Development of a Quadruplex RT-qPCR for the Detection of Porcine Astrovirus, Porcine Sapovirus, Porcine Norovirus, and Porcine Rotavirus A
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reference Strains
2.2. Clinical Samples
2.3. Primers and Probes
2.4. Nucleic Acids
2.5. Standard Plasmid Constructs
2.6. Reaction Parameters
2.7. Standard Curves
2.8. Analytical Specificity
2.9. Analytical Sensitivity
2.10. Repeatability Analysis
2.11. Assessment Using Clinical Samples
3. Results
3.1. Construction of the Standard Plasmids
3.2. Attainment of the Reaction Conditions
3.3. Generation of the Standard Curves
3.4. Specificity
3.5. Sensitivity
3.6. Repeatability
3.7. Assessment Results of Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rawal, G.; Linhares, D.C.L. Scoping Review on the Epidemiology, Diagnostics and Clinical Significance of Porcine Astroviruses. Transbound. Emerg. Dis. 2022, 69, 974–985. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.V.; Piewbang, C.; Techangamsuwan, S. Genetic Characterization of Canine Astrovirus in Non-Diarrhea Dogs and Diarrhea Dogs in Vietnam and Thailand Reveals the Presence of a Unique Lineage. Front. Vet. Sci. 2023, 10, 1278417. [Google Scholar] [CrossRef] [PubMed]
- Shan, T.; Wang, C.; Tong, W.; Zheng, H.; Hua, X.; Yang, S.; Guo, Y.; Zhang, W.; Tong, G. Complete Genome of a Novel Porcine Astrovirus. J. Virol. 2012, 86, 13820–13821. [Google Scholar] [CrossRef] [PubMed]
- Fang, Q.; Wang, C.; Liu, H.; Wu, Q.; Liang, S.; Cen, M.; Dong, Q.; Wei, Y.; Chen, Y.; Ouyang, K.; et al. Pathogenic Characteristics of a Porcine Astrovirus Strain Isolated in China. Viruses 2019, 11, 1156. [Google Scholar] [CrossRef] [PubMed]
- Vaishali; Gupta, R.; Kumar, M.; Bansal, N.; Vivek; Kumar, P.; Kumar, P.; Jindal, N. Coinfection of Porcine Astrovirus and Other Porcine Viruses in Diarrheic Pigs in Haryana, India. Arch. Virol. 2023, 168, 246. [Google Scholar] [CrossRef]
- Umair, M.; Rehman, Z.; Haider, S.A.; Usman, M.; Rana, M.S.; Ikram, A.; Salman, M. First Report of Coinfection and Whole-Genome Sequencing of Norovirus and Sapovirus in an Acute Gastroenteritis Patient from Pakistan. J. Med. Virol. 2023, 95, e28458. [Google Scholar] [CrossRef]
- Hoque, S.A.; Pham, N.T.K.; Onda-Shimizu, Y.; Nishimura, S.; Sugita, K.; Kobayashi, M.; Islam, M.T.; Okitsu, S.; Khamrin, P.; Maneekarn, N.; et al. Sapovirus Infections in Japan before and after the Emergence of the COVID-19 Pandemic: An Alarming Update. J. Med. Virol. 2023, 95, e29023. [Google Scholar] [CrossRef]
- Saif, L.J.; Bohl, E.H.; Theil, K.W.; Cross, R.F.; House, J.A. Rotavirus-Like, Calicivirus-Like, and 23-Nm Virus-Like Particles Associated with Diarrhea in Young Pigs. J. Clin. Microbiol. 1980, 12, 105–111. [Google Scholar] [CrossRef]
- Nagai, M.; Wang, Q.; Oka, T.; Saif, L.J. Porcine Sapoviruses: Pathogenesis, Epidemiology, Genetic Diversity, and Diagnosis. Virus Res. 2020, 286, 198025. [Google Scholar] [CrossRef]
- Yinda, C.K.; Conceição-Neto, N.; Zeller, M.; Heylen, E.; Maes, P.; Ghogomu, S.M.; Van Ranst, M.; Matthijnssens, J. Novel Highly Divergent Sapoviruses Detected by Metagenomics Analysis in Straw-Colored Fruit Bats in Cameroon. Emerg. Microbes Infect. 2017, 6, e38. [Google Scholar] [CrossRef]
- Wang, L.; Marthaler, D.; Fredrickson, R.; Gauger, P.C.; Zhang, J.; Burrough, E.R.; Petznick, T.; Li, G. Genetically Divergent Porcine Sapovirus Identified in Pigs, United States. Transbound. Emerg. Dis. 2020, 67, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Shen, Q.; Hua, X.; Cui, L.; Liu, J.; Yang, S. The First Chinese Porcine Sapovirus Strain That Contributed to an Outbreak of Gastroenteritis in Piglets. J. Virol. 2008, 82, 8239–8240. [Google Scholar] [CrossRef] [PubMed]
- Young, V.L.; McSweeney, A.M.; Edwards, M.J.; Ward, V.K. The Disorderly Nature of Caliciviruses. Viruses 2024, 16, 1324. [Google Scholar] [CrossRef] [PubMed]
- Cotton, M.; Petrova, V.; Phan, M.V.; Rabaa, M.A.; Watson, S.J.; Ong, S.H.; Kellam, P.; Baker, S. Deep Sequencing of Norovirus Genomes Defines Evolutionary Patterns in An Urban Tropical Setting. J. Virol. 2014, 88, 11056–11069. [Google Scholar] [CrossRef]
- Di Bartolo, I.; Tofani, S.; Angeloni, G.; Ponterio, E.; Ostanello, F.; Ruggeri, F.M. Detection and Characterization of Porcine Caliciviruses in Italy. Arch. Virol. 2014, 159, 2479–2484. [Google Scholar] [CrossRef]
- Chhabra, P.; de Graaf, M.; Parra, G.I.; Chan, M.C.W.; Green, K.; Martella, V.; Wang, Q.; White, P.A.; Katayama, K.; Vennema, H.; et al. Updated Classification of Norovirus Genogroups and Genotypes. J. Gen. Virol. 2019, 100, 1393–1406. [Google Scholar] [CrossRef]
- Sugieda, M.; Nagaoka, H.; Kakishima, Y.; Ohshita, T.; Nakamura, S.; Nakajima, S. Detection of Norwalk-Like Virus Genes in the Caecum Contents of Pigs. Arch. Virol. 1998, 143, 1215–1221. [Google Scholar] [CrossRef]
- Cavicchio, L.; Tassoni, L.; Laconi, A.; Cunial, G.; Gagliazzo, L.; Milani, A.; Campalto, M.; Di Martino, G.; Forzan, M.; Monne, I.; et al. Author Correction: Unrevealed Genetic Diversity of GII Norovirus in the Swine Population of North East Italy. Sci. Rep. 2020, 10, 12522. [Google Scholar] [CrossRef]
- Cavicchio, L.; Laconi, A.; Piccirillo, A.; Beato, M.S. Swine Norovirus: Past, Present, and Future. Viruses 2022, 14, 537. [Google Scholar] [CrossRef]
- Yu, F.; Jiang, B.; Guo, X.; Hou, L.; Tian, Y.; Zhang, J.; Li, Q.; Jia, L.; Yang, P.; Wang, Q.; et al. Norovirus Outbreaks in China, 2000-2018: A Systematic Review. Rev. Med. Virol. 2022, 32, e2382. [Google Scholar] [CrossRef]
- Kumar, D.; Shepherd, F.K.; Springer, N.L.; Mwangi, W.; Marthaler, D.G. Rotavirus Infection in Swine: Genotypic Diversity, Immune Responses, and Role of Gut Microbiome in Rotavirus Immunity. Pathog. Basel Switz. 2022, 11, 1078. [Google Scholar] [CrossRef] [PubMed]
- Campanha, J.E.T.; Possatti, F.; Lorenzetti, E.; de Almeida Moraes, D.; Alfieri, A.F.; Alfieri, A.A. Longitudinal Study of Rotavirus C VP6 Genotype I6 in Diarrheic Piglets up to 1 Week Old. Braz. J. Microbiol. Publ. Braz. Soc. Microbiol. 2020, 51, 1345–1351. [Google Scholar] [CrossRef] [PubMed]
- Patton, J.T. Rotavirus Diversity and Evolution in the Post-Vaccine World. Discov. Med. 2012, 13, 85–97. [Google Scholar] [PubMed]
- Joshi, M.S.; Arya, S.A.; Shinde, M.S.; Ingle, V.C.; Birade, H.S.; Gopalkrishna, V. Rotavirus C Infections in Asymptomatic Piglets in India, 2009-2013: Genotyping and Phylogenetic Analysis of All Genomic Segments. Arch. Virol. 2022, 167, 2665–2675. [Google Scholar] [CrossRef] [PubMed]
- Genz, B.; Gerszon, J.; Pollock, Y.; Gleeson, B.; Shankar, R.; Sellars, M.J.; Moser, R.J. Detection and Genetic Diversity of Porcine Rotavirus A, B and C in Eastern Australian Piggeries. Aust. Vet. J. 2023, 101, 153–163. [Google Scholar] [CrossRef]
- Rodger, S.M.; Craven, J.A.; Williams, I. Letter: Demonstration of Reovirus-Like Particles in Intestinal Contents of Piglets with Diarrhoea. Aust. Vet. J. 1975, 51, 536. [Google Scholar] [CrossRef]
- Díaz Alarcón, R.G.; Liotta, D.J.; Miño, S. Zoonotic RVA: State of the Art and Distribution in the Animal World. Viruses 2022, 14, 2554. [Google Scholar] [CrossRef]
- Werid, G.M.; Zhang, H.; Ibrahim, Y.M.; Pan, Y.; Zhang, L.; Xu, Y.; Zhang, W.; Wang, W.; Chen, H.; Fu, L.; et al. Development of a Multiplex RT-PCR Assay for Simultaneous Detection of Four Potential Zoonotic Swine RNA Viruses. Vet. Sci. 2022, 9, 176. [Google Scholar] [CrossRef]
- Zhang, H.; Yan, Z.; Wang, X.; Gaňová, M.; Chang, H.; Laššáková, S.; Korabecna, M.; Neuzil, P. Determination of Advantages and Limitations of qPCR Duplexing in a Single Fluorescent Channel. ACS Omega 2021, 6, 22292–22300. [Google Scholar] [CrossRef]
- Kralik, P.; Ricchi, M. A Basic Guide to Real Time PCR in Microbial Diagnostics: Definitions, Parameters, and Everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef]
- Padmanabhan, A.; Hause, B.M. Detection and Characterization of a Novel Genotype of Porcine Astrovirus 4 from Nasal Swabs from Pigs with Acute Respiratory Disease. Arch. Virol. 2016, 161, 2575–2579. [Google Scholar] [CrossRef] [PubMed]
- Stamelou, E.; Giantsis, I.A.; Papageorgiou, K.V.; Petridou, E.; Davidson, I.; Polizopοulou, Z.S.; Papa, A.; Kritas, S.K. Epidemiology of Astrovirus, Norovirus and Sapovirus in Greek Pig Farms Indicates High Prevalence of Mamastrovirus Suggesting the Potential Need for Systematic Surveillance. Porc. Health Manag. 2022, 8, 5. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.; Zhang, J.; Gauger, P.C.; Burrough, E.R.; Zhang, J.; Harmon, K.; Wang, L.; Zheng, Y.; Petznick, T.; Li, G. Genetic Characterization of Porcine Sapoviruses Identified from Pigs during a Diarrhoea Outbreak in Iowa, 2019. Transbound. Emerg. Dis. 2022, 69, 1246–1255. [Google Scholar] [CrossRef] [PubMed]
- Mauroy, A.; Van der Poel, W.H.M.; der Honing, R.H.V.; Thys, C.; Thiry, E. Development and Application of a SYBR Green RT-PCR for First Line Screening and Quantification of Porcine Sapovirus Infection. BMC Vet. Res. 2012, 8, 193. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Hou, X.; Xiao, G.; Liu, B.; Jia, H.; Wei, J.; Mi, X.; Guo, Q.; Wei, Y.; Zhai, S.L. Emergence of a Novel G4P[6] Porcine Rotavirus with Unique Sequence Duplication in NSP5 Gene in China. Animals 2024, 14, 1790. [Google Scholar] [CrossRef]
- Wolf, S.; Williamson, W.; Hewitt, J.; Lin, S.; Rivera-Aban, M.; Ball, A.; Scholes, P.; Savill, M.; Greening, G.E. Molecular Detection of Norovirus in Sheep and Pigs in New Zealand Farms. Vet. Microbiol. 2009, 133, 184–189. [Google Scholar] [CrossRef]
- Shi, K.; Zhou, H.; Feng, S.; He, J.; Li, B.; Long, F.; Shi, Y.; Yin, Y.; Li, Z. Development of a Quadruplex RT-qPCR for the Detection of Porcine Rotaviruses and the Phylogenetic Analysis of Porcine RVH in China. Pathogens 2023, 12, 1091. [Google Scholar] [CrossRef]
- Ferrari, E.; Salogni, C.; Martella, V.; Alborali, G.L.; Scaburri, A.; Boniotti, M.B. Assessing the Epidemiology of Rotavirus A, B, C and H in Diarrheic Pigs of Different Ages in Northern Italy. Pathogens 2022, 11, 467. [Google Scholar] [CrossRef]
- Létourneau, V.; Gagné, M.J.; Vyskocil, J.M.; Brochu, V.; Robitaille, K.; Gauthier, M.; Brassard, J.; Duchaine, C. Hunting for a Viral Proxy in Bioaerosols of Swine Buildings Using Molecular Detection and Metagenomics. J. Environ. Sci. 2025, 148, 69–78. [Google Scholar] [CrossRef]
- Wilhelm, B.; Leblanc, D.; Houde, A.; Brassard, J.; Gagné, M.J.; Plante, D.; Bellon-Gagnon, P.; Jones, T.H.; Muehlhauser, V.; Janecko, N.; et al. Survey of Canadian Retail Pork Chops and Pork Livers for Detection of Hepatitis E Virus, Norovirus, and Rotavirus Using Real Time RT-PCR. Int. J. Food Microbiol. 2014, 185, 33–40. [Google Scholar] [CrossRef]
- Liu, H.; Shi, K.; Zhao, J.; Yin, Y.; Chen, Y.; Si, H.; Qu, S.; Long, F.; Lu, W. Development of a One-Step Multiplex qRT-PCR Assay for the Detection of African Swine Fever Virus, Classical Swine Fever Virus and Atypical Porcine Pestivirus. BMC Vet. Res. 2022, 18, 43. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, W.; Wang, D.; Zhu, X.; Chen, Y.; Ouyang, K.; Wei, Z.; Liu, H.; Huang, W. Establishment of a Multiplex RT-PCR Method for the Detection of Five Known Genotypes of Porcine Astroviruses. Front. Vet. Sci. 2021, 8, 684279. [Google Scholar] [CrossRef] [PubMed]
- Su, M.; Qi, S.; Yang, D.; Guo, D.; Yin, B.; Sun, D. Coinfection and Genetic Characterization of Porcine Astrovirus in Diarrheic Piglets in China From 2015 to 2018. Front. Vet. Sci. 2020, 7, 462. [Google Scholar] [CrossRef] [PubMed]
- Qin, Y.; Fang, Q.; Li, X.; Li, F.; Liu, H.; Wei, Z.; Ouyang, K.; Chen, Y.; Huang, W. Molecular Epidemiology and Viremia of Porcine Astrovirus in Pigs from Guangxi Province of China. BMC Vet. Res. 2019, 15, 471. [Google Scholar] [CrossRef] [PubMed]
- Dufkova, L.; Scigalkova, I.; Moutelikova, R.; Malenovska, H.; Prodelalova, J. Genetic Diversity of Porcine Sapoviruses, Kobuviruses, and Astroviruses in Asymptomatic Pigs: An Emerging New Sapovirus GIII Genotype. Arch. Virol. 2013, 158, 549–558. [Google Scholar] [CrossRef]
- Liu, X.; Song, C.; Liu, Y.; Qu, K.; Bi, J.; Bi, J.; Wang, Y.; Yang, Y.; Sun, J.; Guo, Z.; et al. High Genetic Diversity of Porcine Sapovirus from Diarrheic Piglets in Yunnan Province, China. Front. Vet. Sci. 2022, 9, 854905. [Google Scholar] [CrossRef]
- Wang, Q.H.; Costantini, V.; Saif, L.J. Porcine Enteric Caliciviruses: Genetic and Antigenic Relatedness to Human Caliciviruses, Diagnosis and Epidemiology. Vaccine 2007, 25, 5453–5466. [Google Scholar] [CrossRef]
- Wang, Q.H.; Chang, K.O.; Han, M.G.; Sreevatsan, S.; Saif, L.J. Development of a New Microwell Hybridization Assay and an Internal Control RNA for the Detection of Porcine Noroviruses and Sapoviruses by Reverse Transcription-PCR. J. Virol. Methods 2006, 132, 135–145. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Vlasova, A.N.; Kenney, S.P.; Saif, L.J. Emerging and Re-Emerging Coronaviruses in Pigs. Curr. Opin. Virol. 2019, 34, 39–49. [Google Scholar] [CrossRef]
- Tao, R.; Chang, X.; Zhou, J.; Zhu, X.; Yang, S.; Li, K.; Gu, L.; Zhang, X.; Li, B. Molecular Epidemiological Investigation of Group A Porcine Rotavirus in East China. Front. Vet. Sci. 2023, 10, 1138419. [Google Scholar] [CrossRef]
- Vlasova, A.N.; Amimo, J.O.; Saif, L.J. Porcine Rotaviruses: Epidemiology, Immune Responses and Control Strategies. Viruses 2017, 9, 48. [Google Scholar] [CrossRef] [PubMed]
- Neira, V.; Melgarejo, C.; Urzúa-Encina, C.; Berrios, F.; Valdes, V.; Mor, S.; Brito-Rodriguez, B.; Ramirez-Toloza, G.A. Identification and characterization of porcine Rotavirus A in Chilean swine population. Front. Vet. Sci. 2023, 10, 1240346. [Google Scholar] [CrossRef] [PubMed]
- Werid, G.M.; Ibrahim, Y.M.; Chen, H.; Fu, L.; Wang, Y. Molecular Detection and Genetic Characterization of Potential Zoonotic Swine Enteric Viruses in Northern China. Pathogens 2022, 11, 417. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.H.; Kobayashi, N.; Nagashima, S.; Zhou, X.; Ghosh, S.; Peng, J.S.; Hu, Q.; Zhou, D.J.; Yang, Z.Q. Full Genomic Analysis of a Porcine-Bovine Reassortant G4P[6] Rotavirus Strain R479 Isolated from an Infant in China. J. Med. Virol. 2010, 82, 1094–1102. [Google Scholar] [CrossRef] [PubMed]
- Wu, F.T.; Liu, L.T.C.; Jiang, B.; Kuo, T.Y.; Wu, C.Y.; Liao, M.H. Prevalence and Diversity of Rotavirus A in Pigs: Evidence for a Possible Reservoir in Human Infection. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2022, 98, 105198. [Google Scholar] [CrossRef]
Primer/Probe | Sequence (5′ → 3′) | Gene | Tm/°C | Size (bp) |
---|---|---|---|---|
PoAstV-F | GATTTACAGTTGGCCCAGA | ORF1 | 56.2 | 116 |
PoAstV-R | GAGTTTCCCATGCAGCG | 56.6 | ||
PoAstV-P | ROX-CCCACTGATGAAGAGAAACTCTATGCT-BHQ2 | 62.3 | ||
PoSaV-F | GGCCAACGCAGTGGCAAC | ORF1 | 61.6 | 96 |
PoSaV-R | ATCACGAACACTTCTGGCTC | 58.3 | ||
PoSaV-P | CY5-GCATGGTACGGTGGCACTGACGG-BHQ3 | 66.4 | ||
PoNoV-F | GGACCTCCTTGCCCCCA | ORF1 | 59.9 | 135 |
PoNoV-R | GACATGGCACAGAGRGTGAT | 57.9 | ||
PoNoV-F | VIC-ACATCACAATGGAACTCCTTTGCCC-BHQ1 | 63.4 | ||
PoRVA-F | TGACACCAGCAGTTGCA | VP6 | 54.9 | 99 |
PoRVA-R | ATTCACAAACTGCAGATTCA | 54.1 | ||
PoRVA-P | FAM-AGCACCACCATTTATATTTCATGCTAC-BHQ1 | 60 |
Ingredient | Volume (µL) | Final Concentration (nM) |
---|---|---|
2× One Step RT-PCR Buffer III | 10.0 | / |
Ex Taq HS (5 U/µL) | 0.4 | / |
PrimeScript RT Enzyme Mix II | 0.4 | / |
PoAstV-F | 0.2 | 200 |
PoAstV-R | 0.2 | 200 |
PoAstV-P | 0.2 | 200 |
PoSaV-F | 0.2 | 200 |
PoSaV-R | 0.2 | 200 |
PoSaV-P | 0.2 | 200 |
PoNoV-F | 0.4 | 400 |
PoNoV-R | 0.4 | 400 |
PoNoV-P | 0.3 | 300 |
PoRVA-F | 0.3 | 300 |
PoRVA-R | 0.3 | 300 |
PoRVA- P | 0.2 | 200 |
Total Nucleic Acid | 2.0 | / |
Nuclease-Free Distilled Water | Up to 20.0 | / |
Plasmid Constructs | Copies/Reaction | Number of Samples | Quadruplex RT-qPCR | |
---|---|---|---|---|
Ct Value (Average) | Hit Rate (%) | |||
p-PoAstV | 500 | 28 | 34.81 | 100 |
250 | 28 | 35.36 | 100 | |
125 | 28 | 35.86 | 85.71 | |
62.5 | 28 | Not Detected | 0 | |
p-PoSaV | 500 | 28 | 34.67 | 100 |
250 | 28 | 35.24 | 100 | |
125 | 28 | 35.83 | 89.29 | |
62.5 | 28 | Not Detected | 0 | |
p-PoNoV | 500 | 28 | 34.22 | 100 |
250 | 28 | 34.87 | 100 | |
125 | 28 | 35.45 | 82.14 | |
62.5 | 28 | Not Detected | 0 | |
p-PoRVA | 500 | 28 | 34.35 | 100 |
250 | 28 | 34.88 | 100 | |
125 | 28 | 35.36 | 92.86 | |
62.5 | 28 | Not Detected | 0 |
Plasmid Constructs | Concentration (Copies/μL) | Ct Values of Intra-Assay | Ct Values of Inter-Assay | ||||
---|---|---|---|---|---|---|---|
SD | CV (%) | SD | CV (%) | ||||
p-PoAstV | 107 | 15.585 | 0.17 | 1.08 | 15.437 | 0.09 | 0.57 |
105 | 23.470 | 0.11 | 0.45 | 23.437 | 0.08 | 0.34 | |
103 | 27.900 | 0.02 | 0.09 | 27.928 | 0.02 | 0.08 | |
p-PoSaV | 107 | 17.208 | 0.11 | 0.65 | 17.415 | 0.12 | 0.80 |
105 | 25.339 | 0.31 | 1.23 | 25.474 | 0.26 | 1.03 | |
103 | 29.341 | 0.11 | 0.35 | 29.161 | 0.13 | 0.44 | |
p-PoNoV | 107 | 17.185 | 0.21 | 1.24 | 17.272 | 0.11 | 0.65 |
105 | 25.042 | 0.11 | 0.45 | 25.442 | 0.09 | 0.35 | |
103 | 30.014 | 0.06 | 0.21 | 29.641 | 0.17 | 0.58 | |
p-PoRVA | 107 | 16.713 | 0.15 | 0.92 | 16.295 | 0.18 | 1.11 |
105 | 24.468 | 0.07 | 0.28 | 24.309 | 0.15 | 0.62 | |
103 | 29.038 | 0.12 | 0.41 | 29.212 | 0.15 | 0.50 |
City | Positive Sample | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Number | PoAstV | PoSaV | PoNoV | PoRVA | A + S | A + N | A + R | S + N | S + R | N + R | A + S + N | A + S + R | A + N + R | S + N + R | A + S + N + R | |
Fangchenggang | 80 | 30 | 0 | 0 | 9 | 0 | 0 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Liuzhou | 69 | 42 | 5 | 5 | 3 | 2 | 1 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Nanning | 162 | 77 | 45 | 20 | 30 | 26 | 12 | 24 | 5 | 8 | 6 | 10 | 6 | 14 | 6 | 6 |
Chongzuo | 45 | 14 | 20 | 0 | 0 | 10 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Yulin | 125 | 44 | 20 | 14 | 0 | 10 | 9 | 0 | 3 | 0 | 0 | 2 | 0 | 0 | 0 | 0 |
Guigang | 286 | 122 | 27 | 0 | 43 | 6 | 0 | 23 | 0 | 4 | 0 | 0 | 4 | 0 | 0 | 0 |
Baise | 593 | 149 | 15 | 4 | 125 | 14 | 0 | 56 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Hezhou | 30 | 6 | 0 | 2 | 3 | 0 | 2 | 3 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Hechi | 21 | 12 | 0 | 2 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Beihai | 20 | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Laibin | 23 | 8 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Wuzhou | 54 | 30 | 0 | 0 | 10 | 0 | 0 | 7 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Qinzhou | 50 | 23 | 0 | 0 | 3 | 0 | 0 | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Guilin | 20 | 6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Total (%) | 1578 | 567 (35.93%) | 132 (8.37%) | 47 (2.98%) | 226 (14.32%) | 68 (4.31%) | 26 (1.65%) | 121 (7.67%) | 8 (0.51%) | 12 (0.76%) | 6 (0.38%) | 12 (0.76%) | 10 (0.63%) | 14 (0.89%) | 6 (0.38%) | 6 (0.38%) |
The Established Assay | The Reference Assay | Total | Clinical Sensitivity (95% CI) | Clinical Specificity (95% CI) | ||
---|---|---|---|---|---|---|
Positive | Negative | |||||
PoAstV | Positive | 560 | 7 | 567 | 99.64% (98.71–99.90%) | 99.31% (98.58–99.67%) |
Negative | 2 | 1009 | 1011 | |||
Total | 562 | 1016 | 1578 | |||
PoSaV | Positive | 129 | 3 | 132 | 99.23% (95.77–99.86%) | 99.79% (99.50–99.96%) |
Negative | 1 | 1445 | 1446 | |||
Total | 130 | 1448 | 1578 | |||
PoNoV | Positive | 47 | 0 | 47 | 100.00% (92.44–100.00%) | 100.00% (99.75–100.00%) |
Negative | 0 | 1531 | 1531 | |||
Total | 47 | 1531 | 1578 | |||
PoRVA | Positive | 222 | 4 | 226 | 99.55% (97.50–99.92%) | 99.70% (99.33–99.90%) |
Negative | 1 | 1351 | 1352 | |||
Total | 223 | 1355 | 1578 |
Method | Positive Samples | |||
---|---|---|---|---|
PoAstV | PoSaV | PoNoV | PoRVA | |
The Developed Multiplex RT-qPCR | 35.93% (567/1578) | 8.37% (132/1578) | 2.98% (47/1578) | 14.32% (226/1578) |
The Reported Reference RT-qPCR | 35.61% (562/1578) | 8.24% (130/1578) | 2.98% (47/1578) | 14.13% (223/1578) |
Agreements | 99.43% | 99.75% | 100% | 99.68% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, J.; Shi, K.; Shi, Y.; Yin, Y.; Feng, S.; Long, F.; Qu, S.; Song, X. Development of a Quadruplex RT-qPCR for the Detection of Porcine Astrovirus, Porcine Sapovirus, Porcine Norovirus, and Porcine Rotavirus A. Pathogens 2024, 13, 1052. https://doi.org/10.3390/pathogens13121052
He J, Shi K, Shi Y, Yin Y, Feng S, Long F, Qu S, Song X. Development of a Quadruplex RT-qPCR for the Detection of Porcine Astrovirus, Porcine Sapovirus, Porcine Norovirus, and Porcine Rotavirus A. Pathogens. 2024; 13(12):1052. https://doi.org/10.3390/pathogens13121052
Chicago/Turabian StyleHe, Junxian, Kaichuang Shi, Yuwen Shi, Yanwen Yin, Shuping Feng, Feng Long, Sujie Qu, and Xingju Song. 2024. "Development of a Quadruplex RT-qPCR for the Detection of Porcine Astrovirus, Porcine Sapovirus, Porcine Norovirus, and Porcine Rotavirus A" Pathogens 13, no. 12: 1052. https://doi.org/10.3390/pathogens13121052
APA StyleHe, J., Shi, K., Shi, Y., Yin, Y., Feng, S., Long, F., Qu, S., & Song, X. (2024). Development of a Quadruplex RT-qPCR for the Detection of Porcine Astrovirus, Porcine Sapovirus, Porcine Norovirus, and Porcine Rotavirus A. Pathogens, 13(12), 1052. https://doi.org/10.3390/pathogens13121052