Establishment of a Quadruplex RT-qPCR for the Detection of Canine Coronavirus, Canine Respiratory Coronavirus, Canine Adenovirus Type 2, and Canine Norovirus
Abstract
1. Introduction
2. Materials and Methods
2.1. Reference Strains
2.2. Positive Samples
2.3. Clinical Samples
2.4. Extraction of Nucleic Acids
2.5. Primers and Probes
2.6. Construction of Standard Plasmids
2.7. Optimization of Reaction Conditions
2.8. Formation of Standard Curves
2.9. Evaluation of Specificity
2.10. Assessment of Sensitivity
2.11. Assessment of Repeatability
2.12. Test of Clinical Samples
3. Results
3.1. Construction of Standard Plasmid Constructs
3.2. Determination of Reaction Conditions
3.3. Generation of Standard Curves
3.4. Specificity
3.5. Sensitivity
3.6. Repeatability
3.7. Test Results of Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Haake, C.; Cook, S.; Pusterla, N.; Murphy, B. Coronavirus infections in companion animals: Virology, epidemiology, clinical and pathologic features. Viruses 2020, 12, 1023. [Google Scholar] [CrossRef] [PubMed]
- Erles, K.; Brownlie, J. Canine respiratory coronavirus: An emerging pathogen in the canine infectious respiratory disease complex. Vet. Clin. N. Am. Small Anim. Pract. 2008, 38, 815–825. [Google Scholar] [CrossRef] [PubMed]
- Day, M.J.; Carey, S.; Clercx, C.; Kohn, B.; MarsilIo, F.; Thiry, E.; Freyburger, L.; Schulz, B.; Walker, D.J. Aetiology of canine infectious respiratory disease complex and prevalence of its pathogens in Europe. J. Comp. Pathol. 2020, 176, 86–108. [Google Scholar] [CrossRef]
- Mesquita, J.R.; Barclay, L.; Nascimento, M.S.; Vinjé, J. Novel norovirus in dogs with diarrhea. Emerg. Infect. Dis. 2010, 16, 980–982. [Google Scholar] [CrossRef]
- Yondo, A.; Kalantari, A.A.; Fernandez-Marrero, I.; McKinney, A.; Naikare, H.K.; Velayudhan, B.T. Predominance of canine parainfluenza virus and Mycoplasma in canine infectious respiratory disease complex in dogs. Pathogens 2023, 12, 1356. [Google Scholar] [CrossRef]
- Mitchell, J.A.; Cardwell, J.M.; Leach, H.; Walker, C.A.; Le Poder, S.; Decaro, N.; Rusvai, M.; Egberink, H.; Rottier, P.; Fernandez, M.; et al. European surveillance of emerging pathogens associated with canine infectious respiratory disease. Vet. Microbiol. 2017, 212, 31–38. [Google Scholar] [CrossRef]
- Hao, X.; Liu, R.; He, Y.; Xiao, X.; Xiao, W.; Zheng, Q.; Lin, X.; Tao, P.; Zhou, P.; Li, S. Multiplex PCR methods for detection of several viruses associated with canine respiratory and enteric diseases. PLoS ONE 2019, 14, e0213295. [Google Scholar] [CrossRef]
- Woo, P.C.Y.; de Groot, R.J.; Haagmans, B.; Lau, S.K.P.; Neuman, B.W.; Perlman, S.; Sola, I.; van der Hoek, L.; Wong, A.C.P.; Yeh, S.H. ICTV virus taxonomy profile: Coronaviridae 2023. J. Gen. Virol. 2023, 104, 001843. [Google Scholar] [CrossRef]
- Buonavoglia, A.; Pellegrini, F.; Decaro, N.; Galgano, M.; Pratelli, A. A one health perspective on canine coronavirus: A wolf in sheep’s clothing? Microorganisms 2023, 11, 921. [Google Scholar] [CrossRef]
- Erles, K.; Toomey, C.; Brooks, H.W.; Brownlie, J. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease. Virology 2003, 310, 216–223. [Google Scholar] [CrossRef]
- Erles, K.; Shiu, K.B.; Brownlie, J. Isolation and sequence analysis of canine respiratory coronavirus. Virus Res. 2007, 124, 78–87. [Google Scholar] [CrossRef] [PubMed]
- Caddy, S.L. New viruses associated with canine gastroenteritis. Vet. J. 2018, 232, 57–64. [Google Scholar] [CrossRef] [PubMed]
- Martella, V.; Lorusso, E.; Decaro, N.; Elia, G.; Radogna, A.; D’Abramo, M.; Desario, C.; Cavalli, A.; Corrente, M.; Camero, M.; et al. Detection and molecular characterization of a canine norovirus. Emerg. Infect. Dis. 2008, 14, 1306–1308. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Xu, J.; Lian, S.; Zhang, R.; Hou, J.; Wang, M.; Yan, X. Difference analysis between canine adenovirus types 1 and 2. Front. Cell. Infect. Microbiol. 2022, 12, 854876. [Google Scholar] [CrossRef]
- Ditchfield, J.; Macpherson, L.; Zbitnew, A. Association of canine adenovirus (Toronto A 26/61) with an outbreak of laryngotracheitis (“kennel cough”): A preliminary report. Can. Vet. J. 1962, 3, 238. [Google Scholar]
- Buonavoglia, C.; Martella, V. Canine respiratory viruses. Vet. Res. 2007, 38, 355–373. [Google Scholar] [CrossRef]
- Priestnall, S.L. Canine respiratory coronavirus: A naturally occurring model of COVID-19? Vet. Pathol. 2020, 57, 467–471. [Google Scholar] [CrossRef]
- Bulut, O.; Yapici, O.; Avci, O.; Simsek, A.; Atli, K.; Dik, I.; Yavru, S.; Hasircioglu, S.; Kale, M.; Mamak, N. The serological and virological investigation of canine adenovirus infection on the dogs. Sci. World J. 2013, 2013, 587024. [Google Scholar] [CrossRef]
- Schulz, B.S.; Kurz, S.; Weber, K.; Balzer, H.J.; Hartmann, K. Detection of respiratory viruses and Bordetella bronchiseptica in dogs with acute respiratory tract infections. Vet. J. 2014, 201, 365–369. [Google Scholar] [CrossRef]
- Lavan, R.; Knesl, O. Prevalence of canine infectious respiratory pathogens in asymptomatic dogs presented at US animal shelters. J. Small Anim. Pract. 2015, 56, 572–576. [Google Scholar] [CrossRef]
- Bodnar, L.; Lorusso, E.; Di Martino, B.; Catella, C.; Lanave, G.; Elia, G.; Bányai, K.; Buonavoglia, C.; Martella, V. Identification of a novel canine norovirus. Infect. Genet. Evol. 2017, 52, 75–81. [Google Scholar] [CrossRef] [PubMed]
- Mesquita, J.R.; Delgado, I.; Costantini, V.; Heenemann, K.; Vahlenkamp, T.W.; Vinje, J.; Nascimento, M.S.J. Seroprevalence of canine norovirus in 14 European countries. Clin. Vaccine Immunol. 2014, 21, 898–900. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Desario, C.; Elia, G.; Mari, V.; Lucente, M.S.; Cordioli, P.; Colaianni, M.L.; Martella, V.; Buonavoglia, C. Serological and molecular evidence that canine respiratory coronavirus is circulating in Italy. Vet. Microbiol. 2007, 121, 225–230. [Google Scholar] [CrossRef] [PubMed]
- Yachi, A.; Mochizuki, M. Survey of dogs in Japan for group 2 canine coronavirus infection. J. Clin. Microbiol. 2006, 44, 2615–2618. [Google Scholar] [CrossRef]
- Hawkins, S.F.C.; Guest, P.C. Multiplex analyses using real-time quantitative PCR. Methods Mol. Biol. 2017, 1546, 125–133. [Google Scholar]
- Kralik, P.; Ricchi, M. A basic guide to real time PCR in microbial diagnostics: Definitions, parameters, and everything. Front. Microbiol. 2017, 8, 108. [Google Scholar] [CrossRef]
- Wang, R.Y.; Zhang, W.Y.; Ye, R.; Pan, Z.Z.; Li, G.R.; Su, S. One-step multiplex TaqMan probe-based method for real-time PCR detection of four canine diarrhea viruses. Mol. Cell. Probes 2020, 53, 8. [Google Scholar] [CrossRef]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Wolfson, W.; Balasuriya, U.B.R. Multiplex one-step RT-qPCR assays for simultaneous detection of SARS-CoV-2 and other enteric viruses of dogs and cats. Viruses 2023, 15, 1890. [Google Scholar] [CrossRef]
- Thieulent, C.J.; Carossino, M.; Peak, L.; Strother, K.; Wolfson, W.; Balasuriya, U.B.R. Development and validation of a panel of one-step four-plex qPCR/RT-qPCR assays for simultaneous detection of SARS-CoV-2 and other pathogens associated with canine infectious respiratory disease complex. Viruses 2023, 15, 1881. [Google Scholar] [CrossRef]
- Dong, J.S.; Tsui, W.N.T.; Leng, X.; Fu, J.P.; Lohman, M.; Anderson, J.; Hamill, V.; Lu, N.Y.; Porter, E.P.; Gray, M.; et al. Validation of a real-time PCR panel for detection and quantification of nine pathogens commonly associated with canine infectious respiratory disease. MethodsX 2023, 11, 8. [Google Scholar] [CrossRef]
- Dong, J.S.; Tsui, W.N.T.; Leng, X.; Fu, J.P.; Lohman, M.; Anderson, J.; Hamill, V.; Lu, N.Y.; Porter, E.P.; Gray, M.; et al. Development of a three-panel multiplex real-time PCR assay for simultaneous detection of nine canine respiratory pathogens. J. Microbiol. Methods 2022, 199, 10. [Google Scholar] [CrossRef] [PubMed]
- Dowgier, G.; Mari, V.; Losurdo, M.; Larocca, V.; Colaianni, M.L.; Cirone, F.; Lucente, M.S.; Martella, V.; Buonavoglia, C.; Decaro, N. A duplex real-time PCR assay based on TaqMan technology for simultaneous detection and differentiation of canine adenovirus types 1 and 2. J. Virol. Methods 2016, 234, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Caddy, S.; Emmott, E.; El-Attar, L.; Mitchell, J.; de Rougemont, A.; Brownlie, J.; Goodfellow, I. Serological evidence for multiple strains of canine norovirus in the UK dog population. PLoS ONE 2013, 8, 8. [Google Scholar] [CrossRef]
- Shi, Y.; Long, F.; Shi, K.; He, M.; Shi, Y.; Feng, S.; Yin, Y.; Wei, X.; Li, Z. A quadruplex reverse transcription quantitative polymerase chain reaction for detecting canine coronavirus, canine rotavirus, canine parvovirus, and canine distemper virus. Microbiol. Res. 2024, 15, 746–761. [Google Scholar] [CrossRef]
- Ma, H.; Yue, H.; Luo, Y.; Li, S.; Tang, C. First detection of canine norovirus in dogs and a complete GVI.2 genome in mainland China. Infect. Genet. Evol. 2021, 92, 104879. [Google Scholar] [CrossRef] [PubMed]
- Martella, V.; Pinto, P.; Buonavoglia, C. Canine noroviruses. Vet. Clin. N. Am. Small Anim. Pract. 2011, 41, 1171–1181. [Google Scholar] [CrossRef]
- Charoenkul, K.; Nasamran, C.; Janetanakit, T.; Tangwangvivat, R.; Bunpapong, N.; Boonyapisitsopa, S.; Suwannakarn, K.; Theamboonler, A.; Chuchaona, W.; Poovorawan, Y.; et al. Human norovirus infection in dogs, Thailand. Emerg. Infect. Dis. 2020, 26, 350–353. [Google Scholar] [CrossRef]
- Lizasoain, A.; Tort, L.F.L.; García, M.; Gómez, M.M.; Leite, J.P.G.; Miagostovich, M.P.; Cristina, J.; Berois, M.; Colina, R.; Victoria, M. Sewage surveillance reveals the presence of canine GVII norovirus and canine astrovirus in Uruguay. Arch. Virol. 2015, 160, 2839–2843. [Google Scholar] [CrossRef]
- Chen, C.; Ji, X.; Zhang, T.; Ge, L.; Sun, M.; Yang, M.; Li, C. A systematic review and meta-analysis of canine enteric coronavirus prevalence in dogs of mainland China. Virol. J. 2024, 21, 155. [Google Scholar] [CrossRef]
- Odigie, A.E.; Capozza, P.; Tempesta, M.; Decaro, N.; Pratelli, A. Epidemiological investigation of enteric canine coronaviruses in domestic dogs: A systematic review and meta-analysis. Res. Vet. Sci. 2024, 174, 105289. [Google Scholar] [CrossRef]
- Vlasova, A.N.; Diaz, A.; Damtie, D.; Xiu, L.S.; Toh, T.H.; Lee, J.S.Y.; Saif, L.J.; Gray, G.C. Novel canine coronavirus isolated from a hospitalized patient with pneumonia in east Malaysia. Clin. Infect. Dis. 2022, 74, 446–454. [Google Scholar] [CrossRef] [PubMed]
- Lednicky, J.A.; Tagliamonte, M.S.; White, S.K.; Blohm, G.M.; Alam, M.M.; Iovine, N.M.; Salemi, M.; Mavian, C.; Morris, J.G. Isolation of a novel recombinant canine coronavirus from a visitor to Haiti: Further evidence of transmission of coronaviruses of zoonotic origin to humans. Clin. Infect. Dis. 2022, 75, E1184–E1187. [Google Scholar] [CrossRef] [PubMed]
- Vlasova, A.N.; Toh, T.H.; Lee, J.S.; Poovorawan, Y.; Davis, P.; Azevedo, M.S.P.; Lednicky, J.A.; Saif, L.J.; Gray, G.C. Animal alphacoronaviruses found in human patients with acute respiratory illness in different countries. Emerg. Microbes Infect. 2022, 11, 699–702. [Google Scholar] [CrossRef] [PubMed]
- Kibenge, F.S.B. Continuous surveillance and viral discovery in animals and humans are a core component of a one-health approach to address recent viral reverse zoonoses. J. Am. Vet. Med. Assoc. 2023, 261, 789–797. [Google Scholar] [CrossRef] [PubMed]



| Name | Sequence (5′-3′) | Tm/°C | Genotype | Gene | Product/bp |
|---|---|---|---|---|---|
| CCoV (M)-F | GGTGGTATGAACATCGACAATT | 57.3 | CCoV-I CCoV-II | M | 134 |
| CCoV (M)-R | TTAGATTTTACATAGTAAGCCCATCC | 56.0 | |||
| CCoV (M)-P | FAM-CGTAATGGTTGCATTACCTAGCAGGACCAT-BHQ1 | 65.6 | |||
| CRCoV (N)-F | TGGGTCGCTAGTAACCAGG | 58.6 | CRCoV | N | 145 |
| CRCoV (N)-R | TAACCCTGAGGGAGTACCG | 56.5 | |||
| CRCoV (N)-P | ROX-CGATCGGGACCCAAGTAGCGATG-BHQ2 | 66.9 | |||
| CAV-2 (hexon)-F | CACAGAAATGCAGGACTCCG | 57.6 | CAV-2 | hexon | 119 |
| CAV-2 (hexon)-R | TGAAAGACCACTCGTACGTG | 58.5 | |||
| CAV-2 (hexon)-P | JOE-GCTTGGCAATGGCCGCTATTGCT-BHQ1 | 65.5 | |||
| CNV (RdRp)-F | CCAAGTTCGARGCCATGT | 54.9 | CNV-GVI CNV-GIV | RaRp | 104 |
| CNV (RdRp)-R | TTAGACGCCATCTTCATTCAC | 54.8 | |||
| CNV (RdRp)-P | CY5- GCGAGATTGCGATCTCCCTCCCAC-BHQ3 | 65.8 |
| Ingredient | Volume/µL | Final Concentration/nΜ |
|---|---|---|
| CCoV (M)-F (20 pmol/µL) | 0.3 | 300 |
| CCoV (M)-R (20 pmol/µL) | 0.3 | 300 |
| CCoV (M)-P (20 pmol/µL) | 0.3 | 300 |
| CRCoV (N)-F (20 pmol/µL) | 0.3 | 300 |
| CRCoV (N)-R (20 pmol/µL) | 0.3 | 300 |
| CRCoV (N)-P (20 pmol/µL) | 0.3 | 300 |
| CAV-2 (hexon)-F (20 pmol/µL) | 0.3 | 300 |
| CAV-2 (hexon)-R (20 pmol/µL) | 0.3 | 300 |
| CAV-2 (hexon)-P (20 pmol/µL) | 0.3 | 300 |
| CNV (RdRp)-F (20 pmol/µL) | 0.3 | 300 |
| CNV (RdRp)-R (20 pmol/µL) | 0.3 | 300 |
| CNV (RdRp)-P (20 pmol/µL) | 0.3 | 300 |
| 2× One-Step RT-PCR Buffer III | 10 | / |
| Ex Taq HS (5 U/µL) | 0.4 | / |
| PrimeScript RT Enzyme Mix II | 0.4 | / |
| RNA/DNA Template | 2 | / |
| Distilled Water | 3.6 | / |
| Total | 20 | / |
| Plasmid Construct | Concentration (Copies/Reaction) | Number of Samples | Quadruplex RT-qPCR | |
|---|---|---|---|---|
| ) | Hit Rate (%) | |||
| p-CCoV | 400 | 35 | 34.012 | 100 |
| 200 | 35 | 34.591 | 100 | |
| 100 | 35 | 35.982 | 97.14 | |
| 50 | 35 | ND | 0 | |
| P-CRCoV | 400 | 35 | 33.311 | 100 |
| 200 | 35 | 34.198 | 100 | |
| 100 | 35 | 34.991 | 94.26 | |
| 50 | 35 | ND | 0 | |
| P-CAV-2 | 400 | 35 | 33.675 | 100 |
| 200 | 35 | 34.836 | 100 | |
| 100 | 35 | 35.465 | 97.14 | |
| 50 | 35 | ND | 0 | |
| P-CNV | 400 | 35 | 33.834 | 100 |
| 200 | 35 | 34.903 | 100 | |
| 100 | 35 | 35.671 | 91.43 | |
| 50 | 35 | ND | 0 | |
| Plasmid | Concentration (Copies/µL) | Concentration (Copies/Reaction) | Ct Values of Intra-Assay | Ct Values of Inter-Assay | ||||
|---|---|---|---|---|---|---|---|---|
| SD | CV% | SD | CV% | |||||
| p-CCoV | 1 × 109 | 2 × 1010 | 13.178 | 0.121 | 0.92 | 13.452 | 0.052 | 0.39 |
| 1 × 106 | 2 × 107 | 23.283 | 0.045 | 0.19 | 23.264 | 0.096 | 0.41 | |
| 1 × 103 | 2 × 104 | 32.165 | 0.105 | 0.33 | 32.133 | 0.101 | 0.31 | |
| P-CRCoV | 1 × 109 | 2 × 1010 | 12.935 | 0.068 | 0.52 | 12.890 | 0.057 | 0.44 |
| 1 × 106 | 2 × 107 | 22.506 | 0.296 | 1.31 | 22.721 | 0.123 | 0.54 | |
| 1 × 103 | 2 × 104 | 31.602 | 0.218 | 0.69 | 31.413 | 0.031 | 0.10 | |
| p-CAV-2 | 1 × 109 | 2 × 1010 | 13.360 | 0.051 | 0.38 | 13.568 | 0.119 | 0.88 |
| 1 × 106 | 2 × 107 | 22.827 | 0.153 | 0.67 | 22.880 | 0.074 | 0.32 | |
| 1 × 103 | 2 × 104 | 31.557 | 0.275 | 0.87 | 31.218 | 0.032 | 0.10 | |
| p-CNV | 1 × 109 | 2 × 1010 | 12.854 | 0.136 | 1.06 | 12.561 | 0.022 | 0.17 |
| 1 × 106 | 2 × 107 | 22.476 | 0.238 | 1.06 | 22.367 | 0.053 | 0.24 | |
| 1 × 103 | 2 × 104 | 31.315 | 0.073 | 0.23 | 31.769 | 0.102 | 0.32 | |
| Pathogen | Sample | Developed RT-qPCR | Reference RT-qPCR | ||
|---|---|---|---|---|---|
| Positive | Percentage (%) | Positive | Percentage (%) | ||
| Single Infection | |||||
| CCoV | 1688 | 80 | 4.74% | 79 | 4.68% |
| CRCoV | 1688 | 92 | 5.45% | 90 | 5.33% |
| CAV-2 | 1688 | 21 | 1.24% | 24 | 1.42% |
| CNV | 1688 | 15 | 0.89% | 13 | 0.77% |
| Co-Infection | |||||
| CCoV + CRCoV | 1688 | 40 | 2.37% | 39 | 2.31% |
| CCoV + CAV-2 | 1688 | 13 | 0.77% | 12 | 0.71% |
| CCoV + CNV | 1688 | 1 | 0.06% | 2 | 0.12% |
| CRCoV + CAV-2 | 1688 | 4 | 0.24% | 2 | 0.12% |
| CRCoV + CNV | 1688 | 4 | 0.24% | 3 | 0.18% |
| CCoV + CAV-2 + CNV | 1688 | 1 | 0.06% | 1 | 0.06% |
| CCoV + CRCoV + CAV-2 | 1688 | 9 | 0.53% | 8 | 0.47% |
| CCoV + CRCoV + CNV | 1688 | 1 | 0.06% | 2 | 0.12% |
| Total (Single + Co-Infection) | |||||
| CCoV | 1688 | 145 | 8.59% | 143 | 8.47% |
| CRCoV | 1688 | 146 | 8.65% | 144 | 8.53% |
| CAV-2 | 1688 | 48 | 2.84% | 47 | 2.78% |
| CNV | 1688 | 22 | 1.30% | 21 | 1.24% |
| Established RT-qPCR | Reference RT-qPCR | Total | Clinical Sensitivity (95% CI) | Clinical Specificity (95% CI) | ||
|---|---|---|---|---|---|---|
| Positive | Negative | |||||
| CCoV | Positive | 140 | 5 | 145 | 97.90% (94.01–99.28%) | 99.68% (99.24–99.86%) |
| Negative | 3 | 1540 | 1543 | |||
| Total | 143 | 1545 | 1688 | |||
| CRCoV | Positive | 142 | 4 | 146 | 99.61% (95.08–99.62%) | 99.74% (99.34–99.90%) |
| Negative | 2 | 1540 | 1542 | |||
| Total | 144 | 1544 | 1688 | |||
| CAV-2 | Positive | 47 | 1 | 48 | 100% (92.44–100%) | 99.94% (99.66–99.99%) |
| Negative | 0 | 1640 | 1640 | |||
| Total | 47 | 1641 | 1688 | |||
| CNV | Positive | 21 | 1 | 22 | 95.45% (78.20–99.19%) | 99.94% (99.66–99.99%) |
| Negative | 1 | 1665 | 1666 | |||
| Total | 22 | 1666 | 1688 | |||
| Method | Positive Sample | |||
|---|---|---|---|---|
| CCoV | CRCoV | CAV-2 | CNV | |
| Established RT-qPCR | 145/1688 (8.59%) | 146/1688 (8.65%) | 48/1688 (2.84%) | 22/1688 (1.30%) |
| Reference RT-qPCR | 143/1688 (8.47%) | 144/1688 (8.53%) | 47/1688 (2.78%) | 21/1688 (1.24%) |
| Agreements (95% CI) | 99.53% (92.25–99.87%) | 99.64% (99.23–99.84%) | 99.94% (99.67–99.99%) | 99.88% (99.57–99.97%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, K.; Shi, Y.; Shi, Y.; Long, F.; Yin, Y.; Pan, Y.; Li, Z.; Feng, S. Establishment of a Quadruplex RT-qPCR for the Detection of Canine Coronavirus, Canine Respiratory Coronavirus, Canine Adenovirus Type 2, and Canine Norovirus. Pathogens 2024, 13, 1054. https://doi.org/10.3390/pathogens13121054
Shi K, Shi Y, Shi Y, Long F, Yin Y, Pan Y, Li Z, Feng S. Establishment of a Quadruplex RT-qPCR for the Detection of Canine Coronavirus, Canine Respiratory Coronavirus, Canine Adenovirus Type 2, and Canine Norovirus. Pathogens. 2024; 13(12):1054. https://doi.org/10.3390/pathogens13121054
Chicago/Turabian StyleShi, Kaichuang, Yandi Shi, Yuwen Shi, Feng Long, Yanwen Yin, Yi Pan, Zongqiang Li, and Shuping Feng. 2024. "Establishment of a Quadruplex RT-qPCR for the Detection of Canine Coronavirus, Canine Respiratory Coronavirus, Canine Adenovirus Type 2, and Canine Norovirus" Pathogens 13, no. 12: 1054. https://doi.org/10.3390/pathogens13121054
APA StyleShi, K., Shi, Y., Shi, Y., Long, F., Yin, Y., Pan, Y., Li, Z., & Feng, S. (2024). Establishment of a Quadruplex RT-qPCR for the Detection of Canine Coronavirus, Canine Respiratory Coronavirus, Canine Adenovirus Type 2, and Canine Norovirus. Pathogens, 13(12), 1054. https://doi.org/10.3390/pathogens13121054

