Next Article in Journal
Molecular Characterization of Philometra obladae (Nematoda: Philometridae) in Juvenile Oblada melanura (Linnaeus, 1758) from the Tyrrhenian Sea off Sicily, Italy
Previous Article in Journal
Antiviral Development for the Polio Endgame: Current Progress and Future Directions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 13
Issue 11
10.3390/pathogens13110970
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Mycoplasma DNA Using Conventional Polymerase Chain Reaction in Canine Abortion, Stillbirth, and Neonatal Mortality Cases in Central Italy

by
Maria Luisa Marenzoni
1,
Filomena Chierchia
1,
Lakamy Sylla
1,
Elisa Rossi
1,
Michela Beccaglia
2,
Daniele Marini
1,
Iolanda Moretta
1,* and
Vincenzo Cuteri
3
1
Department of Veterinary Medicine, University of Perugia, Via San Costanzo 4, 06126 Perugia, PG, Italy
2
Ambulatorio Beccaglia, Via P.R. Giuliani 32, 20851 Lissone, MB, Italy
3
School of Biosciences and Veterinary Medicine, University of Camerino, Via Circonvallazione 93/95, 62024 Matelica, MC, Italy
*
Author to whom correspondence should be addressed.
Pathogens 2024, 13(11), 970; https://doi.org/10.3390/pathogens13110970
Submission received: 25 September 2024 / Revised: 18 October 2024 / Accepted: 4 November 2024 / Published: 6 November 2024
(This article belongs to the Section Epidemiology of Infectious Diseases)
Versions Notes

Abstract

:
Mycoplasma spp. has been involved in canine infertility, but research on this topic is limited and shows conflicting results, as it has also been isolated from vaginal swabs of healthy dogs. This study aimed to retrospectively research Mycoplasma DNA by a conventional dual Polymerase Chain Reaction from 114 cases of canine abortion, stillbirth, and neonatal mortality that occurred in Central Italy. In addition, four fetal membranes from dystocic dams were analyzed. In total, 7 out of 114 cases (6.14%) and one of the fetal membranes tested positive for Mycoplasma DNA. From five of them (62.5%), other microorganisms were identified, particularly Canid herpesvirus-1 (2/8, 25%) and Escherichia coli, Staphylococcus aureus, and/or Staphylococcus pseudintermedius (3/8, 37.5%), notoriously responsible for infertility in bitches or neonatal mortality. In two different litters, only one puppy of each one tested positive for Mycoplasma DNA. Additionally, Mycoplasma DNA was detected in fetal membranes collected during a cesarean section of a bitch whelping Mycoplasma-negative puppies, supporting that Mycoplasma spp. is part of the normal genital microflora of the female. The detection of Mycoplasma DNA in association with other major pathogens and its detection in the female genital tract without transmission to puppies support the hypothesis that Mycoplasma belongs to the autochthonous genital microflora or, at most, may play a secondary role in canine abortion and neonatal mortality.

1. Introduction

Abortion, stillbirth, and neonatal mortality are significant reproductive issues in canine breeding, with reported incidences ranging from 5% to 35%. The etiology of these reproductive losses is complex and can be broadly categorized into infectious and non-infectious causes [1]. Infectious agents are particularly implicated in the high mortality rates observed during the first week of life. Among the main bacterial pathogens, Staphylococcus spp., Streptococcus spp., and Escherichia coli, Brucella canis are frequently identified as primary causes of pregnancy loss and neonatal death in bitches [2,3,4]. Viral infections, including canine herpesvirus (CHV-1), canine parvovirus (CPV), and canine minute virus, are also recognized contributors to these reproductive failures. Additionally, protozoal infections such as Neospora caninum may rarely result in abortion and neonatal mortality [5]. However, despite comprehensive diagnostic efforts, a considerable percentage of cases remain of unknown etiology, with 55% of canine neonatal deaths, for instance, being attributed to undetermined causes [6]. These undetermined causes may be linked to hereditary or genetic factors (such as lethal genes), placental insufficiencies, hormonal problems, or rare causes, including infectious ones, which are undiagnosed. A previous study has attempted to attribute rare infectious causes to this subset of undiagnosed cases [7], but the possibility of other atypical or less commonly investigated potential etiological agents, such as Mycoplasma, remains.
Mycoplasma species have been implicated in reproductive issues in various species, including canines, but their exact role remains controversial due to their frequent isolation from both healthy and affected individuals [8,9,10].
Mycoplasma spp. (genus currently named Mycoplasmopsis, class Mollicutes, order Mycoplasmatales, family Mycoplasmataceae [11]) have been isolated from the genital tract of both healthy and infertile male and female dogs and are considered part of the normal vaginal flora [12,13,14]. The most common Mycoplasma reported in the urogenital tract is Mycoplasma canis (currently taxonomically named Mycoplasmopsis canis), identified in healthy and infertile dogs, including those with urogenital diseases [8,9,15,16], while M. edwardii (currently taxonomically named Mycoplasmopsis edwardii) is mostly reported in healthy dogs [10]. Other species identified in the genital tract of the dog include M. molare (currently named Mesomycoplasma molare), M. spumans (currently named Metamycoplasma spumans), and M. maculosum (currently named Mycoplasmopsis maculosa), which have variable but generally lower prevalences than M. canis [8,9,10]. Experimental studies have demonstrated the potential role of M. canis as a pathogen [12,17,18], and other Mycoplasma spp. have been associated with canine infertility [16,19,20] or pyometra [21]. However, the existing studies are very limited and somewhat contradictory. Experimental and observational studies have recognized Mycoplasma spp. as a cause of endometritis, abortion, and neonatal mortality in many different species, such as cats, cattle, sheep, goats, and humans [22,23,24,25,26].
Canine mycoplasmas can be considered a model for mycoplasmosis research in the human genital tract due to their taxonomic similarity [20]. Also, canine Mycoplasma can colonize human bodies [27,28].
The specialization in Mycoplasma isolation and the metabolic needs of these bacteria make their identification more difficult than other bacteria [15]. Culture-independent methods, such as biomolecular methods, have been found to be more sensitive for the identification of Mycoplasma species, possibly because the colonization of mucosal tissues is minimal or the viability of the microorganism is often compromised [29].
The purpose of the present study was to retrospectively detect Mycoplasma DNA in a caseload of canine abortion, stillbirth, and neonatal mortality submitted to a veterinary microbiology laboratory to identify infectious agents associated with canine abortion.

2. Materials and Methods

2.1. Sampling

During the period from 2006 to 2019, pools of lung, liver, and/or spleen from fetuses or prematurely dead newborns and, when available, fetal membranes and vaginal swabs of the dam were collected from cases of canine abortion (defined as fetal loss during the second half of pregnancy and characterized by the expulsion of a stillborn or a living incapable of independent life), stillbirth (defined as puppies reported dead at birth), and dead neonatal puppies (defined as puppy death occurred within 28 days of birth) that occurred in Central Italy. The samples were referred to the microbiology laboratory of the Department of Veterinary Medicine of Perugia to be tested for the presence of viral and/or bacterial pathogens. In individual cases, the pool of tissues consisted of other organs (for example, case no. 3, including lung, spleen, and kidney) based on any lesions appreciable at necropsy.
All the data presented in this study were collected during routine diagnostic procedures, and therefore, no specific ethical approval was required. The samples were collected for diagnostic purposes, along with the associated anamnesis. Additionally, the samples were anonymized to ensure privacy and confidentiality.
In this study, a total of 162 specimens were examined, representing 114 cases collected from a minimum of 91 different litters. These included 10 abortions (8.8%), 4 stillbirths (3.5%), 78 cases of neonatal mortality (68.4%), and 22 cases in which the exact age of the newborns was not documented (19.3%). In addition, four fetal membranes from dystocic dams were analyzed. Samples were sent to the laboratory within 24 h of the event (abortion, stillbirth, or neonatal mortality) and were kept at 4 °C until further processing. When the veterinarians were not able to send the samples within 24 h, it was stored frozen and shipped later.
Based on a screening approach that detects the main infectious and non-infectious causes of infertility, abortion, stillbirth, and neonatal mortality, a complete protocol was performed, when possible, including necropsy and histological examinations associated with bacteriological and virological tests. However, economic reasons, method of storage, or delivery of the samples limited the possibility of performing all tests in each case. In particular, bacteriological testing may be compromised, especially for certain bacteria, while molecular tests are less affected by this issue. This is the reason why not all frozen samples were subjected to bacteriological isolation analysis.
The biomolecular method was used to detect the viral agents (Canid herpesvirus-1 and Canine parvovirus), while a standard bacteriological examination (seed onto Blood agar, Mannitol-salt agar, and MacConkey’s agar plates—Oxoid, Milan, Italy), incubated for at least 24 h at 37 °C under aerobic and anaerobic conditions (GasPakTM EZ, Becton Dickinson, Franklin Lakes, NJ, USA), was carried out to detect the main bacterial pathogens. The isolated bacteria were identified by using the MALDI-TOF MS (SOP Direct Transfer Procedure Revision.4; Bruker Microflex Lt®, Bruker Daltonics, Bremen, Germany). If more than three bacterial species were isolated from the same sample, they were considered as contaminants.

2.2. Biomolecular Investigations

DNA extraction from fetal or neonatal tissues was performed using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO, USA). The concentration and purity of the extracted DNA were quantified using a NanoDrop spectrophotometer (NanoDrop2000, ThermoFisher Scientific, Milan, Italy). The extracted DNA was stored at −20 °C until use.
A conventional dual Polymerase Chain Reaction (PCR) protocol targeting the 16S rRNA gene was used to detect Mycoplasma spp. [30,31]. The primers are listed in Table 1. An in silico simulation, as previously described [32], was conducted to confirm the primer specificity for detecting canine Mycoplasma pathogens using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 22 June 2021). PCR products of the expected size were purified using a PCR purification kit (Qiaquick, Qiagen, Italy) and directly sequenced on both strands with the same primers as previously described by a DNA analyzer (ABI 3730, Applied Biosystems, Waltham, MA, USA) capillary sequencer (Bio-Fab Research srl, Rome, Italy). Sequences were assembled and aligned using BioEdit (Version 7.2.5, 2022). Sequence similarity was checked against sequences deposited in GenBank using the BLAST 2.13.0+ (NCBI, Bethesda, MD, USA; released 21 February 2022) to confirm the species specificity of the PCR.

3. Results

3.1. In Silico Analysis

The in silico analysis of the used primers revealed that they were able to simultaneously amplify the DNA of almost all Mycoplasma species isolated in dogs. They do not amplify microorganisms previously classified as Mycoplasma, such as M. haemocanis (currently, class Mollicutes, order Mycoplasmatales, family Mycoplasmataceae, genus Mycoplasma), Acholeplasma (currently, class Mollicutes, order Acholeplasmatales, family Acholeplasmataceae, genus Acholeplasma) and Ureaplasma (currently, class Mollicutes, order Mycoplasmoidales, family Mycoplasmoidaceae, genus Ureaplasma). Moreover, a significant primer identity with Bacillus cereus was detected, highlighting the need to sequence the amplified products to assess the actual identity of the sequences.

3.2. Prevalence of Mycoplasma spp. and Other Pathogens in Abortion and Neonatal Mortality Cases

On the basis of the diagnostic protocol above described, although not systematically investigated, probable causes of abortion and neonatal mortality were identified in 49 out of 114 cases, accounting for 47.6%: CaHV-1 in 7.8% of cases (6 out of 77), and bacteria in the 61.3% (38 out of 62 cases), with E. coli (20/38, 52.6%), Staphylococcus spp. (19/38, 50%), Pseudomonas spp. (8/38, 21%), Proteus spp. (8/38, 21%), Klebsiella spp. (8/38, 21%), Streptococcus spp. (1/38, 2.6%), Enterobacter spp. (1/38, 2.6%), and Enterococcus spp. (1/38, 2.6%). These results are summarized in Table 2.
In total, 7 out of 114 cases (6.14%) and 1 of the analyzed fetal membranes tested positive for Mycoplasma DNA. The results of the Mycoplasma-positive cases, including other microbiological examinations and sequencing, are summarized in Table 3. In five of them (62.5%), other microorganisms were identified in combination, in particular with CaHV-1 (2/8, 25%) and E. coli, Staphylococcus aureus, and/or Staphylococcus pseudintermedius (3/8, 37.5%). In two different litters (cases nos. 2 and 6), only one pup from each one tested positive for Mycoplasma DNA.
Sequencing identified Mycoplasma species already detected in dogs in the genital tract, except for one case of unidentified Mycoplasma previously identified in free-living birds (accession number: KM485604.1), while another uncultured Mycoplasma has already been detected in dogs (accession number: EU772945.1).
Mycoplasma DNA was identified from a vaginal swab and fetal membrane collected during the cesarean section of a bitch whelping Mycoplasma-negative puppies (case no. 9), but sequencing was repeatedly unsuccessful for the sequence detected from the vaginal swab, making it impossible to study their identity. In case no. 8, the Mycoplasma species detected in puppy and vaginal swab were different.

4. Discussion

Mycoplasma has been reported in the canine genital tract. The prevalence of Mycoplasma infection in the genital tract ranges from 17% to approximately 80%, with M. canis being the most represented species [9,10,15,16,33]. However, the detection of Mycoplasma DNA in cases of abortion, stillbirth, and neonatal mortality in dogs has been rarely investigated [2]. In the present study, out of a total of 114 cases of abortion, stillbirth, and neonatal mortality analyzed, together with four cases of fetal membrane and a vaginal swab of the bitch, only eight cases resulted positive for Mycoplasma DNA, revealing that the presence of this pathogen is rare in this kind of samples.
In our caseload, other major pathogens associated with abortion and neonatal mortality were identified in 50%, in agreement with the current literature [2,3,4]; in the remaining cases, it was not possible to perform any bacteriological examination due to the method of storage or because it was not required by the submitting party. It should be remembered that a portion of abortions and perinatal mortality is attributed to non-infective causes, including hereditary genetic causes, lethal genes, placental issues, or may also involve hormonal problems, which constitute a fraction of these deaths [4] and not investigated and reported in the current study. Among infectious agents associated with the presence of Mycoplasma DNA, CaHV-1 was detected in cases nos. 2 and 8, while cases nos. 1 and 6 showed E. coli with or without S. pseudintermedius. These findings are consistent with the existing literature, recognizing these agents as a cause of abortion and neonatal mortality [2,3,4].
Mycoplasma DNA was detected only in some dead puppies of a littermate, both in the presence of other main pathogens (such as cases nos. 2 and 6) and not. This suggests that Mycoplasma spp. is a normal component of the reproductive tract microflora, not responsible for mortality, at least alone, and other factors should be taken into consideration as potential contributors to the mortality. However, additional research and diagnostic testing could help to better define the role of Mycoplasma spp. in these cases (i.e., investigating virulence factors of specific Mycoplasma strains, the immune response of the puppies, or any potential interactions between Mycoplasma and other pathogens or pathological condition in the reproductive tract).
The presence of Mycoplasma in vaginal swabs and fetal membranes from normal pregnancy (case no. 9), which tested positive for Mycoplasma (associated with E. coli and S. aureus), with healthy puppies tested negative after cesarean section, further supports the hypothesis that Mycoplasma may be a normal component of the genital tract. On the contrary, case no. 8 initially suggested a potential mother-to-fetus transmission of Mycoplasma, as both the puppy and the corresponding vaginal swab from the dam tested positive for Mycoplasma. However, sequencing revealed that they were two different Mycoplasma species. More extensive studies on the detection of Mycoplasma DNA during all canine whelping events, including those categorized as normal, could be useful to determine whether Mycoplasma is a part of the normal microbial flora during this specific period in the birth canal.
Sequence typing of these eight Mycoplasma spp. identified species allowed to confirm the species already detected in the genital tract by other authors [8,10,20], except for two cases (nos. 4 and 8) in which uncultured Mycoplasma was detected. Only a few bacterial species, such as M. maculatum and M. spumans, have previously been associated with infertility in dogs [16,19,20,33,34]. The identification of pathogenic roles of different Mycoplasma species in dogs is limited, and not all species are pathogenic or highly virulent [20]. M. cynos, known to be pathogenic in the respiratory system, has also been identified in the genital tract in other studies [8,15,16,35,36,37].
Abnormal detection of Mycoplasma DNA in the intestine was observed in one case (no. 4), although 30% of healthy dogs have been reported to have Mycoplasma in the colon [38].
The lack of complete anamnestic data and the great heterogeneity of the samples limited the evaluation of cases. Additionally, the retrospective nature of the study made it difficult to interpret the epidemiological framework. Specifically, the absence of bacteriological examinations in some samples, the failure to search for other viruses, and incomplete necropsy and histological investigations in cases positive for Mycoplasma prevent conclusive determination of other potential causes of mortality. Considering the overall results, Mycoplasma spp. can be considered a normal component of the microflora or possibly an opportunistic pathogen when present with other primary pathogens. To address these limitations and improve the understanding of the role of Mycoplasma in these kind of samples, a structured surveillance program encompassing a larger number of cases, along with a standardized form for recording clinical signs and potential risk factors, should be implemented.
The present study obtained only qualitative data (presence/absence of bacterial DNA), but future research should explore quantitative aspects to gain a deeper understanding of the role of Mycoplasma, as reproductive tract infections are believed to be caused by overgrowth of normal microflora. Recently, a relative abundance of Mycoplasma has been detected in the endometrial microbiome of dogs with pyometra [21]. However, in another study, the number of microorganisms was not considered a relevant factor, while the duration of the infection, the degree of epithelial damage, or the local immune response were hypothesized to be more relevant in the high quality of the semen [39]. In this specific context, further tests such as immunohistochemistry and in situ hybridization are required to determine the role of mycoplasmas in causing abortion or neonatal mortality, similar to what has been observed in other species [24].

5. Conclusions

The involvement of Mycoplasma in canine abortion and neonatal mortality remains one of the least studied causes, and, in any case, its role seems to be limited. Future investigations should also consider quantitative aspects and examine the specific association of bacteria with the lesions using histological in situ techniques to determine their role in the development of abortion, stillbirth, and neonatal mortality in dogs.

Author Contributions

Conceptualization: M.L.M., F.C. and V.C.; methodology: M.L.M. and F.C.; software: D.M.; investigation: M.L.M., F.C., L.S., E.R., M.B., D.M., V.C. and I.M.; resources: M.L.M., L.S. and I.M.; data curation: F.C.; writing—original draft preparation: M.L.M., E.R. and I.M.; writing—review and editing: L.S., M.B., D.M. and I.M.; supervision: V.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Ethical review and approval were waived for this study because all the data presented were collected during routine diagnostic procedures; the samples were collected for diagnostic purposes, along with the associated anamnesis. Additionally, the samples were anonymized to ensure privacy and confidentiality.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Johnston, S.D.; Raksil, S. Fetal loss in the dog and cat. Vet. Clin. N. Am. Small Anim. Pract. 1987, 17, 535–554. [Google Scholar] [CrossRef] [PubMed]
  2. Givens, M.D.; Marley, M.S.D. Infectious causes of embryonic and fetal mortality. Theriogenology 2008, 70, 270–285. [Google Scholar] [CrossRef] [PubMed]
  3. Münnich, A.; Küchenmeister, U. Causes, diagnosis and therapy of common diseases in neonatal puppies in the first days of life: Cornerstones of practical approach. Reprod. Domest. Anim. 2014, 49, 64–74. [Google Scholar] [CrossRef] [PubMed]
  4. Verstegen, J.; Dhaliwal, G.; Verstegen-Onclin, K. Canine and feline pregnancy loss due to viral and non-infectious causes: A review. Theriogenology 2008, 70, 304–319. [Google Scholar] [CrossRef] [PubMed]
  5. Pretzer, S.D. Bacterial and protozoal causes of pregnancy loss in the bitch and queen. Theriogenology 2008, 70, 320–326. [Google Scholar] [CrossRef]
  6. Blunden, A.S. A review of the fading puppy syndrome (also known as fading puppy complex). Vet. Ann. 1986, 26, 264–269. [Google Scholar]
  7. Stefanetti, V.; Compagnone, A.; Sordini, C.; Passamonti, F.; Rampacci, E.; Moscati, L.; Marenzoni, M.L. Retrospective Biomolecular Investigation of Coxiella burnetii and Leptospira spp. DNA in Cases of Abortion, Stillbirth and Neonatal Mortality in Dogs and Cats. Top Companion Anim. Med. 2018, 33, 122–125. [Google Scholar] [CrossRef]
  8. Spergser, J.; Rosengarten, R. Identification and differentiation of canine Mycoplasma isolates by 16S-23S rDNA PCR-RFLP. Vet. Microbiol. 2007, 125, 170–174. [Google Scholar] [CrossRef]
  9. Maksimović, Z.; Maksimović, A.; Halilbašić, A.; Rifatbegović, M. Genital mycoplasmas of healthy bitches. J. Vet. Diagn. Investig. 2018, 30, 651–653. [Google Scholar] [CrossRef]
  10. Alves, A.B.P.; Dos Santos Machado, L.; de Souza, J.B.; Spenchutt Vieira, G.P.; Dias, T.S.; de Almeida, V.L.; do Nascimento, E.R.; Barreto, M.L.; Da Cunha, N.C. Detection of Mycoplasma species at various anatomical sites of dogs from different types of kennels. Braz. J. Microbiol. 2023, 54, 1251–1255. [Google Scholar] [CrossRef]
  11. Gupta, R.S.; Sawnani, S.; Adeolu, M.; Alnajar, S.; Oren, A. Phylogenetic framework for the phylum Tenericutes based on genome sequence data: Proposal for the creation of a new order Mycoplasmoidales ord. nov., containing two new families Mycoplasmoidaceae fam. nov. and Metamycoplasmataceae fam. nov. harbouring Eperythrozoon, Ureaplasma and five novel genera. Antonie Van Leeuwenhoek 2018, 111, 1583–1630. [Google Scholar] [PubMed]
  12. Rosendal, S. Canine mycoplasmas: Pathogenicity of mycoplasmas associated with distemper pneumonia. J. Infect. Dis. 1978, 138, 203–210. [Google Scholar] [CrossRef]
  13. Baba, E.; Hata, H.; Fukata, T.; Arakawa, A. Vaginal and uterine microflora of adult dogs. Am. J. Vet. Res. 1983, 44, 606–609. [Google Scholar]
  14. Golińska, E.; Sowińska, N.; Tomusiak-Plebanek, A.; Szydło, M.; Witka, N.; Lenarczyk, J.; Strus, M. The vaginal microflora changes in various stages of the estrous cycle of healthy female dogs and the ones with genital tract infections. BMC Vet. Res. 2021, 17, 8. [Google Scholar] [CrossRef] [PubMed]
  15. Chalker, V.J. Canine mycoplasmas. Res. Vet. Sci. 2005, 79, 1–8. [Google Scholar] [CrossRef]
  16. Doig, P.A.; Ruhnke, H.L.; Bosu, W.T. The genital Mycoplasma and Ureaplasma flora of healthy and diseased dogs. Can. J. Comp. Med. 1981, 45, 233–238. [Google Scholar]
  17. Laber, G.; Holzmann, A. Experimentally induced mycoplasmal infection in the genital tract of the male dog: II. Andrological and microbiological investigations after exposure to mycoplasms. Theriogenology 1977, 7, 177–188. [Google Scholar] [CrossRef]
  18. Holzmann, A.; Laber, G.; Walzl, H. Experimentally induced mycoplasmal infection in the genital tract of the female dog. Theriogenology 1979, 12, 355–370. [Google Scholar] [CrossRef]
  19. Tamiozzo, P.J. Mycoplasma maculosum and Mycoplasma spumans associated with fertility disorders in dogs from a Bernese Mountain dog kennel. Rev. Argent Microbiol. 2022, 54, 39–42. [Google Scholar] [CrossRef]
  20. Domrazek, K.; Kaszak, I.; Kanafa, S.; Sacharczuk, M.; Jurka, P. The influence of Mycoplasma species on human and canine semen quality: A review. Asian J. Androl. 2023, 25, 29–37. [Google Scholar] [CrossRef]
  21. Zheng, H.H.; Du, C.T.; Zhang, Y.Z.; Yu, C.; Huang, R.L.; Tang, X.Y.; Xie, G.H. A study on the correlation between intrauterine microbiota and uterine pyogenesis in dogs. Theriogenology 2023, 196, 97–105. [Google Scholar] [CrossRef]
  22. Tan, R.J.; Miles, J.A. Possible role of feline T-strain mycoplasmas in cat abortion. Aust. Vet. J. 1974, 50, 142–145. [Google Scholar] [CrossRef]
  23. Rodríguez, J.L.; de los Monteros, A.E.; Herráez, P.; Poveda, J.B.; Fernández, A. Isolation of Mycoplasma mycoides, mycoides (LC variant), from two naturally aborted caprine fetuses. Theriogenology 1995, 44, 1003–1009. [Google Scholar] [CrossRef]
  24. Hermeyer, K.; Peters, M.; Brügmann, M.; Jacobsen, B.; Hewicker-Trautwein, M. Demonstration of Mycoplasma bovis by immunohistochemistry and in situ hybridization in an aborted bovine fetus and neonatal calf. J. Vet. Diagn. Investig. 2012, 24, 364–369. [Google Scholar] [CrossRef]
  25. Lis, R.; Rowhani-Rahbar, A.; Manhart, L.E. Mycoplasma genitalium infection and female reproductive tract disease: A meta-analysis. Clin. Infect. Dis. 2015, 61, 418–426. [Google Scholar] [CrossRef]
  26. Heidari, S.; Derakhshandeh, A.; Firouzi, R.; Ansari-Lari, M.; Masoudian, M.; Eraghi, V. Molecular detection of Chlamydophila abortus, Coxiella burnetii, and Mycoplasma agalactiae in small ruminants’ aborted fetuses in southern Iran. Trop. Anim. Health Prod. 2018, 50, 779–785. [Google Scholar] [CrossRef]
  27. Klein, S.; Klotz, M.; Eigenbrod, T. First isolation of Mycoplasma canis from human tissue samples after a dog bite. New Microbes New Infect. 2018, 25, 14–15. [Google Scholar] [CrossRef]
  28. Sidrak, D.; Green, J.; Nawathe, P.; Morgan, M.; Soni, P.R. Canine-to-Human Transmission of Mycoplasma canis in the Central Nervous System. J. Pediatr. Infect. Dis. Soc. 2022, 11, 28–30. [Google Scholar] [CrossRef]
  29. Rota, A.; Corrò, M.; Patuzzi, I.; Milani, C.; Masia, S.; Mastrorilli, E.; Petrin, S.; Longo, A.; Del Carro, A.; Losasso, C. Effect of sterilization on the canine vaginal microbiota: A pilot study. BMC Vet. Res. 2020, 16, 455. [Google Scholar] [CrossRef]
  30. Vojdani, A.; Franco, A.R. Multiplex PCR for the detection of Mycoplasma fermentans, M. hominis, and M. penetrans in patients with chronic fatigue syndrome, fibromyalgia, rheumatoid arthritis, and Gulf War syndrome. J. Chronic Fatigue Syndr. 1999, 5, 187–197. [Google Scholar] [CrossRef]
  31. Lierz, M.; Hagen, N.; Harcourt-Brown, N.; Hernandez-Divers, S.J.; Lüschow, D.; Hafez, H.M. Prevalence of mycoplasmas in eggs from birds of prey using culture and a genus-specific mycoplasma polymerase chain reaction. Avian Pathol. 2007, 36, 145–150. [Google Scholar] [CrossRef] [PubMed]
  32. Yu, B.; Zhang, C. In silico PCR analysis. Methods Mol. Biol. 2011, 760, 91–107. [Google Scholar] [PubMed]
  33. Jagódka, D.; Kaczorek-Łukowska, E.; Socha, P.A. The prevalence of Mycoplasma canis in the vaginas of breeding bitches. J. Vet. Res. 2024, 68, 347–353. [Google Scholar] [CrossRef] [PubMed]
  34. Jang, S.S.; Ling, G.V.; Yamamoto, R.; Wolf, A.M. Mycoplasma as a cause of canine urinary tract infection. J. Am. Vet. Med. Assoc. 1984, 185, 45–47. [Google Scholar] [PubMed]
  35. L’Abee-Lund, T.M.; Heiene, R.; Friis, N.F.; Ahrens, P.; Sorum, H. Mycoplasma canis and urogenital disease in dogs in Norway. Vet. Rec. 2003, 153, 231–235. [Google Scholar] [CrossRef]
  36. Lechner, D.; Aurich, J.; Spergser, J.; Aurich, C. Double semen collection at a 1-h interval in dogs decreases the bacterial contamination of canine ejaculates. Theriogenology 2023, 208, 126–131. [Google Scholar] [CrossRef]
  37. Jambhekar, A.; Robin, E.; Le Boedec, K. A systematic review and meta-analyses of the association between 4 Mycoplasma species and lower respiratory tract disease in dogs. J. Vet. Intern. Med. 2019, 33, 1880–1891. [Google Scholar] [CrossRef]
  38. Bowe, P.S.; Van Kruiningen, H.J.; Rosendal, S. Attempts to produce granulomatous colitis in Boxer dogs with a Mycoplasma. Can. J. Comp. Med. 1982, 46, 430–433. [Google Scholar]
  39. Schäfer-Somi, S.; Spergser, J.; Aurich, C. Bacteria and mycoplasms in canine ejaculates: A retrospective survey. Vet. Med. Austria 2009, 96, 240–245. [Google Scholar]
Table 1. Sequences and characteristics of the primers used for Mycoplasma detection.
Table 1. Sequences and characteristics of the primers used for Mycoplasma detection.
PrimerSequence (5′–3′)Amplicon Size (bp)TargetReference
GPFGCTGGCTGTGTGCCTAATACA101316S rRNA gene of Mycoplasma spp.Lierz et al., 2007 [31]
MGSOTGCACCATCTGTCACTCTGTTAACCTC
MCPL-FGGGAGCAAACAGGATTAGATACCCT27316S rRNA gene of generic MycoplasmaVojdani et al., 1999 [30]
MCPL-RTGCACCATCTGTCACTCTGTTAACCTC
Table 2. Results for the pathogen detection and identification in canine abortion and neonatal mortality cases of the present study.
Table 2. Results for the pathogen detection and identification in canine abortion and neonatal mortality cases of the present study.
Causes of Abortion and Neonatal MortalityNumber of Cases out of Number of Samples Investigated (Percentage)
Viral Causes
Canine Herpesvirus 1 (CaHV-1)6/77 (7.8%)
Bacterial Causes38/62 (61.3%)
Escherichia coli20/38 (52.6%)
Staphylococcus spp.19/38 (50%)
Pseudomonas spp.8/38 (21%)
Proteus spp.8/38 (21%)
Klebsiella spp.8/38 (21%)
Streptococcus spp.1/38 (2.6%)
Enterobacter spp.1/38 (2.6%)
Enterococcus spp.1/38 (2.6%)
Mycoplasma-positive cases8/114 (7%)
Mycoplasma-positive cases identified in combination with additional microorganisms5/8 (62.5%)
Combined with CaHV-12/8 (25%)
Combined with E. coli, Staphylococcus aureus, and/or Staphylococcus pseudintermedius3/8 (37.5%)
Total cases investigated114 *
* The total number of investigated cases does not reflect the overall number of samples examined reported in the column, as some samples were subjected to both bacteriological and virological testing, while others were only tested for specific pathogens.
Table 3. Summary of Mycoplasma DNA-positive cases: sample types, sequencing results, virological, and bacteriological examinations for each case.
Table 3. Summary of Mycoplasma DNA-positive cases: sample types, sequencing results, virological, and bacteriological examinations for each case.
Case No.Type of SamplesHistoryResults of Sequencing *CaHV-1 PCR ResultBacteriological Examination
1Pool of tissuesPuppy, 7 days old, died without microscopic lesions; the entire litter is deceased.Mycoplasmopsis canis (99% with LR215010.1) or Mycoplasmopsis cynos (99% with HF559394.1)-Staphylococcus pseudintermedius, Escherichia coli
2Pool of tissuesPuppy, 15 days old. The entire litter perished at 8–15 days of life. They did not receive colostrum. The dam was vaccinated against CHV-1.Mycoplasmopsis canis (100% with LR215010.1)+Not executed
3Gut and pool of tissues (lung, spleen, and kidney, LSK)Puppy, 28 days old, died. It comes from a breeding farm where another 60 puppies died due to Canine parvovirus infection.Gut: Mycoplasmopsis cynos (100% with HF559394.1)
LSK: Mycoplasmopsis cynos (99% with HF559394.1)		-Not executed
4GutPuppy died at 15 days of life. The other littermates were healthy.Uncultured bacterium (100% with HM330539.1; EU772945.1)Not executedNot executed
5KidneyAutolytic aborted fetus.Metamycoplasma spumans (100% with NR_113678.1)-Not executed
6Pool of tissuesPuppy from a litter from which 7 out of 11 puppies died. The dam was vaccinated against CHV-1.Mycoplasmopsis edwardii
(100% with LS991951.1)		-Escherichia coli
7Pool of tissuesFour puppies died at 24 h of life with hepatic lesions.Mycoplasmopsis canis (100% with LR215010.1)-Not executed
8Pool of tissues and vaginal swab (VS) of the bitchFour-day-old pup.Pool of tissues: uncultured Mycoplasma (100% with KM485604.1)
VS: Mycoplasmopsis edwardii (100% with LS991951.1)		+Not executed
9Fetal membrane and vaginal swab (VS) of the bitchCesarean section due to dystocia; all puppies were healthy.VS: repeatedly unsequentiable
Fetal membrane: Mycoplasmopsis canis (100% with LR215010.1)		-Escherichia coli, Staphylococcus aureus, Proteus sp. (probably contaminant)
* Percentage of identity and accession number of the reference microorganism.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Marenzoni, M.L.; Chierchia, F.; Sylla, L.; Rossi, E.; Beccaglia, M.; Marini, D.; Moretta, I.; Cuteri, V. Detection of Mycoplasma DNA Using Conventional Polymerase Chain Reaction in Canine Abortion, Stillbirth, and Neonatal Mortality Cases in Central Italy. Pathogens 2024, 13, 970. https://doi.org/10.3390/pathogens13110970

AMA Style

Marenzoni ML, Chierchia F, Sylla L, Rossi E, Beccaglia M, Marini D, Moretta I, Cuteri V. Detection of Mycoplasma DNA Using Conventional Polymerase Chain Reaction in Canine Abortion, Stillbirth, and Neonatal Mortality Cases in Central Italy. Pathogens. 2024; 13(11):970. https://doi.org/10.3390/pathogens13110970

Chicago/Turabian Style

Marenzoni, Maria Luisa, Filomena Chierchia, Lakamy Sylla, Elisa Rossi, Michela Beccaglia, Daniele Marini, Iolanda Moretta, and Vincenzo Cuteri. 2024. "Detection of Mycoplasma DNA Using Conventional Polymerase Chain Reaction in Canine Abortion, Stillbirth, and Neonatal Mortality Cases in Central Italy" Pathogens 13, no. 11: 970. https://doi.org/10.3390/pathogens13110970

APA Style

Marenzoni, M. L., Chierchia, F., Sylla, L., Rossi, E., Beccaglia, M., Marini, D., Moretta, I., & Cuteri, V. (2024). Detection of Mycoplasma DNA Using Conventional Polymerase Chain Reaction in Canine Abortion, Stillbirth, and Neonatal Mortality Cases in Central Italy. Pathogens, 13(11), 970. https://doi.org/10.3390/pathogens13110970

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop