Next Article in Journal
Wildlife, Reservoir of Zoonotic Agents: Moving beyond Denial and Fear
Next Article in Special Issue
History and Current Status of Mediterranean Spotted Fever (MSF) in the Crimean Peninsula and Neighboring Regions along the Black Sea Coast
Previous Article in Journal
Mpox Outbreak 2022: A Comparative Analysis of the Characteristics of Individuals Receiving MVA-BN Vaccination and People Diagnosed with Mpox Infection in Milan, Italy
Previous Article in Special Issue
High Prevalence of Rickettsia raoultii Found in Dermacentor Ticks Collected in Barnaul, Altai Krai, Western Siberia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 12
Issue 9
10.3390/pathogens12091080
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts

by
Shehla Shehla
1,
Farman Ullah
1,
Abdulaziz Alouffi
2,
Mashal M. Almutairi
3,
Zaibullah Khan
1,
Tetsuya Tanaka
4,
Marcelo B. Labruna
5,
Kun-Hsien Tsai
6,* and
Abid Ali
1,*
1
Department of Zoology, Abdul Wali Khan University Mardan, Mardan 23200, Pakistan
2
King Abdulaziz City for Science and Technology, Riyadh 12354, Saudi Arabia
3
Department of Pharmacology and Toxicology, College of Pharmacy, King Saud University, Riyadh 11451, Saudi Arabia
4
Laboratory of Infectious Diseases, Joint Faculty of Veterinary Medicine, Kagoshima University, Kagoshima 890-0065, Japan
5
Department of Preventive Veterinary Medicine and Animal Health, Faculty of Veterinary Medicine, University of São Paulo, São Paulo 05508-060, Brazil
6
Institute of Environmental and Occupational Health Sciences, Department of Public Health, College of Public Health, National Taiwan University, Taipei 100025, Taiwan
*
Authors to whom correspondence should be addressed.
Pathogens 2023, 12(9), 1080; https://doi.org/10.3390/pathogens12091080
Submission received: 26 June 2023 / Revised: 4 August 2023 / Accepted: 22 August 2023 / Published: 24 August 2023
(This article belongs to the Special Issue Advances in Spotted Fever)
Browse Figures
Review Reports Versions Notes

Abstract

:
Ixodid ticks are responsible for the transmission of various intracellular bacteria, such as the Rickettsia species. Little Information is available about the genetic characterization and epidemiology of Rickettsia spp. The current study was designed to assess the tick species infesting various livestock hosts and the associated Rickettsia spp. in Pakistan. Ticks were collected from different livestock hosts (equids, cattle, buffaloes, sheep, goats, and camels); morphologically identified; and screened for the genetic characterization of Rickettsia spp. by the amplification of partial fragments of the gltA, ompA and ompB genes. Altogether, 707 ticks were collected from 373 infested hosts out of 575 observed hosts. The infested hosts comprised 105 cattle, 71 buffaloes, 70 sheep, 60 goats, 34 camels, and 33 equids. The overall occurrence of Rickettsia spp. was 7.6% (25/330) in the tested ticks. Rickettsia DNA was detected in Rhipicephalus haemaphysaloides (9/50, 18.0%), followed by Rhipicephalus turanicus (13/99, 13.1%), Haemaphysalis cornupunctata (1/18, 5.5%), and Rhipicephalus microplus (2/49, 4.1%); however, no rickettsial DNA was detected in Hyalomma anatolicum (71), Hyalomma dromedarii (35), and Haemaphysalis sulcata (8). Two Rickettsia agents were identified based on partial gltA, ompA, and ompB DNA sequences. The Rickettsia species detected in Rh. haemaphysaloides, Rh. turanicus, and Rh. microplus showed 99–100% identity with Rickettsia sp. and Candidatus Rickettsia shennongii, and in the phylogenetic trees clustered with the corresponding Rickettsia spp. The Rickettsia species detected in Rh. haemaphysaloides, Rh. turanicus, Rh. microplus, and Ha. cornupunctata showed 100% identity with R. massiliae, and in the phylogenetic trees it was clustered with the same species. Candidatus R. shennongii was characterized for the first time in Rh. haemaphysaloides, Rh. turanicus, and Rh. microplus. The presence of SFG Rickettsia spp., including the human pathogen R. massiliae, indicates a zoonotic risk in the study region, thus stressing the need for regular surveillance.

1. Introduction

Ticks (Acari, Parasitiformes, Ixodida) are blood-feeding ectoparasites found in all ecoregions of the world [1]. They are known for transmitting different pathogens, including viruses, protozoans, and bacteria, that pose significant threats to human and animal health [2,3]. Among tick-borne pathogens, species of the bacterial genera Anaplasma, Ehrlichia, and Rickettsia, as well as protozoans of the genera Babesia and Theileria, cause infection in small ruminants and bovines [4,5], which may lead to significant economic losses. These pathogens also cause infections in humans in many regions [6,7,8]. In addition, many tick-borne Rickettsia spp. play a relevant public role by causing spotted fever illness in different parts of the world [4].
There have been significant advances in our knowledge of the diversity and distribution of Rickettsiae in many parts of world [4,9]. Recently, the characterization of novel Rickettsia spp. based on reliable genetic markers revealed broad diversity at the species level [9,10]. Currently, the genus Rickettsia encompasses 34 recognized species plus several unidentified strains [11]. These species are divided into five main monophyletic groups: the spotted fever group (SFG), the transitional group, the typhus group, the canadensis group, and the bellii group [11]. Species belonging to these groups differ in terms of several traits related to their ecology, distribution, hosts, and pathogenicity [4]. The SFG is highly diverse and a subject of intensive study [9], encompassing the largest number of tick-borne pathogens, including Rickettsia africae, Rickettsia conorii, Rickettsia honei, Rickettsia japonica, Rickettsia massiliae, Rickettsia monacensis, Rickettsia parkeri, Rickettsia rickettsii, Rickettsia sibirica, and Rickettsia slovaca [12].
Rickettsia massiliae was first reported in Rhipicephalus sanguineus ticks infesting dogs from France [13]. Since then, the agent has been detected in different tick species, including Rhipicephalus microplus, Rhipicephalus turanicus, Rhipicephalus haemaphysaloides, Rh. sanguineus, Rhipicephalus lunulatus, Rhipicephalus pusillus, Rhipicephalus bursa, Rhipicephalus sulcatus, Rhipicephalus muhsamae, Haemaphysalis punctata, Haemaphysalis erinacei, Haemaphysalis parva, Haemaphysalis adleri, Haemaphysalis sulcata, Dermacentor marginatus, Ixodes ricinus, and Hyalomma anatolicum in several countries of Africa, Europe, and the Middle East [2,3,4,14,15]. There have also been some reports of R. massiliae in Rh. sanguineus sensu lato (s.l.) in the New World [4,16,17,18]. Furthermore, R. massiliae has been molecularly characterized in Ha. bispinosa, Rh. sanguineus, and Rh. turanicus ticks in India, Iran, and China, respectively [19,20,21].
Pakistan has a great variety of landscapes and habitats, maintaining a broad range of vertebrate species which serve as hosts for diverse tick species and reservoirs for different types of pathogens, particularly Rickettsia spp. [3,22,23,24,25,26,27,28]. Earlier, serological methods were used to detect the exposure of humans to rickettsial infection in Pakistan [29], but antigen conservation among different species makes it difficult to accurately identify and explore the existing and novel diversity of Rickettsia spp. [5]. In Pakistan, few molecular studies have been conducted for the detection and characterization of Rickettsia spp. [5,30], although there have been recent records of R. massiliae in Hy. anatolicum, Hyalomma hussaini, Rh. haemaphysaloides, Rh. turanicus, and Rh. microplus ticks [2,3,8]. Indeed, currently available data regarding the existing of several unidentified Rickettsia spp. in Pakistan are scarce, as the available records have been confined to small sampling areas and limited host ranges, and based on only one or two genetic markers. Therefore, the present study aimed to use three suitable genetic markers (gltA, ompA, and ompB) for the identification and genetic characterization of Rickettsia spp. in ticks infesting diverse hosts in different agro-ecological zones of Pakistan.

2. Materials and Methods

2.1. Study Area

Tick specimens were collected in the following 13 districts of Khyber Pakhtunkhwa (KP) province, Pakistan: Charsadda (34.161297° N, 71.753660° E), Bajaur (34.7865° N, 71.5249° E), Swabi (34.1241° N, 72.4613° E), Mardan (34.194697° N, 72.050557° E), Peshawar (34.039825° N, 71.566832° E), Bannu (32.9298° N, 70.6693° E), Lower Dir (34.9161° N, 71.8097° E), Malakand (34.5030° N, 71.9046° E), Lakki Marwat (32.6135° N, 70.9012° E), Nowshera (34.0105° N, 71.9876° E), Mohmand (34.5356° N, 71.2874° E), Swat (34.8065° N, 72.3548° E), and Buner (34.3943° N, 72.6151° E). The KP province has suitable environmental conditions for different ticks and tick-borne pathogens because of its desertic, humid, and arid plains and the arid and humid hilly areas that vary in climate, altitude, and seasons (winter, spring, summer, and fall). The average temperatures of the selected districts of KP province range from 33.4 °C in the summer to 10.4 °C in the winter (climate-data.org, accessed on 7 April 2023). These areas are characterized by an abundance of free-roaming hosts infested with ticks and close coexistence of humans and animals. To design a map, the geographic coordinates of all collection sites were obtained using a Global Positioning System, imported into a Microsoft Excel sheet, and processed using ArcGIS V. 10.3.1 (ESRI, Redlands, CA, USA) (Figure 1).

2.2. Tick Sampling and Identification

All of the ticks (males, females, and nymphs) were conveniently collected during July 2019 to October 2020 from different livestock hosts (equids, cattle, buffaloes, sheep, goats, and camels) in the 13 districts. Ticks were collected from the aforementioned hosts whenever they were found, irrespective of specific location within the targeted survey regions and the time, in various farms, open fields, and freely moving animals in pastures. Collection was carried out once from each host when found to be infested with ticks. By examining the entire body of each host, 1–8 attached ticks per animal were collected using tweezers. Immediately after collection, the ticks were washed with distilled water followed by 70% ethanol and stored in properly labeled tubes containing 100% ethanol. Collected ticks were morphologically identified under a stereo zoom microscope (SZ61, Olympus, Tokyo, Japan) using standard taxonomic keys [31,32,33,34].

2.3. DNA Extraction and PCR

The collected ticks were individually subjected to DNA extraction using the standard phenol chloroform method [35]. The genomic DNA was extracted from 330 selected ticks (118 nymphs, 95 males, and 117 females). The extracted DNA was quantified via NanoDrop (NanoQ, Optizen, Daejeon, Republic of Korea). The pellet was hydrated with nuclease-free water. A conventional PCR (GE-96G, BIOER, Hangzhou, China) was performed to amplify partial fragments of the rickettsial citrate synthase (gltA), 190-kDa outer membrane protein (ompA), and 120-kDa outer membrane protein (ompB) genes (Table 1). PCR assays were performed in a 20 µL reaction volume containing 12 µL PCR master mix (Thermo fisher scientific, Inc.; Waltham, MA, USA), 1 µL of each forward and reverse primer (10 µM), 2 µL of genomic DNA (50–100 ng), and 4 µL of PCR water. The thermo-cycling conditions for the amplification of the gltA, ompA, and ompB genes were used as described previously [36,37,38]. Rickettsia aeschlimannii DNA and nuclease-free water were used as positive and negative controls, respectively. The PCR products were run on 1.5% agarose gel prepared in tris borate EDTA (TBE) containing 2 µL ethidium bromide at a concentration of 0.2–0.5 μg/mL for staining purposes. The amplified DNA fragments were observed by means of gel documentation (BioDoc-It™ Imaging Systems UVP, LLC, Upland, CA, USA).

2.4. DNA Sequencing and Phylogenetic Analysis

All of the PCR-amplified products for the gltA, ompA, and ompB genes were submitted for bidirectional sequencing (Macrogen, Inc., Seoul, Republic of Korea). The obtained sequences were trimmed to remove the poor reading sequences through SeqMan v. 5 (DNASTAR, Inc.; Madison, WI, USA), and additionally to generate partial sequences for gltA, ompA, and ompB genes. The obtained sequences were submitted to BLAST (Basic Local Alignment Search Tool) [39] at NCBI (National Center for Biotechnology Information). For the construction of phylogenetic trees, Rickettsia spp. sequences were retrieved from GenBank and aligned with the obtained sequences using the BioEdit Sequence Alignment Editor v. 7.0.5 [40]. Individual phylogenetic trees based on the gltA, ompA, and ompB fragments were constructed in MEGA-X [41] using the maximum likelihood method and the Tamura–Nei model [42]. All the available methods were tested, being found similar results. However, the maximum likelihood is a recommended and accurate method for the best evolutionary analysis, due to its ability to evaluate different phylogenetic trees and models under a statistical framework [43]. Moreover, the topology of Rickettsia spp. in this MS was in accordance to Karkouri et al. [11]. Bootstrap resampling analysis (1000 replicates) was used to assess the statistical significance of the nodes. The final positions in the dataset comprised the obtained gltA, ompA, and ompB fragments.

3. Results

3.1. Occurrence of Morphologically Identified Ticks

Overall, 707 ticks were collected from 373 (64.9%) out of 575 examined livestock hosts. The tick-infested animals consisted of 105 cattle, 71 buffaloes, 70 sheep, 60 goats, 34 camels, and 33 equids. The highest number of infestation rates of the different hosts was recorded in the of district Nowshera (29/35, 82.9%), followed by Buner (33/40, 82.5%), Swabi (32/39, 82.1%), Swat (29/39, 74.3%), Bajaur (20/27, 74.1%), Lakki Marwat (28/39, 71.8%), Lower Dir (26/39, 66.7%), Peshawar (35/58, 60.3%), Bannu (21/35, 60.0%), Mohmand (23/39, 58.9%), Mardan (29/52, 55.7%), Charsadda (49/89, 55.0%), and Malakand (19/44, 43.1%). The highest occurrence of ticks was recorded in the district of Charsadda (91/707, 12.9%) followed by Peshawar (73/707, 10.3%), Mardan (70/707, 9.9%), Lakki Marwat (62/707, 8.8%), Swabi (57/707, 8.06%), Nowshera (57/707, 8.1%), Bajaur (53/707, 7.5%), Buner (53/707, 7.5%), Swat (49/707, 6.9%), Bannu (42/707, 5.9%), Mohmand (37/707, 5.2%), Lower Dir (34/707, 4.8%), and Malakand (29/707, 4%). Based on morphological analyses, seven tick species belonging to three genera (Rhipicephalus, Haemaphysalis, and Hyalomma) were identified. Overall, the highest occurrence was observed for Rh. microplus (179/707, 25.3%), followed by Rh. turanicus (163/707, 23.1%), Hy. anatolicum (135/707, 19.09%), Rh. haemaphysaloides (119/707, 16.8%), Hyalomma dromedarii (74/707, 10.5%), Haemaphysalis cornupunctata (28/707, 3.9%), and Ha. sulcata (9/707, 1.3%). Among the 707 collected ticks, 320 (45.3%) were females, 219 (30.9%) were nymphs, and 168 (23.8%) were males.

3.2. Detection of Rickettsia spp. in Ticks

Table 2 describes the results of molecular analyses of 330 ticks (118 nymphs, 95 males, and 117 females) collected from different hosts in different locations, which were individually subjected to amplification of fragments of each of the rickettsial genes gltA, ompA, and ompB. The overall occurrence of Rickettsia spp. based on gltA, ompA, and ompB genes was 7.6% (25/330) of the tested ticks. Rickettsia spp. were detected in four tick species: Rh. haemaphysaloides, Rh. turanicus, Rh. microplus, and Ha. cornupunctata, while no Rickettsia sp. was detected in Hy. anatolicum, Hy. dromedarii, and Ha. sulcata. The occurrence of Rickettsia spp. was highest in Rhipicephalus haemaphysaloides (9/50, 18.0%), followed by Rh. turanicus (13/99, 13.1%), Ha. cornupunctata (1/18, 5.5%), and Rh. microplus (2/49, 4.1%). The occurrence of Rickettsia spp. was noted to be highest in the district of Mardan (4/26, 15.4%), followed by Mohmand (2/20, 10.0%), Bajaur (3/33, 9.1%), Charsadda (3/34, 8.8%), Lower Dir (2/23, 8.7%), Nowshera (2/26, 7.7%), Swabi (2/28, 7.1%), Peshawar (2/30, 6.7%), Malakand (1/18, 5.5%), Swat (1/19, 5.3%), Bannu (1/20, 5.0%), Lakki Marwat (1/26, 3.8%), and Buner (1/27, 3.7%) (Table 2).

3.3. Sequencing and Phylogenetic Analysis

DNA sequences were generated from all 25 tick specimens that yielded amplicons by means of PCR assays targeting fragments of the rickettsial genes gltA, ompA, and ompB. Two Rickettsia spp. agents were identified based on partial fragments of gltA, ompA, and ompB; i.e., Candidatus Rickettsia shennongii and R. massiliae (Table 2). For each of these two Rickettsia spp., a single haplotype was generated for each of the three rickettsial genes, regardless of the number of PCR-positive ticks. The obtained gltA, ompA, and ompB haplotypes from Rh. haemaphysaloides, Rh. turanicus, and Rh. microplus showed maximum identities of 100%, 99.29–99.82%, and 99.87–100% and queries of 71–100%, 99%, and 94%, respectively, with Rickettsia sp. and Ca. R. shennongii, which have been reported in Taiwan and China. On the other hand, a rickettsial gltA haplotype obtained from Rh. haemaphysaloides, Rh. turanicus, Rh. microplus, and Ha. cornupunctata showed 100% identity and 100% query with R. massiliae reported in the USA, whereas an ompA haplotype from these same ticks showed 99.3–100% maximum identity and 100% query with R. massiliae reported in USA, France, and Lebanon, and an ompB haplotype showed 99.24–100% maximum identity and 100% query with R. massiliae reported in Argentina.
Since only one haplotype was generated for each gene of Ca. R. shennongii and R. massiliae, this single haplotype was used in each of the phylogenetic analyses. In all three phylogenetic trees, the obtained Ca. R. shennongii haplotypes clustered with the Rickettsia sp. and Ca. R. shennongii on the basis of gltA, ompA, and ompB reported from Taiwan and China, respectively (Figure 2, Figure 3 and Figure 4). The R. massiliae sequences clustered with the same species based on gltA reported from the USA; ompA reported from the USA, France, and Lebanon; and ompB reported from the USA, France, and Argentina (Figure 2, Figure 3 and Figure 4). The obtained haplotypes of Ca. R. shennongii were deposited to GenBank under the following accession numbers: gltA (OP820487, OR428237–OR428243, OR437436–OR437448), ompA (OP820485, OR437460–OR437479), and ompB (OP820483, OR437449–OR437459). The R. massiliae haplotypes were deposited under the following accession numbers: gltA (OP820488, OR428235, OR428236), ompA (OP820486, OR428231), and ompB (OP820484, OR428232–OR428234).

4. Discussion

Prior to this study, the SFG novel agent Ca. R. shennongii was detected in Rh. haemaphysaloides ticks in China [12], while R. massiliae was detected in different tick species in different parts of the world. The pathogenic role of R. massiliae has been reported in humans [6,44,45], while the pathogenicity of Ca. R. shennongii to humans is unknown. The ecological conditions in Pakistan are suitable for the propagations of ticks and tick-borne pathogens [2,5]. Previous studies reporting R. massiliae in ticks from Pakistan relied on, at most, two genetic markers [2,3,5]. However, due to the unavailability of sufficient knowledge regarding the unidentified Rickettsia spp. in Pakistan, there is a need to conduct comprehensive studies in which Rickettsia spp. could be genetically characterized via suitable genetic markers. Hence, the present study reported two SFG Rickettsia spp. in four tick species via gltA, ompA, and ompB genetic markers. In phylogenetic trees inferred from gltA, ompA, and ompB partial sequences, the present sequences of Ca. R. shennongii and R. massiliae grouped separately with their corresponding species from different regions. The R. massiliae sequences were grouped into two branches, suggesting evolutionary differences.
The highest tick occurrence was noted for Rh. microplus, which is a dominant tick in the region [2,3,46]. Equids were found to be infested by Rh. turanicus and Rh. haemaphysaloides. The ticks Rh. microplus, Haemaphysalis bispinosa, Hy. anatolicum, and Hy. dromedarii, previously reported when found on Pakistan’s equids [2,46], were not found on the host species of the present study. This may be due to the availability of other suitable hosts. A wide host range was observed for Rh. turanicus, Rh. haemaphysaloides, Hy. anatolicum, Hy. dromedarii, Ha. cornupunctata, and Ha. sulcata, infesting cattle, buffaloes, sheep and goats; this might be due to their three-host life cycle [47]. The one-host tick Rh. microplus, infesting various hosts such as cattle, buffaloes, and goats, may be linked to the sharing of habitats by different hosts. The camels were found to be infested by Hy. dromedarii, which is considered the main tick species parasitizing camels [48].
Rhipicephalus turanicus, Rh. microplus, Rh. haemaphysaloides, and Ha. cornupunctata ticks infesting cattle, buffaloes, sheep, and goats were found to be positive for R. massiliae. Previously, R. massiliae has been detected in tick species of the genera Rhipicephalus, Haemaphysalis, Hyalomma, and Dermacentor, collected from dogs, small ruminants, and cattle in China, Iran, Nigeria, Tunisia, Portugal, Argentina, and the USA [17,49,50,51,52,53,54,55]. Rickettsia massiliae in Rh. microplus, Rh. turanicus, and Rh. haemaphysaloides ticks infesting cattle, buffaloes, goats, sheep, and equids has been reported in Pakistan [2,5,8], although this is the first report of R. massiliae in Ha. cornupunctata infesting sheep and goats. In previous studies, the highest occurrence of R. massiliae was observed in Rh. microplus and Rh. haemaphysaloides [2,3], while in the present study, the highest occurrence was observed in Rh. haemaphysaloides. This may be due the collection process of tick samples from the hosts (equids and wild animals), which were different than the hosts examined in the current study (livestock).
The agent Ca. R. shennongii was detected in three tick species—Rh. microplus, Rh. haemaphysaloides, and Rh. turanicus—infesting cattle, buffaloes, sheep, and goats. Previously, this Rickettsia species was not fully characterized and mostly called Rickettsia sp., and has been detected in Haemaphysalis spinigera, Haemaphysalis turturis, Haemaphysalis bandicota, and Rh. haemaphysaloides reported from India (NCBI https://www.ncbi.nlm.nih.gov/, accessed on 7 April 2023) and Taiwan [56]. In some cases, it was called R. massiliae when detected in ectoparasites of pets reported from India (NCBI https://www.ncbi.nlm.nih.gov/, accessed on 7 April 2023). Recently, it was genetically characterized and called Ca. R. shennongii when detected in Rh. haemaphysaloides ticks in China [12], confirming its broad host and geographic range. This also provides evidence for the possible role of these ticks in the spreading of Ca. R. shennongii, as the adult female and nymph ticks were found to be positive for rickettsial DNA. Hence, there is a possibility that the detected rickettsial DNA was ingested in blood from the infected host. Rickettsia spp.-infected ticks constitute a possible health risk to livestock-holders [4], and we stress the need for further research to understand its pathogenic potential and to avoid any zoonotic consequences.
The gltA, ompA, and ompB genes have been shown to have a high degree of intraspecific variation, and are extensively used for reliable phylogenetic analyses within the genus Rickettsia [57]. Taking these into account, the characterization of Ca. R. shennongii and R. massiliae was confirmed by these three reliable genetic markers [2,3,8]. Based on these genetic markers, the sequences of Ca. R. shennongii showed maximum identities with sequences of Rickettsia sp. and “Ca. R. shennongii” reported in Taiwan and China [12], while the sequences of R. massiliae showed maximum identities with sequences of this species reported in the USA and Argentina. The pathogenic potential of R. massiliae in humans has been described in Europe and South America [6,46]; however, there is no information about the pathogenicity of Ca. R. shennongii. Although the zoonotic transmission of R. massiliae in Pakistan is currently unknown, it emphasizes the need to conduct further epidemiological studies in order to explore its pathogenic role. The systematic investigation of SFG Rickettsia spp. with high zoonotic potential [58] may allow us to explore the emerging novel species in the region. The presence of Ca. R. shennongii in Pakistan indicates the presence of diverse unidentified SFG Rickettsia spp. Extensive “One-Health” studies and various surveillance programs are essential in order to elucidate the epidemiology, transmission, and pathogenicity of Rickettsia spp. in the country. The One-Health approach is particularly relevant for the development of strategies to control tick infestations and associated TBDs. The integration of the One-Health approach in surveillance programs will improve our understanding regarding the circulation of zoonotic TBPs in different regions of the country.

5. Conclusions

The present study reports the presence of two Rickettsia agents in Rh. haemaphysaloides, Rh. turanicus, Rh. microplus, and Ha. cornupunctata, collected from cattle, buffaloes, sheep, and goats, in 13 districts of KP, Pakistan: Ca. R. shennongii associated with Rh. haemaphysaloides, Rh. microplus, and Rh. turanicus; and R. massiliae associated with Rh. haemaphysaloides, Rh. turanicus, Rh. microplus, and Ha. cornupunctata. The distribution of Rickettsia in the study area and the observed detection rate in domestic animals point to the diversity of SFG Rickettsiae. Epidemiological and surveillance studies are required in order to explore the pathogenic potential of Ca. R. shennongii.

Author Contributions

A.A. (Abid Ali): designed the experimental idea of the study. A.A. (Abid Ali), S.S., F.U. and Z.K. collected the tick samples. S.S., A.A. (Abdulaziz Alouffi), M.M.A., T.T., Z.K., K.-H.T. and F.U. performed the experiments. A.A. (Abid Ali), K.-H.T., S.S., F.U., M.M.A., T.T., Z.K. and M.B.L. performed the phylogenetic analysis. All authors have read and agreed to the published version of the manuscript.

Funding

Funding was obtained from the researchers supporting project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia. This research was also partially funded by the National Science and Technology Council, grant number: 112-2327-B-002-008.

Institutional Review Board Statement

This study was ethically approved by the Advanced Studies and Research Board (AWKUM/CE/SC/2022/12041) of the Faculty of Chemical and Life Sciences, Abdul Wali Khan University, Mardan.

Informed Consent Statement

Oral consent was taken from the livestock owners during tick collection, and they were informed about the purpose of the study.

Data Availability Statement

The data set of the current study can be found in the online repository under the accession numbers present in the article.

Acknowledgments

The authors acknowledge the financial support provided by the Higher Education Commission (HEC), Pakistan, and Pakistan Science Foundation (PSF). The researchers support project number (RSP2023R494), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jiang, J.; Farris, C.M.; Yeh, K.B.; Richards, A.L. International Rickettsia Disease surveillance: An example of cooperative research to increase laboratory capability and capacity for risk assessment of rickettsial outbreaks worldwide. Front. Med. 2021, 8, 622015. [Google Scholar] [CrossRef] [PubMed]
  2. Ali, A.; Zahid, H.; Zeb, I.; Tufail, M.; Khan, S.; Haroon, M.; Bilal, M.; Hussain, M.; Alouffi, A.S.; Muñoz-Leal, S.; et al. Risk factors associated with tick infestations on equids in Khyber Pakhtunkhwa, Pakistan, with notes on Rickettsia massiliae detection. Parasites Vectors 2021, 14, 363. [Google Scholar] [CrossRef] [PubMed]
  3. Ali, A.; Shehla, S.; Zahid, H.; Ullah, F.; Zeb, I.; Ahmed, H.; Da Silva Vaz, I., Jr.; Tanaka, T. Molecular survey and spatial distribution of Rickettsia spp. in ticks infesting free-ranging wild animals in Pakistan (2017–2021). Pathogens 2022, 11, 162. [Google Scholar] [CrossRef]
  4. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
  5. Karim, S.; Budachetri, K.; Mukherjee, N.; Williams, J.; Kausar, A.; Hassan, M.J.; Adamson, S.; Dowd, S.E.; Apanskevich, D.; Arijo, A.; et al. A study of ticks and tick-borne livestock pathogens in Pakistan. PLoS Negl. Trop. Dis. 2017, 11, e0005681. [Google Scholar] [CrossRef] [PubMed]
  6. García-García, J.C.; Portillo, A.; Núñez, M.J.; Santibáñez, S.; Castro, B.; Oteo, J.A. Case report: A patient from Argentina infected with Rickettsia massiliae. Am. J. Trop. Med. Hyg. 2010, 82, 691. [Google Scholar] [CrossRef] [PubMed]
  7. Dumic, I.; Jevtic, D.; Veselinovic, M.; Nordstrom, C.W.; Jovanovic, M.; Mogulla, V.; Veselinovic, E.M.; Hudson, A.; Simeunovic, G.; Petcu, E.; et al. Human granulocytic anaplasmosis—A systematic review of published cases. Microorganisms 2022, 10, 1433. [Google Scholar] [CrossRef]
  8. Khan, Z.; Shehla, S.; Alouffi, A.; Kashif Obaid, M.; Zeb Khan, A.; Almutairi, M.M.; Numan, M.; Aiman, O.; Alam, S.; Ullah, S.; et al. Molecular survey and genetic characterization of Anaplasma marginale in ticks collected from livestock hosts in Pakistan. Animals 2022, 12, 1708. [Google Scholar] [CrossRef]
  9. Binetruy, F.; Buysse, M.; Barosi, R.; Duron, O. Novel Rickettsia genotypes in ticks in French Guiana, South America. Sci. Rep. 2020, 10, 2537. [Google Scholar] [CrossRef]
  10. Weinert, L.A.; Morand, S.; Krasnov, B.R.; Littlewood, D.T.J. The diversity and phylogeny of Rickettsia. In Parasite Diversity and Diversification: Evolutionary Ecology Meets Phylogenetics; Cambridge University Press: Cambridge, UK, 2015; pp. 150–181. [Google Scholar]
  11. El Karkouri, K.; Ghigo, E.; Raoult, D.; Fournier, P.E. Genomic evolution and adaptation of arthropod-associated Rickettsia. Sci. Rep. 2022, 12, 3807. [Google Scholar] [CrossRef]
  12. Lu, M.; Tian, J.; Wang, W.; Zhao, H.; Jiang, H.; Han, J.; Guo, W.; Li, K. High diversity of Rickettsia spp., Anaplasma spp., and Ehrlichia spp. in ticks from Yunnan Province, Southwest China. Front. Microbiol. 2022, 13, 1008110. [Google Scholar] [CrossRef] [PubMed]
  13. Beati, L.; Finidori, J.P.; Gilot, B.; Raoult, D. Comparison of serologic typing, sodium dodecyl sulfate-polyacrylamide gel electrophoresis protein analysis, and genetic restriction fragment length polymorphism analysis for identification of Rickettsiae: Characterization of two new rickettsial strains. J. Clin. Microbiol. 1992, 30, 1922–1930. [Google Scholar] [CrossRef] [PubMed]
  14. Blanda, V.; Torina, A.; La Russa, F.; D’Agostino, R.; Randazzo, K.; Scimeca, S.; Giudice, E.; Caracappa, S.; Cascio, A.; de la Fuente, J. A retrospective study of the characterization of Rickettsia species in ticks collected from humans. Ticks Tick-Borne Dis. 2017, 8, 610–614. [Google Scholar] [CrossRef] [PubMed]
  15. Chisu, V.; Leulmi, H.; Masala, G.; Piredda, M.; Foxi, C.; Parola, P. Detection of Rickettsia hoogstraalii, Rickettsia helvetica, Rickettsia massiliae, Rickettsia slovaca and Rickettsia aeschlimannii in ticks from Sardinia, Italy. Ticks Tick-Borne Dis. 2017, 8, 347–352. [Google Scholar] [CrossRef]
  16. Beeler, E.; Abramowicz, K.F.; Zambrano, M.L.; Sturgeon, M.M.; Khalaf, N.; Hu, R.; Dasch, G.A.; Eremeeva, M.E. A focus of dogs and Rickettsia massiliae–infected Rhipicephalus sanguineus in California. Am. J. Trop. Med. Hyg. 2011, 84, 244. [Google Scholar] [CrossRef]
  17. Cicuttin, G.L.; Brambati, D.F.; Eugui, J.I.R.; Lebrero, C.G.; De Salvo, M.N.; Beltrán, F.J.; Dohmen, F.E.G.; Jado, I.; Anda, P. Molecular characterization of Rickettsia massiliae and Anaplasma platys infecting Rhipicephalus sanguineus ticks and domestic dogs, Buenos Aires (Argentina). Ticks Tick-Borne Dis. 2014, 5, 484–488. [Google Scholar] [CrossRef]
  18. López-Pérez, A.M.; Sánchez-Montes, S.; Foley, J.; Guzmán-Cornejo, C.; Colunga-Salas, P.; Pascoe, E.; Becker, I.; Delgado-de la Mora, J.; Licona-Enriquez, J.D.; Suzan, G. Molecular evidence of Borrelia burgdorferi sensu stricto and Rickettsia massiliae in ticks collected from a domestic-wild carnivore interface in Chihuahua, Mexico. Ticks Tick-Borne Dis. 2019, 10, 1118–1123. [Google Scholar] [CrossRef]
  19. Wei, Q.Q.; Guo, L.P.; Wang, A.D.; Mu, L.M.; Zhang, K.; Chen, C.F.; Zhang, W.J.; Wang, Y.Z. The first detection of Rickettsia aeschlimannii and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China. Parasites Vectors 2015, 8, 631. [Google Scholar] [CrossRef]
  20. Krishnamoorthy, P.; Sudhagar, S.; Goudar, A.L.; Jacob, S.S.; Suresh, K.P. Molecular survey and phylogenetic analysis of tick-borne pathogens in ticks infesting cattle from two South Indian states. Vet. Parasitol. Reg. Stud. 2021, 25, 100595. [Google Scholar] [CrossRef]
  21. Mostafavi, S.M.; Khalili, M.; Akhtardanesh, B.; Nourollahifard, S.R.; Esmaeili, S. Rickettsia spp. in Rhipicephalus sanguineus sensu lato ticks collected from stray dogs in Kerman city, Iran. Ticks Tick-Borne Dis. 2022, 13, 101985. [Google Scholar] [CrossRef]
  22. Numan, M.; Islam, N.; Adnan, M.; Safi, S.Z.; Chitimia-Dobler, L.; Labruna, M.B.; Ali, A. First genetic report of Ixodes kashmiricus and associated Rickettsia sp. Parasites Vectors 2022, 15, 378. [Google Scholar] [CrossRef] [PubMed]
  23. Khan, M.; Islam, N.; Khan, A.; Islam, Z.U.; Muñoz-Leal, S.; Labruna, M.B.; Ali, A. New records of Amblyomma gervaisi from Pakistan, with detection of a reptile-associated Borrelia sp. Ticks Tick-Borne Dis. 2022, 13, 102047. [Google Scholar] [CrossRef] [PubMed]
  24. Ahmad, I.; Ullah, S.; Alouffi, A.; Almutairi, M.M.; Khan, M.; Numan, M.; Safi, S.Z.; Chitimia-Dobler, L.; Tanaka, T.; Ali, A. Description of Male, Redescription of Female, Host Record, and Phylogenetic Position of Haemaphysalis danieli. Pathogens 2022, 11, 1495. [Google Scholar] [CrossRef] [PubMed]
  25. Aiman, O.; Ullah, S.; Chitimia-Dobler, L.; Nijhof, A.M.; Ali, A. First report of Nosomma monstrosum ticks infesting Asian water buffaloes (Bubalus bubalis) in Pakistan. Ticks Tick-Borne Dis. 2022, 13, 101899. [Google Scholar] [CrossRef]
  26. Alam, S.; Khan, M.; Alouffi, A.; Almutairi, M.M.; Ullah, S.; Numan, M.; Islam, N.; Khan, Z.; Aiman, O.; Zaman Safi, S.; et al. Spatio-Temporal Patterns of Ticks and Molecular Survey of Anaplasma marginale, with Notes on Their Phylogeny. Microorganisms 2022, 10, 1663. [Google Scholar] [CrossRef]
  27. Ullah, S.; Alouffi, A.; Almutairi, M.M.; Islam, N.; Rehman, G.; Ul Islam, Z.; Ahmed, H.; Vaz, I., Jr.; Labruna, M.B.; Tanaka, T.; et al. First Report of Rickettsia conorii in Hyalomma kumari Ticks. Animals 2023, 13, 1488. [Google Scholar] [CrossRef] [PubMed]
  28. Ali, A.; Obaid, M.K.; Almutairi, M.; Alouffi, A.; Numan, M.; Ullah, S.; Rehman, G.; Islam, Z.U.; Khan, S.B.; Tanaka, T. Molecular Detection of Coxiella spp. in Ticks (Ixodidae and Argasidae) Infesting Domestic and Wild Animals: With Notes on the Epidemiology of Tick-borne Coxiella burnetii in Asia. Front. Microbiol. 2023, 14, 1229950. [Google Scholar] [CrossRef]
  29. Robertson, R.G.; Wisseman, C.L., Jr. Tick-Borne Rickettsiae of the Spotted Fever Group in west Pakistan: II. Serological classification of isolates from west Pakistan and Thailand: Evidence for two new species. Am. J. Epidemiol. 1973, 97, 55–64. [Google Scholar] [CrossRef]
  30. Ali, A.; Numan, M.; Khan, M.; Aiman, O.; Muñoz-Leal, S.; Chitimia-Dobler, L.; Labruna, M.B.; Nijhof, A.M. Ornithodoros (Pavlovskyella) ticks associated with a Rickettsia sp. in Pakistan. Parasites Vectors 2022, 15, 138. [Google Scholar] [CrossRef]
  31. Walker, J.B.; Keirans, J.E.; Horak, I.G. The Genus Rhipicephalus (Acari, Ixodidae): A Guide to the Brown Ticks of the World; Cambridge University Press: Cambridge, UK, 2000. [Google Scholar]
  32. Apanaskevich, D.A. Differentiation of closely related species Hyalomma anatolicum and H. excavatum (Acari: Ixodidae) based on a study of all life cycle stages, throughout entire geographical range. Parazitologiia 2003, 37, 259–280. [Google Scholar]
  33. Apanaskevich, D.A.; Schuster, A.L.; Horak, I.G. The genus Hyalomma: VII. Redescription of all parasitic stages of H. (Euhyalomma) dromedarii and H. (E.) schulzei (Acari: Ixodidae). J. Med. Entomol. 2008, 45, 817–831. [Google Scholar] [CrossRef] [PubMed]
  34. Geevarghese, G.; Mishra, A.C. Haemaphysalis Ticks of India; Elsevier: Amsterdam, The Netherlands, 2011. [Google Scholar]
  35. Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Long Island, NY, USA, 2001; pp. 23–44. [Google Scholar]
  36. Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef] [PubMed]
  37. Roux, V.; Fournier, P.E.; Raoult, D. Differentiation of spotted fever group Rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rompA. J. Clin. Microbiol. 1996, 34, 2058. [Google Scholar] [CrossRef] [PubMed]
  38. Roux, V.; Raoult, D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int. J. Syst. Evol. Microbiol. 2000, 50, 1449–1455. [Google Scholar] [CrossRef] [PubMed]
  39. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  40. Hall, T. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  41. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
  42. Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar]
  43. Guindon, S.; Gascuel, O. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 2003, 52, 696–704. [Google Scholar] [CrossRef]
  44. Matsumoto, K.; Ogawa, M.; Brouqui, P.; Raoult, D.; Parola, P. Transmission of Rickettsia massiliae in the tick, Rhipicephalus turanicus. Med. Vet. Entomol. 2005, 19, 263–270. [Google Scholar] [CrossRef]
  45. Eldin, C.; Virgili, G.; Attard, L.; Edouard, S.; Viale, P.; Raoult, D.; Parola, P. Rickettsia massiliae infection after a tick bite on the eyelid. Travel. Med. Infect. Dis. 2018, 26, 66–68. [Google Scholar] [CrossRef] [PubMed]
  46. Kamran, K.; Ali, A.; Villagra, C.; Siddiqui, S.; Alouffi, A.S.; Iqbal, A. A cross-sectional study of hard ticks (acari: Ixodidae) on horse farms to assess the risk factors associated with tick-borne diseases. Zoonoses Public Health 2021, 68, 247–262. [Google Scholar] [CrossRef] [PubMed]
  47. Vatansever, Z. Hyalomma anatolicum Koch, 1844 (Figs. 158–160). In Ticks of Europe and North Africa: A Guide to Species Identification; Springer: Cham, Switzerland, 2017; pp. 391–395. [Google Scholar]
  48. Nourollahi Fard, S.R.; Fathi, S.; Norouzi Asl, E.; Asgary Nazhad, H.; Salehzadeh Kazeroni, S. Hard ticks on one-humped camel (Camelus dromedarius) and their seasonal population dynamics in southeast, Iran. Trop. Anim. Health Prod. 2012, 44, 197–200. [Google Scholar] [CrossRef]
  49. Marié, J.L.; Davoust, B.; Socolovschi, C.; Raoult, D.; Parola, P. Molecular detection of rickettsial agents in ticks and fleas collected from a European hedgehog (Erinaceus europaeus) in Marseilles, France. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 77–79. [Google Scholar] [CrossRef] [PubMed]
  50. Yu, P.; Liu, Z.; Niu, Q.; Yang, J.; Abdallah, M.O.; Chen, Z.; Liu, G.; Luo, J.; Yin, H. Molecular evidence of tick-borne pathogens in Hyalomma anatolicum ticks infesting cattle in Xinjiang Uygur Autonomous Region, Northwestern China. Exp. Appl. Acarol. 2017, 73, 269–281. [Google Scholar] [CrossRef] [PubMed]
  51. Ortuño, A.; Sanfeliu, I.; Nogueras, M.M.; Pons, I.; López-Claessens, S.; Castellà, J.; Antón, E.; Segura, F. Detection of Rickettsia massiliae/Bar29 and Rickettsia conorii in red foxes (Vulpes vulpes) and their Rhipicephalus sanguineus complex ticks. Ticks Tick-Borne Dis. 2018, 9, 629–631. [Google Scholar] [CrossRef]
  52. Belkahia, H.; Selmi, R.; Zamiti, S.; Daaloul-Jedidi, M.; Messadi, L.; Ben Said, M. Zoonotic Rickettsia Species in Small Ruminant Ticks from Tunisia. Front. Vet. Sci. 2021, 8, 676896. [Google Scholar] [CrossRef]
  53. Elelu, N.; Ola-Fadunsin, S.D.; Bankole, A.A.; Raji, M.A.; Ogo, N.I.; Cutler, S.J. Prevalence of tick infestation and molecular characterization of spotted fever Rickettsia massiliae in Rhipicephalus species parasitizing domestic small ruminants in north-central Nigeria. PLoS ONE 2022, 17, 0263843. [Google Scholar] [CrossRef]
  54. Mesquita, J.R.; Santos-Silva, S.; de Sousa Moreira, A.; Baptista, M.B.; Cruz, R.; Esteves, F.; Vala, H.; Barradas, P.F. Rickettsia massiliae circulation in sheep and attached Rhipicephalus sanguineus in Central Portugal. Trop. Anim. Health Prod. 2022, 54, 199. [Google Scholar] [CrossRef]
  55. Monje, L.D.; Linares, M.C.; Beldomenico, P.M. Prevalence and infection intensity of Rickettsia massiliae in Rhipicephalus sanguineus sensu lato ticks from Mendoza, Argentina. Microbes Infect. 2016, 18, 701–705. [Google Scholar] [CrossRef]
  56. Nguyen, V.L.; Colella, V.; Greco, G.; Fang, F.; Nurcahyo, W.; Hadi, U.K.; Venturina, V.; Tong, K.B.Y.; Tsai, Y.L.; Taweethavonsawat, P.; et al. Molecular detection of pathogens in ticks and fleas collected from companion dogs and cats in East and Southeast Asia. Parasites Vectors 2020, 13, 420. [Google Scholar] [CrossRef] [PubMed]
  57. Klein, D.; Beth-Din, A.; Cohen, R.; Lazar, S.; Glinert, I.; Zayyad, H.; Atiya-Nasagi, Y. New spotted fever group Rickettsia isolate, identified by sequence analysis of conserved genomic regions. Pathogens 2019, 9, 11. [Google Scholar] [CrossRef] [PubMed]
  58. Guo, L.P.; Jiang, S.H.; Liu, D.; Wang, S.W.; Chen, C.F.; Wang, Y.Z. Emerging spotted fever group Rickettsiae in ticks, northwestern China. Ticks Tick-Borne Dis. 2016, 7, 1146–1150. [Google Scholar] [CrossRef] [PubMed]
Pathogens 12 01080 g001
Figure 1. Map showing collection sites for ticks in different districts of Khyber Pakhtunkhwa, Pakistan.
Figure 1. Map showing collection sites for ticks in different districts of Khyber Pakhtunkhwa, Pakistan.
Pathogens 12 01080 g001
Pathogens 12 01080 g002
Figure 2. Phylogenetic tree based on gltA sequences for Rickettsia spp. using the Maximum likelihood method (Tamura–Nei model). The Rickettsia canadensis was taken as an outgroup. The 1000 bootstrapping values were followed, and the levels of bootstrap support (≥70%) for the phylogenetic groupings are given at each node. The sequences (OP820487; 363 bp, OP820488; 362 bp) obtained in the present study are shown in an underlined font.
Figure 2. Phylogenetic tree based on gltA sequences for Rickettsia spp. using the Maximum likelihood method (Tamura–Nei model). The Rickettsia canadensis was taken as an outgroup. The 1000 bootstrapping values were followed, and the levels of bootstrap support (≥70%) for the phylogenetic groupings are given at each node. The sequences (OP820487; 363 bp, OP820488; 362 bp) obtained in the present study are shown in an underlined font.
Pathogens 12 01080 g002
Pathogens 12 01080 g003
Figure 3. Phylogenetic tree based on ompA sequences for Rickettsia spp. using the Maximum likelihood method (Tamura–Nei model). The group comprising sequences of Rickettsia akari, and Rickettsia australis was taken as the outgroup. The 1000 bootstrapping values were followed, and the levels of bootstrap support (≥70%) for the phylogenetic groupings are given at each node. The sequences (OP820485; 564 bp, OP820486; 530 bp) obtained in the present study are shown in an underlined font.
Figure 3. Phylogenetic tree based on ompA sequences for Rickettsia spp. using the Maximum likelihood method (Tamura–Nei model). The group comprising sequences of Rickettsia akari, and Rickettsia australis was taken as the outgroup. The 1000 bootstrapping values were followed, and the levels of bootstrap support (≥70%) for the phylogenetic groupings are given at each node. The sequences (OP820485; 564 bp, OP820486; 530 bp) obtained in the present study are shown in an underlined font.
Pathogens 12 01080 g003
Pathogens 12 01080 g004
Figure 4. Phylogenetic tree based on ompB sequences for Rickettsia spp. using the Maximum likelihood method (Tamura–Nei model). The group comprising sequences of Rickettsia australis, Rickettsia asembonensis, and Rickettsia felis was taken as the outgroup. The 1000 bootstrapping values were followed, and the levels of bootstrap support (≥70%) for the phylogenetic groupings are given at each node. The sequences (OP820483; 796 bp, OP820484; 794 bp) obtained in the present study are shown in an underlined font.
Figure 4. Phylogenetic tree based on ompB sequences for Rickettsia spp. using the Maximum likelihood method (Tamura–Nei model). The group comprising sequences of Rickettsia australis, Rickettsia asembonensis, and Rickettsia felis was taken as the outgroup. The 1000 bootstrapping values were followed, and the levels of bootstrap support (≥70%) for the phylogenetic groupings are given at each node. The sequences (OP820483; 796 bp, OP820484; 794 bp) obtained in the present study are shown in an underlined font.
Pathogens 12 01080 g004
Table 1. List of primers used in the present study.
Table 1. List of primers used in the present study.
GenePrimerSequence (5′-3′)Amplicon Size Reference
gltACS-78GCAAGTATCGGTGAGGATGTAAT401 bp[36]
CS-323GCTTCCTTAAAATTCAATAAATCAGGAT
ompARr190.70pATGGCGAATATTTCTCCAAAA631 bp[37]
Rr190.701n GTTCCGTTAATGGCAGCATCT
ompB120-M59CCGCAGGGTTGGTAACTGC862 bp[38]
120-807CCTTTTAGATTACCGCCTAA
Table 2. Occurrence of ticks and the detection rate of Rickettsia spp. According to geographical districts and hosts in Pakistan.
Table 2. Occurrence of ticks and the detection rate of Rickettsia spp. According to geographical districts and hosts in Pakistan.
DistrictHostsNo. of Infested/No. of Examined Livestock HostsIdentified TicksNo. of Ticks According to Life StageNo. of Tested TicksMolecular Detection of Rickettsia spp. In Morphologically Identified Ticks (N, F, M)
No. of Ticks with R. massiliaeNo. of Ticks with Ca. R. shennongii
gltAompAompBgltAompAompB
CharsaddaEquids4/9Rh. turanicus1N, 2F1N, 1F 1N1N1N
Rh. haemaphysaloides3N, 1M, 1F1N, 1M, 1F
Cattle14/20Rh. turanicus1N, 1M, 2F1M, 1F
Hy. anatolicum2N, 2F1N, 1F
Rh. haemaphysaloides4N, 1M, 3F1N, 1M, 1F 1F
Rh. microplus7N, 2M, 11F1N, 1M, 1F
Buffaloes8/15Hy. anatolicum1N, 1M, 3F1N, 1M, 1F
Rh. turanicus1N, 1M, 1F1M, 1F 1F1F
Sheep8/20Hy. anatolicum1N, 1M, 2F1N, 1F
Rh. turanicus2N, 1M, 2F1M
Goats9/15Hy. anatolicum1N, 1M, 1F1N, 1F
Rh. turanicus2N, 1M, 3F1N, 1M, 1F
Rh. haemaphysaloides3N, 2M, 6F1N, 1M, 1F
Camels6/10Hy. dromedarii3N, 2M, 5F1N, 1M, 1F
Total49/89 91343
PeshawarEquids4/11Rh. turanicus2N, 1M, 2F1N, 1M
Cattle13/19Hy. anatolicum4N, 2M, 5F1N, 1M, 1F
Rh. haemaphysaloides2N, 2M, 4F1N, 1M, 1F
Buffaloes5/9Hy. anatolicum2N, 1M, 3F1N, 1M, 1F
Rh. turanicus3N, 1M, 3F1N, 1M, 1F
Sheep6/8Rh. turanicus3N, 1M, 3F1N, 1M, 1F
Goats5/7Rh. haemaphysaloides4N, 1M, 4F1N, 1M, 1F 1N1N1N
Rh. microplus3N, 2M, 6F1N, 1M, 1F 1N1N1N
Camels2/4Hy. dromedarii3N, 1M, 5F1N, 1M, 5F
Total35/58 73302
MardanEquids3/5Rh. turanicus1N, 2M, 5F1N, 1M, 1F 1M1M
Cattle11/15Hy. anatolicum1N, 2M, 2F1N, 1M, 1F
Rh. turanicus1N, 2M, 3F1N, 1M, 1F1N1N1N
Rh. microplus7N, 4M, 13F1N, 1M, 1F
Buffaloes5/10Rh. haemaphysaloides2N, 2M, 3F1N, 1M, 1F
Sheep4/10Rh. haemaphysaloides2N, 2M, 2F1N, 1M, 1F 1N1N
Goats4/8Rh. haemaphysaloides1N, 2M1N, 1M
Rh. turanicus3N, 2M, 1F1N, 1M, 1F 1N1N1N
Camels2/4Hy. dromedarii1N, 2M, 2F1N, 1M, 1F
Total29/52 70264
SwabiEquids3/5Rh. turanicus1N, 2M, 1F1N, 1M, 1F
Cattle9/9Rh. microplus5N, 3M, 7F3N, 1M, 1F
Buffaloes8/8Hy. anatolicum1N, 2M, 3F1N, 1M, 1F
Rh. turanicus1N, 1M, 1F1N, 1M, 1F 1N1N1N
Sheep5/7Rh. haemaphysaloides1N, 2M, 3F1N, 1M, 1F
Rh. turanicus1N, 1M, 2F1N, 1M, 1F
Goats5/6Rh. microplus2N, 3M, 5F1N, 2M, 2F1M 1M
Camels2/4Hy. dromedarii2N, 3M, 4F1N, 1M, 1F
Total32/39 57282
Lakki MarwatEquids3/4Rh. turanicus1N, 1M, 2F1N, 1M, 1F
Cattle7/8Hy. tnatolicum1N, 1M, 1F1N, 1M, 1F
Rh. turanicus3N, 1M, 1F1N, 1F
Rh. microplus3N, 2M, 6F1N, 2M
Buffaloes5/7Hy. anatolicum1N, 2M, 3F1N, 1F
Sheep6/10Hy. anatolicum3N, 1M, 4F1N, 1F
Rh. turanicus1N, 1M, 2F1N, 1M, 1F
Goats5/7Hy. anatolicum1N, 2M, 3F1N, 1M, 1F
Rh. haemaphysaloides2N, 2M, 4F1N, 1M, 1F 1N1N1N
Camels2/3Hy. dromedarii2N, 2M, 3F1N, 1F
Total28/39 62261
BannuEquids0/2NoneNoneNone
Cattle7/7Hy. anatolicum1N, 2M, 3F1N, 1M, 1F
Rh. haemaphysaloides3N, 1M, 5F1N, 1M, 1F
Rh. microplus3N, 2M, 5F1N, 1M, 1F
Buffaloes4/6Rh. turanicus1N, 1M, 2F1N, 1M, 1F 1N1N1N
Sheep3/9Hy. anatolicum1N, 2M1N, 1M
Goats5/7Hy. anatolicum1N, 2M, 2F1N, 1M, 1F
Camels2/4Hy. dromedarii2N, 1M, 2F1N, 1M, 1F
Total21/35 42201
NowsheraEquids2/2Rh. turanicus1N, 1M, 1F1N, 1M, 1F
Cattle8/9Hy. anatolicum1N, 2M, 3F1N, 1M, 1F
Rh. microplus4N, 2M, 6F1N, 1M, 1F
Buffaloes6/6Hy. anatolicum1N, 2M, 1F1N, 1M, 1F
Rh. turanicus1N, 1M, 1F1N, 1F 1N1N1N
Sheep6/7Hy. anatolicum4N, 1M, 5F1N, 1M, 1F
Goats5/7Rh. haemaphysaloides4N, 1M, 6F1N, 1M, 1F 1M1M
Ha. sulcata1N, 1M, 2F1N, 1M, 1F
Camels2/4Hy. dromedarii1N, 1M, 2F1N, 1M, 1F
Total29/35 57262
BajaurEquids2/2Rh. turanicus1N, 2M, 1F1N, 1M, 1F
Cattle6/7Rh. turanicus1N, 2M, 2F1N, 1M, 1F 1F1F
Rh. microplus5N, 1M, 5F1N, 1M, 1F
Buffaloes4/5Hy. anatolicum1N, 2M, 3F1N, 1M, 1F
Rh. turanicus1N, 1M, 1F1N, 1M, 1F
Sheep4/6Rh. turanicus1N, 1M, 2F1N, 1M, 2F
Rh. haemaphysaloides2N, 2M, 3F2N, 1M, 1F 1F1F
Goats3/5Hy. anatolicum1N, 1M, 2F1N, 1M, 1F
Rh. haemaphysaloides1N, 2M, 2F1N, 1M, 1F 1N1N1N
Camels1/2Hy. dromedarii1N, 1M, 2F1N, 1F
Total20/27 53333
MalakandEquids2/5Rh. turanicus1N, 1M, 2F1N, 1F
Cattle4/11Rh. turanicus1N, 1M, 2F1N, 1M, 1F
Buffaloes3/8Hy. anatolicum1N, 1M, 1F1N, 1F
Sheep4/9Ha. cornupunctata1N, 2M, 3F1N, 2M,3F1N1N1N
Goats3/6Hy. anatolicum1N, 2M1N, 1M
Camels3/5Hy. dromedarii4N, 1M, 4F1N, 1M
Total19/44 29181
MohmandEquid3/4Rh. turanicus1N, 1M, 3F1N, 1M, 1F
Cattle6/7Hy. anatolicum1N, 1M, 1F1N, 1F
Ha. cornupunctata4N, 1M, 4F1N, 1M, 1F
Buffaloes2/8Hy. anatolicum1N, 1M1N, 1M
Sheep5/10Rh. turanicus1N, 1M, 1F1N, 1F 1N1N1N
Rh. haemaphysaloides1N, 2M1N, 1M
Goats4/6Rh. haemaphysaloides1N, 1M, 1F1N, 1F 1F1F
Ha. sulcata1N, 1M1N, 1M
Camels3/4Hy. dromedarii3N, 1M, 3F1N, 1M, 1F
Total23/39 37202
Lower DirEquids2/6Rh. turanicus1N, 1M, 1F1M, 1F
Cattle7/8Hy. anatolicum1N, 1F1N, 1F
Rh. microplus4N, 1M, 5F2N, 1M, 2F
Buffaloes4/6Rh. turanicus1N, 1M, 2F1N, 1M, 1F 1F1F
Sheep7/10Ha. cornupunctata1N, 2M, 1F1N, 1M, 1F
Rh. turanicus1N, 1M, 2F1N, 1F 1N1N1N
Goats6/9Ha. cornupunctata1N, 1M, 1F1N, 1M, 1F
Rh. haemaphysaloides1N, 1M, 2F1N, 2F
Total26/39 34232
BunerEquids3/4Rh. turanicus1N, 2M, 3F1M, 1F
Cattle6/7Rh. microplus3N, 2M, 4F1N, 2F
Buffaloes9/10Rh. turanicus1N, 1M, 1F1N, 1F
Hy. anatolicum1N, 1M, 1F1N, 1M, 1F
Rh. microplus4N, 2M, 5F3N, 1F
Sheep6/7Ha. sulcata1N, 1M, 1F1N, 1M, 1F
Rh. turanicus1N, 2M, 2F1N, 1M, 1F
Goats5/5Rh. turanicus1N, 1M, 1F1N, 1M
Rh. haemaphysaloides2N, 1M, 2F1N, 1F 1F1F
Camels4/7Hy. dromedarii1N, 1M, 3F1N, 1M, 1F
Total33/40 53271
SwatEquids2/5Rh. turanicus1N, 1M, 1F1N, 1F
Cattle7/9Rh. microplus4N, 1M, 6F1N, 1M, 1F
Buffaloes8/10Rh. turanicus1N, 1M, 1F1N, 1M, 1F
Rh. microplus5N, 2M, 7F1N, 1M,1F
Sheep6/8Hy. anatolicum1N, 1M, 1F1N, 1F
Rh. turanicus1N, 2M, 2F1N, 1M, 1F 1N1N1N
Goats6/7Hy. anatolicum1N, 1M, 2F1N, 1F
Ha. cornupunctata1N, 2M, 3F1N, 1M, 1F
Total29/39 49191
Total 373/575 (64.9%)Rh. turanicus (163, 23.1%),
Rh. microplus (179, 25.3%),
Hy. anatolicum (136, 19.2%),
Rh. haemaphysaloides (118, 16.6%),
Hy. dromedarii (74, 10.5%),
Ha. sulcata (9, 1.3%),
Ha. cornupunctata (28, 1.8%)		707 (219N,
320F, 168M)		330 (118N, 95M, 117F)4/330 (1.2%)25/330 (7.6%)
25/330 (7.6%)
Rh. haemaphysaloides (9/50, 18.0%)
Rh. turanicus (13/99, 13.1%),
Rh. microplus (2/49, 4.1%)
Ha. cornupunctata (1/18, 5.5%),
N: Nymph, F: Female, M: Male.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shehla, S.; Ullah, F.; Alouffi, A.; Almutairi, M.M.; Khan, Z.; Tanaka, T.; Labruna, M.B.; Tsai, K.-H.; Ali, A. Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens 2023, 12, 1080. https://doi.org/10.3390/pathogens12091080

AMA Style

Shehla S, Ullah F, Alouffi A, Almutairi MM, Khan Z, Tanaka T, Labruna MB, Tsai K-H, Ali A. Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens. 2023; 12(9):1080. https://doi.org/10.3390/pathogens12091080

Chicago/Turabian Style

Shehla, Shehla, Farman Ullah, Abdulaziz Alouffi, Mashal M. Almutairi, Zaibullah Khan, Tetsuya Tanaka, Marcelo B. Labruna, Kun-Hsien Tsai, and Abid Ali. 2023. "Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts" Pathogens 12, no. 9: 1080. https://doi.org/10.3390/pathogens12091080

APA Style

Shehla, S., Ullah, F., Alouffi, A., Almutairi, M. M., Khan, Z., Tanaka, T., Labruna, M. B., Tsai, K. -H., & Ali, A. (2023). Association of SFG Rickettsia massiliae and Candidatus Rickettsia shennongii with Different Hard Ticks Infesting Livestock Hosts. Pathogens, 12(9), 1080. https://doi.org/10.3390/pathogens12091080

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop