection of the Weligama coconut leaf wilt disease associated phytoplasma: Development and validation of a polyclonal antibody based indirect ELISA. PLoS ONE 2019, 14, e0214983. [Google Scholar] [CrossRef] [PubMed]
- Wijesekara, H.T.R.; Perera, S.A.C.N.; Bandupriya, D.; Meegahakumbura, M.K.; Perera, L. Detection of Weligama Coconut Leaf Wilt Disease Phytoplasma by Real-Time Polymerase Chain Reaction. Cord 2020, 36, 11–15. [Google Scholar] [CrossRef]
- Christensen, N.M.; Axelsen, K.B.; Nicolaisen, M.; Schulz, A. Phytoplasmas and their interactions with hosts. Trends Plant Sci. 2005, 10, 526–535. [Google Scholar] [CrossRef] [PubMed]
- Bonnot, F.; De Franqueville, H.; Lourença, E. Spatial and spatiotemporal pattern analysis of coconut lethal yellowing in Mozambique. Phytopathology 2010, 100, 300–312. [Google Scholar] [CrossRef]
- Ramjegathesh, R.; Karthikeyan, G.; Rajendran, L.; Johnson, I.; Raguchander, T.; Samiyappan, R. Root (wilt) disease of coconut palms in South Asia-an overview. Arch. Phytopathol. Plant Prot. 2012, 45, 2485–2493. [Google Scholar] [CrossRef]
- Bahder, B.W.; Soto, N.; Mou, D.F.; Humphries, A.R.; Helmick, E.E. Quantification and distribution of the 16SrIV-D phytoplasma in the wild date palm, Phoenix sylvestris, at different stages of decline using quantitative PCR (qPCR) Analysis. Plant Dis. 2020, 104, 1328–1334. [Google Scholar] [CrossRef]
- Ariyarathna, H.A.C.K.; Everard, J.M.D.T.; Karunanayake, E.H. Diseased sugarcane in Sri Lanka is infected with sugarcane grassy shoot and/or sugarcane white leaf phytoplasma. Australas. Plant Dis. Notes 2007, 2, 123. [Google Scholar] [CrossRef]
- Doyle, J.J.; Doyle, J. Doyle & Doyle Focus 1990 CTAB.pdf. Focus 1990, 12, 13–15. [Google Scholar]
- Manimekalai, R.; Soumya, V.P.; Sathish Kumar, R.; Selvarajan, R.; Reddy, K.; Thomas, G.V.; Baranwal, V.K. Molecular detection of 16SrXI group phytoplasma associated with root (wilt) disease of coconut (Cocos nucifera) in India. Plant Dis. 2010, 94, 636. [Google Scholar] [CrossRef]
- Bahder, B.W.; Helmick, E.E.; Chakrabarti, S.; Osorio, S.; Soto, N.; Chouvenc, T.; Harrison, N.A. Disease progression of a lethal decline caused by the 16SrIV-D phytoplasma in Florida palms. Plant Pathol. 2018, 67, 1821–1828. [Google Scholar] [CrossRef]
- Babu, M.; Thangeswari, S.; Josephrajkumar, A.; Krishnakumar, V.; Karthikeyan, A.; Selvamani, V.; Karun, A. First report on the association of ‘Candidatus Phytoplasma asteris’ with lethal wilt disease of coconut (Cocos nucifera L.) in India. J. Gen. Plant Pathol. 2021, 87, 16–23. [Google Scholar] [CrossRef]
- Nejat, N.; Sijam, K.; Abdullah, S.N.A.; Vadamalai, G.; Dickinson, M. Phytoplasmas associated with disease of coconut in Malaysia: Phylogenetic groups and host plant species. Plant Pathol. 2009, 58, 1152–1160. [Google Scholar] [CrossRef]
- Pilet, F.; Rakotoarisoa, E.; Rakotomalala, M.; Sisteron, S.; Razakamanana, H.N.; Rabemiafara, L. First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the Western coast of Madagascar. Plant Dis. 2021, 105, 4146. [Google Scholar] [CrossRef]
- Namba, S.; Oyaizu, H.; Kato, S.; Iwanami, S.; Tsuchizaki, T. Phylogenetic diversity of phytopathogenic mycoplasma like organisms. Int. J. Syst. Evol. Microbiol. 1993, 43, 461–467. [Google Scholar]
- Dayasena, Y.A.P.K.; Panda, P.; Thushari, A.N.W.S.; Rao, G.P. Geographical Distribution and Identification of Phytoplasma Strain Associated with Sugarcane White Leaf Disease in Sri Lanka. Sugar Tech. 2021, 23, 1351–1358. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. In Nucleic Acids Symposium Series; Information Retrieval Ltd.: London, UK, 1999; Volume 41, pp. 95–98. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar]
- Urasaki, N.; Kawano, S.; Mukai, H.; Uemori, T.; Takeda, O.; Sano, T. Rapid and sensitive detection of “Candidatus Liberibacter asiaticus” by cycleave isothermal and chimeric primer-initiated amplification of nucleic acids. J. Gen. Plant Pathol. 2008, 74, 151–155. [Google Scholar] [CrossRef]
- Yokomi, R.K.; Mello, A.F.S.; Saponari, M.; Fletcher, J. Polymerase chain reaction-based detection of Spiroplasma citri associated with citrus stubborn disease. Plant Dis. 2008, 92, 253–260. [Google Scholar] [CrossRef]
- Foissac, X.; Danet, J.L.; Zreik, L.; Gandar, J.; Nourrisseau, J.G.; Bove, J.M.; Garnier, M. Cloning of the spoT gene of “Candidatus Phlomobacter fragariae” and development of a PCR-restriction fragment length polymorphism assay for detection of the bacterium in insects. Appl. Environ. Microbiol. 2000, 66, 3474–3480. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.B.; Grisham, M.P.; Burner, D.M.; Damann, K.E.; Wei, Q. A polymerase chain reaction protocol for the detection of Clavibacter xyli subsp. xyli, the causal bacterium of sugarcane ratoon stunting disease. Plant Dis. 1998, 82, 285–290. [Google Scholar] [CrossRef]
- Francis, M.; Lin, H.; Rosa, J.C.; La Doddapaneni, H.; Civerolo, E.L. Genome-based PCR primers for specific and sensitive detection and quantification of Xylella fastidiosa. Eur. J. Plant Pathol. 2006, 115, 203–213. [Google Scholar] [CrossRef]
- Pilet, F.; Quaicoe, R.N.; Osagie, I.J.; Freire, M.; Foissac, X. Multilocus sequence analysis reveals three distinct populations of “Candidatus Phytoplasma palmicola” with a specific geographical distribution on the African continent. Appl. Environ. Microbiol. 2019, 85, e02716-18. [Google Scholar] [CrossRef]
- Seemüller, E.R.; Schneider, B.; Mäurer, R.; Ahrens, U.; Daire, X.; Kison, H.; Lorenz, K.H.; Firrao, G.; Avinent, L.; Sears, B.B.; et al. Phylogenetic classification of phytopathogenic mollicutes by sequence analysis of 16S ribosomal DNA. Int. J. Syst. Evol. Microbiol. 1994, 44, 440–446. [Google Scholar] [CrossRef] [Green Version]
Primers for the First PCR (Reference) | Primers for the Nested PCR (Reference) | Annealing Temperatures for Both PCR Cycles | |
---|---|---|---|
1 | P1/Tint [13] | fU5/rU3 [11] | 56 °C for both cycles |
2 | R16F2n/R16r2 [10] | 56 °C and 60 °C | |
3 | P1694/Pc399 [15] | 56 °C and 60 °C | |
4 | P1/P7 [13] | fU5/rU3 [11] | 50 °C and 56 °C |
5 | R16F2n/R16r2 [10] | 50 °C and 60 °C | |
6 | P1694/Pc399 [15] | 50 °C and 60 °C |
Accession Number | Host Plant | Reference |
---|---|---|
GQ850122.1 | Coconut | [24] |
EU635503.1 | Coconut | [7] |
HF571986.2 | Sugarcane | Unpublished |
MT360451.1 | Sugarcane | Unpublished |
MT649298.1 | Sugarcane | Unpublished |
AF498307.1 | Coconut | Unpublished |
AF434989.1 | Date palm | [25] |
MG993138 | Queen palm | [25] |
MG993148 | Cabbage palm | [25] |
MG243700.1 | Date palm | Unpublished |
AF498309.1 | Coconut | Unpublished |
JX681021.1 | Oil palm | Unpublished |
KY814724.1 | Coconut | [26] |
MK617534.1 | Coconut | [26] |
MK992774.1 | Coconut | Unpublished |
JX273772.1 | Coconut | [26] |
KF993431.1 | Coconut | Unpublished |
EU328159.1 | Coconut | [27] |
EU636906.1 | Coconut | [27] |
KF419286.1 | Coconut | Unpublished |
JQ868442.1 | Coconut | Unpublished |
Y14175.1 | Coconut | Unpublished |
X80117.1 | Coconut | [28] |
GU952098.1 | Coconut | Unpublished |
LC228755.1 | Coconut | Unpublished |
KP064103.1 | Coconut | Unpublished |
DQ645636.1 | Coconut | Unpublished |
HQ613874.1 | Coconut | Unpublished |
D12581.2 | Mulberry | [29] |
MT862368.1 | Sugarcane | [30] |
MT860714.1 | Sugarcane | [30] |
MT860721.1 | Sugarcane | [30] |
CR1 (MZ822450) | Coconut | Current study |
CR2 (MZ822449) | Coconut | Current study |
CR3 (MZ822431) | Coconut | Current study |
CR4 (MZ822432) | Coconut | Current study |
CR5 (MZ822428) | Coconut | Current study |
CR6 (MZ822430) | Coconut | Current study |
CR7 (MZ822429) | Coconut | Current study |
CR8 (OP279594) | Sugarcane | Current study |
CR9 (OP279485) | Coconut | Current study |
CR10 (OP279647) | Coconut | Current study |
CR11 (OP279533) | Coconut | Current study |
Primer Name | Sequence | Annealing Temperature | Target Organism | Reference |
---|---|---|---|---|
OI1 | 5′- GCGCGTATGCAATAC GAGCGGCA-3′ | 54 °C | Liberibacter | [34] |
OI2c | 5′-GCCTCGCGACTTCGCA ACCCAT-3′ | |||
P89-f | 5′ATTGACTCAACAAACGGGATAA3′ | 56 °C | Spiroplasma | [35] |
P89-r | 5′CGGCGTTTGTTTGTTAATTTTTGGTA3′ | |||
Pfr1 | 5′-AATGGGTGTCGCTGCC ATT-3′ | 60 °C | Phlomobacter | [36] |
Pfr4 | 5′-AGCAATGAAATTGTTA TTAACGC-3′ | |||
Cxx1 | 5′ CCGAAGTGAGCAGAT TGACC 3′ | 57 °C | Clavibacter | [37] |
Cxx2 | 5′ ACCCTGTGTTGTTTTC AACG 3′ | |||
HL5 | 5′-AAGGCAATAAACGCG CACTA3′ | 60 °C | Xylella | [38] |
HL6 | 5′-GGTTTTGCTGACTGGC AACA-3′ |
Sample Type | Tissue Type | Number of Samples | Number of Positive Samples | PCR Positivity Rate |
---|---|---|---|---|
WCLWD-symptomatic coconut palms | Bud leaves | 12 | 9 | 75% |
Young inflorescence | 12 | 3 | 25% | |
Roots | 12 | 5 | 41% | |
Stem borings | 12 | 0 | 0% | |
Asymptomatic coconut palms from a WCWLD-prevalent area | Bud leaves | 12 | 9 | 75% |
Young inflorescence | 12 | 2 | 16% | |
Roots | 12 | 5 | 41% | |
Stem borings | 12 | 0 | 0% | |
Healthy coconut palms from a WCLWD-free area | Bud leaves | 6 | 0 | 0% |
Young inflorescence | 6 | 0 | 0% | |
Roots | 6 | 0 | 0% | |
Stem borings | 6 | 0 | 0% |
Tissue Type | Number of Samples (at t = 0) | PCR+ Samples at t = 0 (%) | Number of Samples (at t = 12 Months) | PCR+ Samples (at t = 12 Months) (%) |
---|---|---|---|---|
Bud leaves | 6 | 5 (83%) | 6 | 6 (100%) |
Inflorescence Stem borings | 6 6 | 0 (0%) 0 (0%) | 6 6 | 2 (33%) 0 (0%) |
Roots | 6 | 0 (0%) | 6 | 1 (17%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
De Silva, P.R.; Perera, C.N.; Bahder, B.W.; Attanayake, R.N. Nested PCR-Based Rapid Detection of Phytoplasma Leaf Wilt Disease of Coconut in Sri Lanka and Systemic Movement of the Pathogen. Pathogens 2023, 12, 294. https://doi.org/10.3390/pathogens12020294
De Silva PR, Perera CN, Bahder BW, Attanayake RN. Nested PCR-Based Rapid Detection of Phytoplasma Leaf Wilt Disease of Coconut in Sri Lanka and Systemic Movement of the Pathogen. Pathogens. 2023; 12(2):294. https://doi.org/10.3390/pathogens12020294
Chicago/Turabian StyleDe Silva, Prasad R., Chandrika N. Perera, Brian W. Bahder, and Renuka N. Attanayake. 2023. "Nested PCR-Based Rapid Detection of Phytoplasma Leaf Wilt Disease of Coconut in Sri Lanka and Systemic Movement of the Pathogen" Pathogens 12, no. 2: 294. https://doi.org/10.3390/pathogens12020294