Biofilm Formation and Expression of Virulence Genes of Microorganisms Grown in Contact with a New Bioactive Glass
Abstract
1. Introduction
2. Results
2.1. Antimicrobial Activity
2.2. Biofilm Morphology
2.3. pH Variation
2.4. Expression of Virulence Genes
3. Discussion
4. Materials and Methods
4.1. Sample Preparation
4.2. Culture Conditions
4.3. Antimicrobial Activity
4.4. Biofilm Morphology
4.5. pH Measurement
4.6. Activity on the Expression of Virulence Genes
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Flemming, H.-C.; Wingender, H.-C.F.J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S.A.R.S. Biofilms: An emergent form of bacterial life. Nat. Rev. Genet. 2016, 14, 563–575. [Google Scholar] [CrossRef] [PubMed]
- Campoccia, D.; Montanaro, L.; Arciola, C.R. The significance of infection related to orthopedic devices and issues of antibiotic resistance. Biomaterials 2006, 27, 2331–2339. [Google Scholar] [CrossRef] [PubMed]
- Medellin, M.R.; Fujiwara, T.; Clark, R.; Stevenson, J.D.; Parry, M.; Jeys, L. Mechanisms of failure and survival of total femoral endoprosthetic replacements. Bone Jt. J. 2019, 101, 522–528. [Google Scholar] [CrossRef] [PubMed]
- Bekmurzayeva, A.; Duncanson, W.J.; Azevedo, H.S.; Kanayeva, D. Surface modification of stainless steel for biomedical applications: Revisiting a century-old material. Mater. Sci. Eng. C 2018, 93, 1073–1089. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.V.; Baylan, S.; Park, B.-W.; Richter, G.; Sitti, M. Hydrophobic pinning with copper nanowhiskers leads to bactericidal properties. PLoS ONE 2017, 12, e0175428. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.V.; Vyas, V.; Salve, T.S.; Cortelli, D.; Dellasega, D.; Podestà, A.; Milani, P.; Gade, W.N. Biofilm formation on nanostructured titanium oxide surfaces and a micro/nanofabrication-based preventive strategy using colloidal lithography. Biofabrication 2012, 4, 025001. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Yue, K.; Kazemzadeh-Narbat, M.; Liu, Y.; Khalilpour, A.; Li, B.; Zhang, Y.S.; Annabi, N.; Khademhosseini, A. Mussel-Inspired Multifunctional Hydrogel Coating for Prevention of Infections and Enhanced Osteogenesis. ACS Appl. Mater. Interfaces 2017, 9, 11428–11439. [Google Scholar] [CrossRef]
- Tran, D.L.; Le Thi, P.; Thi, T.T.H.; Park, K.D. Graphene oxide immobilized surfaces facilitate the sustained release of doxycycline for the prevention of implant related infection. Colloids Surf. B Biointerfaces 2019, 181, 576–584. [Google Scholar] [CrossRef]
- Lin, X.; Yang, S.; Lai, K.; Yang, H.; Webster, T.J.; Yang, L. Orthopedic implant biomaterials with both osteogenic and anti-infection capacities and associated in vivo evaluation methods. Nanomed. Nanotechnol. Biol. Med. 2017, 13, 123–142. [Google Scholar] [CrossRef]
- Saeed, K.; McLaren, A.C.; Schwarz, E.M.; Antoci, V.; Arnold, W.V.; Chen, A.F.; Clauss, M.; Esteban, J.; Gant, V.; Hendershot, E.; et al. 2018 international consensus meeting on musculoskeletal infection: Summary from the biofilm workgroup and consensus on biofilm related musculoskeletal infections. J. Orthop. Res. 2019, 37, 1007–1017. [Google Scholar] [CrossRef]
- Baino, F.; Hamzehlou, S.; Kargozar, S. Bioactive Glasses: Where Are We and Where Are We Going? J. Funct. Biomater. 2018, 9, 25. [Google Scholar] [CrossRef]
- Kargozar, S.; Montazerian, M.; Hamzehlou, S.; Kim, H.-W.; Baino, F. Mesoporous bioactive glasses: Promising platforms for antibacterial strategies. Acta Biomater. 2018, 81, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Souza, M.T.; Renno, A.M.; Peitl, O.; Zanotto, E. New highly bioactive crystallization-resistant glass for tissue engineering applications. Transl. Mater. Res. 2017, 4, 014002. [Google Scholar] [CrossRef]
- Gabbai-Armelin, P.R.; Souza, M.T.; Kido, H.W.; Tim, C.R.; Bossini, P.S.; Fernandes, K.R.; Magri, A.M.P.; Parizotto, N.A.; Fernandes, K.P.S.; Ribeiro, D.A.; et al. Characterization and biocompatibility of a fibrous glassy scaffold. J. Tissue Eng. Regen. Med. 2015, 11, 1141–1151. [Google Scholar] [CrossRef]
- Soares, C.J.; Moura, C.C.G.; Chinaglia, C.R.; Zanotto, E.D.; Zanetta-Barbosa, D.; Stavropoulos, A. Effect of titanium surface functionalization with bioactive glass on osseointegration: An experimental study in dogs. Clin. Oral Implant. Res. 2018, 29, 1120–1125. [Google Scholar] [CrossRef]
- Souza, M.T.; Campanini, L.; Chinaglia, C.; Peitl, O.; Zanotto, E.; Souza, C. Broad-spectrum bactericidal activity of a new bioactive grafting material (F18) against clinically important bacterial strains. Int. J. Antimicrob. Agents 2017, 50, 730–733. [Google Scholar] [CrossRef]
- Hoyer, L.L.; Green, C.B.; Oh, S.-H.; Zhao, X. Discovering the secrets of the Candida albicans agglutinin-like sequence (ALS) gene family—a sticky pursuit. Med. Mycol. 2008, 46, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Nobile, C.J.; Nett, J.E.; Andes, D.R.; Mitchell, A.P. Function of Candida albicans Adhesin Hwp1 in Biofilm Formation. Eukaryot. Cell 2006, 5, 1604–1610. [Google Scholar] [CrossRef] [PubMed]
- Silva, N.C.; Nery, J.M.; Dias, A.L.T. Aspartic proteinases of Candida spp.: Role in pathogenicity and antifungal resistance. Mycoses 2013, 57, 1–11. [Google Scholar] [CrossRef]
- Patel, J.D.; Colton, E.; Ebert, M.; Anderson, J.M. Gene expression during S. epidermidis biofilm formation on biomaterials. J. Biomed. Mater. Res. Part A 2012, 100, 2863–2869. [Google Scholar] [CrossRef]
- Ma, L.; Jackson, K.D.; Landry, R.M.; Parsek, M.R.; Wozniak, D.J. Analysis of Pseudomonas aeruginosa Conditional Psl Variants Reveals Roles for the Psl Polysaccharide in Adhesion and Maintaining Biofilm Structure Postattachment. J. Bacteriol. 2006, 188, 8213–8221. [Google Scholar] [CrossRef] [PubMed]
- Williams, P.; Cámara, M. Quorum sensing and environmental adaptation in Pseudomonas aeruginosa: A tale of regulatory networks and multifunctional signal molecules. Curr. Opin. Microbiol. 2009, 12, 182–191. [Google Scholar] [CrossRef]
- Kuang, Z.; Hao, Y.; Walling, B.E.; Jeffries, J.L.; Ohman, D.E.; Lau, G.W. Pseudomonas aeruginosa Elastase Provides an Escape from Phagocytosis by Degrading the Pulmonary Surfactant Protein-A. PLoS ONE 2011, 6, e27091. [Google Scholar] [CrossRef]
- Sun, S.; Zhou, L.; Jin, K.; Jiang, H.; He, Y.-W. Quorum sensing systems differentially regulate the production of phenazine-1-carboxylic acid in the rhizobacterium Pseudomonas aeruginosa PA1201. Sci. Rep. 2016, 6, 30352. [Google Scholar] [CrossRef] [PubMed]
- Choi, A.H.; Ben-Nissan, B.; Matinlinna, J.P.; Conway, R. Current Perspectives: Calcium Phosphate Nanocoatings and Nanocomposite Coatings in Dentistry. J. Dent. Res. 2013, 92, 853–859. [Google Scholar] [CrossRef]
- Coraça-Huber, D.C.; Fille, M.; Hausdorfer, J.; Putzer, D.; Nogler, M. Efficacy of antibacterial bioactive glass S53P4 against S. Aureus biofilms grown on titanium discs in vitro. J. Orthop. Res. 2013, 32, 175–177. [Google Scholar] [CrossRef]
- Drago, L.; Toscano, M.; Bottagisio, M. Recent Evidence on Bioactive Glass Antimicrobial and Antibiofilm Activity: A Mini-Review. Materials 2018, 11, 326. [Google Scholar] [CrossRef]
- Xie, Z.-P.; Zhang, C.-Q.; Yi, C.-Q.; Qiu, J.-J.; Wang, J.-Q.; Zhou, J. In vivo study effect of particulate Bioglass® in the prevention of infection in open fracture fixation. J. Biomed. Mater. Res. Part B Appl. Biomater. 2008, 90, 195–201. [Google Scholar] [CrossRef]
- Begum, S.; Johnson, W.E.; Worthington, T.; A Martin, R. The influence of pH and fluid dynamics on the antibacterial efficacy of 45S5 Bioglass. Biomed. Mater. 2016, 11, 015006. [Google Scholar] [CrossRef] [PubMed]
- Hedia, H.S. Effect of coating thickness and its material on the stress distribution for dental implants. J. Med Eng. Technol. 2007, 31, 280–287. [Google Scholar] [CrossRef]
- Hench, L.L. Bioceramics: From Concept to Clinic. J. Am. Ceram. Soc. 1991, 74, 1487–1510. [Google Scholar] [CrossRef]
- Yang, Y.; Xia, L.; Haapasalo, M.; Wei, W.; Zhang, D.; Ma, J.; Shen, Y. A novel hydroxyapatite-binding antimicrobial peptide against oral biofilms. Clin. Oral Investig. 2018, 23, 2705–2712. [Google Scholar] [CrossRef] [PubMed]
- Bräsen, C.; Esser, D.; Rauch, B.; Siebers, B. Carbohydrate Metabolism in Archaea: Current Insights into Unusual Enzymes and Pathways and Their Regulation. Microbiol. Mol. Biol. Rev. 2014, 78, 89–175. [Google Scholar] [CrossRef] [PubMed]
- Miranda, J.E.A.; Sotomayor, C.E.; Albesa, I.; Paraje, M.G. Oxidative and nitrosative stress in Staphylococcus aureus biofilm. FEMS Microbiol. Lett. 2010, 315, 23–29. [Google Scholar] [CrossRef] [PubMed]
- Dunne, W.M. Bacterial Adhesion: Seen Any Good Biofilms Lately? Clin. Microbiol. Rev. 2002, 15, 155–166. [Google Scholar] [CrossRef]
- Hao, Y.; Huang, X.; Zhou, X.; Li, M.; Ren, B.; Peng, X.; Cheng, L. Influence of Dental Prosthesis and Restorative Materials Interface on Oral Biofilms. Int. J. Mol. Sci. 2018, 19, 3157. [Google Scholar] [CrossRef]
- Macia, M.; Rojo-Molinero, E.; Oliver, A. Antimicrobial susceptibility testing in biofilm-growing bacteria. Clin. Microbiol. Infect. 2014, 20, 981–990. [Google Scholar] [CrossRef]
- Cabal, B.; Malpartida, F.; Torrecillas, R.; Hoppe, A.; Boccaccini, A.R.; Moya, J.S. The Development of Bioactive Glass-Ceramic Substrates with Biocide Activity. Adv. Eng. Mater. 2011, 13, B462–B466. [Google Scholar] [CrossRef]
- Passos, T.F.; Souza, M.T.; Zanotto, E.D.; De Souza, C.W.O. Bactericidal activity and biofilm inhibition of F18 bioactive glass against Staphylococcus aureus. Mater. Sci. Eng. C 2021, 118, 111475. [Google Scholar] [CrossRef]
- Zhou, Y.; Xiao, Y.; Qiu, Y.; Yuan, H.; Van Blitterswijk, C.A.; Zhou, X.; Xu, X.; Bao, C. Adhesion and proliferation of cells and bacteria on microchip with different surfaces microstructures. Biomed. Tech. Eng. 2016, 61, 475–482. [Google Scholar] [CrossRef]
- Thomas, M.S.; Wigneshweraraj, S. Regulation of virulence gene expression. Virulence 2014, 5, 832–834. [Google Scholar] [CrossRef]
- Sarkisova, S.; Patrauchan, M.A.; Berglund, D.; Nivens, D.E.; Franklin, M.J. Calcium-Induced Virulence Factors Associated with the Extracellular Matrix of Mucoid Pseudomonas aeruginosa Biofilms. J. Bacteriol. 2005, 187, 4327–4337. [Google Scholar] [CrossRef] [PubMed]
- Chang, W.; A Small, D.; Toghrol, F.; E Bentley, W. Microarray analysis of Pseudomonas aeruginosa reveals induction of pyocin genes in response to hydrogen peroxide. BMC Genom. 2005, 6, 1–115. [Google Scholar] [CrossRef]
- Chekabab, S.M.; Harel, J.; Dozois, C.M. Interplay between genetic regulation of phosphate homeostasis and bacterial virulence. Virulence 2014, 5, 786–793. [Google Scholar] [CrossRef] [PubMed]
- Souza, M.T.; Peitl, O.; Zanotto, E.D.; Boccaccini, A.R. Novel Double-Layered Conduit Containing Highly Bioactive Glass Fibers for Potential Nerve Guide Application. Int. J. Appl. Glas. Sci. 2016, 7, 183–194. [Google Scholar] [CrossRef]
Incubation Time | Group | p-Value | |||
---|---|---|---|---|---|
Titanium | Titanium Covered with BGF18 | ||||
Mean ± Standard Deviation (Median) | 95% Confidence Interval (Minimum–Maximum) | Mean ± Standard Deviation (Median) | 95% Confidence Interval (Minimum–Maximum) | ||
8 h | 5.87 ± 0.15 (5.83) | 5.64; 6.10 (5.74–6.08) | 5.78 ± 0.08 (5.78) | 5.65; 5.92 (5.68–5.88) | 0.330 * |
24 h | 6.03 ± 0.42 (6.17) | 5.36; 6.69 (5.41–6.35) | 5.96 ± 0.19 (5.99) | 5.65; 6.26 (5.70–6.14) | 0.771 * |
48 h | 5.60 ± 0.39 (5.69) | 4.98; 6.21 (5.09–5.91) | 4.92 ± 0.99 (5.39) | 3.35; 6.50 (3.44–5.47) | 0.200 † |
Incubation Time | Group | p-Value | |||
---|---|---|---|---|---|
Titanium | Titanium Covered with BGF18 | ||||
Mean ± Standard Deviation (Median) | 95% Confidence Interval (Minimum–Maximum) | Mean ± Standard Deviation (Median) | 95% Confidence Interval (Minimum–Maximum) | ||
8 h | 6.89 ± 0.16 (6.89) | 6.64; 7.14 (6.71–7.06) | 7.05 ± 0.15 (7.06) | 6.81; 7.29 (6.86–7.20) | 0.190 * |
24 h | 6.56 ± 0.07 (6.57) | 6.45; 6.67 (6.47–6.64) | 6.60 ± 0.31 (6.58) | 6.12; 7.09 (6.30–6.96) | 0.790 * |
48 h | 7.03 ± 0.09 (7.02) | 6.88; 7.18 (6.95–7.14) | 7.20 ± 0.19 (7.15) | 6.90; 7.50 (7.05–7.45) | 0.157 * |
Incubation Time | Group | p-Value | |||
---|---|---|---|---|---|
Titanium | Titanium Covered with BGF18 | ||||
Mean ± Standard Deviation (Median) | 95% Confidence Interval (Minimum–Maximum) | Mean ± Standard Deviation (Median) | 95% Confidence Interval (Minimum–Maximum) | ||
8 h | 7.36 ± 0.14 (7.32) | 7.13; 7.59 (7.24–7.57) | 7.39 ± 0.20 (7.41) | 7.08; 7.70 (7.15–7.60) | 0.823 * |
24 h | 7.02 ± 0.06 (7.00) | 6.91; 7.12 (6.95–7.11) | 7.11 ± 0.14 (7.15) | 6.88; 7.33 (6.90–7.23) | 0.279 * |
48 h | 6.71 ± 0.44 (6.66) | 6.01; 7.41 (6.26–7.26) | 6.72 ± 0.11 (6.73) | 6.55; 6.89 (6.59–6.84) | 0.963 * |
Microorganism | Gene Name | Gene Description | Function | Reference |
---|---|---|---|---|
C. albicans | ALS1 | Agglutinin-like sequence 1 | Encodes cell-surface glycoproteins that are involved in adhesion of fungal cells to host and abiotic surfaces. | [17] |
HWP1 | Hyphal wall protein 1 | Associated with adhesive functions necessary for biofilm integrity, attachment to host, and virulence. | [18] | |
SAP5 | Secreted aspartyl proteinase 5 | Degrades host cell proteins, contributing to tissue damage and invasion. | [19] | |
S. epidermidis | icaADBC operon | Intercellular adhesion | Mediates intercellular adhesion of bacterial cells by synthesis of polysaccharide intercellular adhesin (PIA). | [20] |
P. aeruginosa | lasl | Acyl-homoserine-lactone synthase | Related to quorum sensing mechanism. Required for the synthesis of N-(3-oxododecanoyl)homoserine lactone. | [22] |
pslA | Polysaccharide synthesis | Involved in attachment to surfaces and extracellular polysaccharide biosynthesis. | [21] | |
lasB | Elastase structural B | Secretion of extracellular proteases that cleaves host proteins, favoring pathogenesis of infection. | [23] | |
phzH | Pyocyanin biosynthesis | Acts converting the phenazine-1-carboxylic acid into phenazine in the pyocyanin synthetic pathway. | [24] |
Microorganism | Gene | Sequence 5′–3′ | Amplification Size (pb) |
---|---|---|---|
C. albicans | ALS1 | TTCTCATGAATCAGCATCCACAA (F) CAGAATTTTCACCCATACTTGGTTTC (R) | 53 |
HWP1 | GCTCAACTTATTGCTATCGCTTATTACA (F) GACCGTCTACCTGTGGGACAGT (R) | 67 | |
SAP5 | CAGAATTTCCCGTCGATGAGA (F) CATTGTGCAAAGTAACTGCAACAG (R) | 78 | |
ACT1 (Reference) | GCTGGTAGAGACTTGACCAACCA (F) GACAATTTCTCTTTCAGCACTAGTAGTGA (R) | 87 | |
S. epidermidis | icaA | CTCTTGCAGGAGCAATCAAT (F) AGAGCACGTGGTTCGTACTT (R) | 176 |
icaD | GAGGCAATATCCAAGGTAA (F) AAATTTCCGTGTTTTCAACATT (R) | 194 | |
icaB | AATGGCTTAAAGCACACGAC (F) AAACAGGAAAGGCATTGTCA (R) | 137 | |
icaC | TATAGGCGTCGGAATGATGT (F) TCCAGTTAGGCTGGTATTGG (R) | 100 | |
16s rDNA (Reference) | GAAAGCCACGGCTAACTACG (F) CATTTCACCGCTACACATGG (R) | 203 | |
P. aeruginosa | lasI | GGCTGGGACGTTAGTGTCAT (F) AAAACCTGGGCTTCAGGAGT (R) | 104 |
pslA | TCCCTACCTCAGCAGCAAGCTGGT (F) CGGATGTCGTGGTTGCGTACCAGGTAT (R) | 198 | |
lasB | AGACCGAGAATGACAAAGTGGAA (F) GGTAGGAGACGTTGTAGACCAGTTG (R) | 81 | |
phzH | TGCGCGAGTTCAGCCACCTG (F) TCCGGGACATAGTCGGCGCA (R) | 214 | |
rpsL (reference) | GCAACTATCAACCAGCTGGTG (F) GCTGTGCTCTTGCAGGTTGTG (R) | 231 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Oliveira, V.d.C.; Souza, M.T.; Zanotto, E.D.; Watanabe, E.; Coraça-Huber, D. Biofilm Formation and Expression of Virulence Genes of Microorganisms Grown in Contact with a New Bioactive Glass. Pathogens 2020, 9, 927. https://doi.org/10.3390/pathogens9110927
Oliveira VdC, Souza MT, Zanotto ED, Watanabe E, Coraça-Huber D. Biofilm Formation and Expression of Virulence Genes of Microorganisms Grown in Contact with a New Bioactive Glass. Pathogens. 2020; 9(11):927. https://doi.org/10.3390/pathogens9110927
Chicago/Turabian StyleOliveira, Viviane de Cássia, Marina Trevelin Souza, Edgar Dutra Zanotto, Evandro Watanabe, and Débora Coraça-Huber. 2020. "Biofilm Formation and Expression of Virulence Genes of Microorganisms Grown in Contact with a New Bioactive Glass" Pathogens 9, no. 11: 927. https://doi.org/10.3390/pathogens9110927
APA StyleOliveira, V. d. C., Souza, M. T., Zanotto, E. D., Watanabe, E., & Coraça-Huber, D. (2020). Biofilm Formation and Expression of Virulence Genes of Microorganisms Grown in Contact with a New Bioactive Glass. Pathogens, 9(11), 927. https://doi.org/10.3390/pathogens9110927