Putative Role of a Yet Uncharacterized Protein Elicitor PeBb1 Derived from Beauveria bassiana ARSEF 2860 Strain against Myzus persicae (Homoptera: Aphididae) in Brassica rapa ssp. pekinensis
Abstract
:1. Introduction
2. Results
2.1. Purification, Identification, and Characterization of PeBb1 Protein
2.2. Gene Cloning
2.3. PeBb1-Induced Necrosis in Tobacco Leaves
2.4. Effect of PeBb1 Elicitor on the Fecundity Rate of M. persicae
2.5. Expression of Plant Defense-Related Genes in Response to PeBb1 Elicitor
3. Discussion
4. Materials and Methods
4.1. Rearing of Aphids
4.2. Plant, Pathogen and Bacterial Culture
4.3. Isolation of Crude Protein
4.4. Protein Purification and Mass Spectrometry
4.5. Gene Cloning
4.6. Expression and Purification of Recombinant Protein
4.7. Characterization of PeBb1 Elicitor Protein
4.8. Bioassay of Elicitor Activity against M. Persicae
4.9. Expression Analysis of Plant Defense-Related Genes Using RT-qPCR
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Oerke, E.-C. Crop losses to pests. J. Agric. Sci. 2006, 144, 31–43. [Google Scholar] [CrossRef]
- Deutsch, C.A.; Tewksbury, J.J.; Tigchelaar, M.; Battisti, D.S.; Merrill, S.C.; Huey, R.B.; Naylor, R.L. Increase in crop losses to insect pests in a warming climate. Science 2018, 361, 916–919. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chowański, S.; Kudlewska, M.; Marciniak, P.; Rosiński, G. Synthetic Insecticides—Is There an Alternative? Polish J. Environ. Stud. 2014, 23, 291–302. [Google Scholar]
- Mesnage, R.; Séralini, G.-E. Editorial: Toxicity of Pesticides on Health and Environment. Front. Public Health 2018, 6, 268. [Google Scholar] [CrossRef] [PubMed]
- Copping, L.G.; Menn, J.J. Biopesticides: A review of their action, applications and efficacy. Pest Manag. Sci. Former. Pestic. Sci. 2000, 56, 651–676. [Google Scholar] [CrossRef]
- Burges, H.D. Formulation of Microbial Biopesticides: Beneficial Microorganisms, Nematodes and Seed Treatments; Springer: Berlin/Heidelberg, Germany, 2012; ISBN 9401149267. [Google Scholar]
- Ruiu, L. Microbial biopesticides in agroecosystems. Agronomy 2018, 8, 235. [Google Scholar] [CrossRef] [Green Version]
- Wraight, S.P.; Carruthers, R.I. Production, delivery, and use of mycoinsecticides for control of insect pests on field crops. In Biopesticides: Use and Delivery; Springer: Berlin/Heidelberg, Germany, 1999; pp. 233–269. [Google Scholar]
- Vega, F.E.; Meyling, N.V.; Luangsa-ard, J.J.; Blackwell, M. Chapter 6-Fungal Entomopathogens; Vega, F.E., Kaya, H.K., Eds.; Academic Press: San Diego, CA, USA, 2012; pp. 171–220. ISBN 978-0-12-384984-7. [Google Scholar]
- Ortiz-Urquiza, A.; Keyhani, N.O.; Quesada-Moraga, E. Culture conditions affect virulence and production of insect toxic proteins in the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Technol. 2013, 23, 1199–1212. [Google Scholar] [CrossRef]
- Zimmermann, G. Review on safety of the entomopathogenic fungi Beauveria bassiana and Beauveria brongniartii. Biocontrol Sci. Technol. 2007, 17, 553–596. [Google Scholar] [CrossRef]
- Butt, T.M. Use of entomogenous fungi for the control of insect pests. In Agricultural Applications; Springer: Berlin/Heidelberg, Germany, 2002; pp. 111–134. [Google Scholar]
- Fan, Y.; Fang, W.; Guo, S.; Pei, X.; Zhang, Y.; Xiao, Y.; Li, D.; Jin, K.; Bidochka, M.J.; Pei, Y. Increased insect virulence in Beauveria bassiana strains overexpressing an engineered chitinase. Appl. Environ. Microbiol. 2007, 73, 295–302. [Google Scholar] [CrossRef] [Green Version]
- Thomas, M.B.; Read, A.F. Can fungal biopesticides control malaria? Nat. Rev. Microbiol. 2007, 5, 377. [Google Scholar] [CrossRef]
- Hegedus, D.D.; Khachatourians, G.G. The impact of biotechnology on hyphomycetous fungal insect biocontrol agents. Biotechnol. Adv. 1995, 13, 455–490. [Google Scholar] [CrossRef]
- St Leger, R.; Screen, S.; Butt, T.; Jackson, C.; Magan, N. Prospects for strain improvement of fungal pathogens of insects and weeds. In Fungi as Biocontrol Agents Progress, Probl. Potential; CABI: Wallingford, UK, 2001; pp. 219–237. [Google Scholar]
- St Leger, R.J.; Wang, C.; Stock, S.; Vandenberg, J.; Glazer, I. Entomopathonic fungi and the genomics era. Insect Pathog. Mol. Approaches Tech. CABI 2009, 365–400. [Google Scholar]
- Ortiz-Urquiza, A.; Garrido-Jurado, I.; Borrego, A.; Quesada-Moraga, E. Effects of cultural conditions on fungal biomass, blastospore yields and toxicity of fungal secreted proteins in batch cultures of Metarhizium anisopliae (Ascomycota: Hypocreales). Pest Manag. Sci. 2010, 66, 725–735. [Google Scholar] [CrossRef] [PubMed]
- Quesada-Moraga, E.; Carrasco-Díaz, J.; Santiago-Álvarez, C. Insecticidal and antifeedant activities of proteins secreted by entomopathogenic fungi against Spodoptera littoralis (Lep. Noctuidae). J. Appl. Entomol. 2006, 130, 442–452. [Google Scholar] [CrossRef]
- Ortiz-Urquiza, A.; Vergara-Ortiz, A.; Santiago-Álvarez, C.; Quesada-Moraga, E. Insecticidal and sublethal reproductive effects of Metarhizium anisopliae culture supernatant protein extract on the Mediterranean fruit fly. J. Appl. Entomol. 2010, 134, 581–591. [Google Scholar] [CrossRef]
- Ortiz-Urquiza, A.; Keyhani, N. Action on the surface: Entomopathogenic fungi versus the insect cuticle. Insects 2013, 4, 357–374. [Google Scholar] [CrossRef] [PubMed]
- Jaber, L.R.; Ownley, B.H. Can we use entomopathogenic fungi as endophytes for dual biological control of insect pests and plant pathogens? Biol. Control 2018, 116, 36–45. [Google Scholar] [CrossRef]
- Basit, A.; Hanan, A.; Nazir, T.; Majeed, M.Z.; Qiu, D. Molecular and Functional Characterization of Elicitor PeBC1 Extracted from Botrytis cinerea Involved in the Induction of Resistance against Green Peach Aphid (Myzus persicae) in Common Beans (Phaseolus vulgaris L.). Insects 2019, 10, 35. [Google Scholar] [CrossRef] [Green Version]
- Qiu, D.; Mao, J.; Yang, X.; Zeng, H. Expression of an elicitor-encoding gene from Magnaporthe grisea enhances resistance against blast disease in transgenic rice. Plant Cell Rep. 2009, 28, 925–933. [Google Scholar] [CrossRef]
- Zhang, W.; Yang, X.; Qiu, D.; Guo, L.; Zeng, H.; Mao, J.; Gao, Q. PeaT1-induced systemic acquired resistance in tobacco follows salicylic acid-dependent pathway. Mol. Biol. Rep. 2011, 38, 2549–2556. [Google Scholar] [CrossRef]
- Thomma, B.P.; Nürnberger, T.; Joosten, M.H. Of PAMPs and effectors: The blurred PTI-ETI dichotomy. Plant Cell 2011, 23, 4–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dangl, J.L.; Jones, J.D.G. Plant pathogens and integrated defence responses to infection. Nature 2001, 411, 826. [Google Scholar] [CrossRef] [PubMed]
- Chisholm, S.T.; Coaker, G.; Day, B.; Staskawicz, B.J. Host-microbe interactions: Shaping the evolution of the plant immune response. Cell 2006, 124, 803–814. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garcia-Brugger, A.; Lamotte, O.; Vandelle, E.; Bourque, S.; Lecourieux, D.; Poinssot, B.; Wendehenne, D.; Pugin, A. Early signaling events induced by elicitors of plant defenses. Mol. Plant-Microbe Interact. 2006, 19, 711–724. [Google Scholar] [CrossRef] [Green Version]
- Kunkel, B.N.; Brooks, D.M. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 2002, 5, 325–331. [Google Scholar] [CrossRef]
- De Ilarduya, O.M.; Xie, Q.; Kaloshian, I. Aphid-induced defense responses in Mi-1-mediated compatible and incompatible tomato interactions. Mol. Plant-Microbe Interact. 2003, 16, 699–708. [Google Scholar] [CrossRef] [Green Version]
- Koornneef, A.; Pieterse, C.M.J. Cross talk in defense signaling. Plant Physiol. 2008, 146, 839–844. [Google Scholar] [CrossRef] [Green Version]
- Maffei, M.E.; Arimura, G.-I.; Mithöfer, A. Natural elicitors, effectors and modulators of plant responses. Nat. Prod. Rep. 2012, 29, 1288–1303. [Google Scholar] [CrossRef]
- Boughton, A.J.; Hoover, K.; Felton, G.W. Impact of chemical elicitor applications on greenhouse tomato plants and population growth of the green peach aphid, Myzus persicae. Entomol. Exp. Appl. 2006, 120, 175–188. [Google Scholar] [CrossRef]
- Cooper, W.R.; Goggin, F.L. Effects of jasmonate-induced defenses in tomato on the potato aphid, Macrosiphum euphorbiae. Entomol. Exp. Appl. 2005, 115, 107–115. [Google Scholar] [CrossRef]
- Bostock, R.M.; Karban, R.; Thaler, J.S.; Weyman, P.D.; Gilchrist, D. Signal interactions in induced resistance to pathogens and insect herbivores. Eur. J. Plant Pathol. 2001, 107, 103–111. [Google Scholar] [CrossRef]
- Hamza, R.; Pérez-Hedo, M.; Urbaneja, A.; Rambla, J.L.; Granell, A.; Gaddour, K.; Beltrán, J.P.; Cañas, L.A. Expression of two barley proteinase inhibitors in tomato promotes endogenous defensive response and enhances resistance to Tuta absoluta. BMC Plant Biol. 2018, 18, 24. [Google Scholar] [CrossRef] [PubMed]
- Thaler, J.S.; Stout, M.J.; Karban, R.; Duffey, S.S. Exogenous jasmonates simulate insect wounding in tomato plants (Lycopersicon esculentum) in the laboratory and field. J. Chem. Ecol. 1996, 22, 1767–1781. [Google Scholar] [CrossRef] [PubMed]
- Thaler, J.S.; Humphrey, P.T.; Whiteman, N.K. Evolution of jasmonate and salicylate signal crosstalk. Trends Plant Sci. 2012, 17, 260–270. [Google Scholar] [CrossRef] [PubMed]
- Schaller, F.; Schaller, A.; Stintzi, A. Biosynthesis and metabolism of jasmonates. J. Plant Growth Regul. 2004, 23, 179–199. [Google Scholar] [CrossRef]
- Moran, P.J.; Thompson, G.A. Molecular responses to aphid feeding in Arabidopsis in relation to plant defense pathways. Plant Physiol. 2001, 125, 1074–1085. [Google Scholar] [CrossRef] [Green Version]
- De Vos, M.; Van Oosten, V.R.; Van Poecke, R.M.P.; Van Pelt, J.A.; Pozo, M.J.; Mueller, M.J.; Buchala, A.J.; Métraux, J.-P.; Van Loon, L.C.; Dicke, M. Signal signature and transcriptome changes of Arabidopsis during pathogen and insect attack. Mol. Plant-Microbe Interact. 2005, 18, 923–937. [Google Scholar] [CrossRef] [Green Version]
- D’Silva, I.; Heath, M.C. Purification and characterization of two novel hypersensitive response-inducing specific elicitors produced by the cowpea rust fungus. J. Biol. Chem. 1997, 272, 3924–3927. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
SOV | DF | SS | MS | F-Value | p-Value |
---|---|---|---|---|---|
Concentration | 3 | 18.67 | 6.224 | 9.58 | <0.001 |
Time | 6 | 3.94 | 0.656 | 1.01 | 0.4198 |
Concentration × Time | 18 | 3.18 | 0.177 | 0.27 | 0.9989 |
Error | 252 | 163.80 | 0.650 | ||
Total | 279 | 189.586 | |||
GM/CV | 2.19/36.77 |
Sr. No. | Gene ID | Gene Biochemical Name (Abbreviated) | Gene Biochemical Name (Detailed) |
---|---|---|---|
Jasmonic Pathway | |||
1 | LOC103848557 | Aln Oxi Synth | Allene oxide synthase, chloroplastic |
2 | LOC103836113 | Aln Oxi Cycl | Allene oxide cyclase 4, chloroplastic |
3 | LOC103836339 | Oxoph Reuct | Putative 12-oxophytodienoate reductase-like protein 1 |
4 | LOC103829425 | CoA Lig | 4-coumarate--CoA ligase-like 4 |
5 | LOC103837563 | Acyl CoA Oxid | peroxisomal-like Acyl-coenzyme A oxidase 2 |
6 | LOC103834740 | Prot AIM1 | Peroxisomal fatty acid beta-oxidation multifunctional protein AIM1-like |
7 | LOC103836556 | Ketoacyl CoA Thiol | Peroxisomal-like 3-ketoacyl-CoA thiolase |
8 | LOC103830390 | Lipoxygen | Lipoxygenase 2, chloroplastic-like |
Ethylene Pathway | |||
1 | LOC103836799 | S-Adeno Synth | S-adenosylmethionine synthase-like |
2 | LOC103835047 | Amino Carbox Synth 8 | 1-aminocyclopropane-1-carboxylate synthase 8 |
3 | LOC103833884 | Amino Carbox Synth 6 | 1-aminocyclopropane-1-carboxylate synthase 6 |
4 | LOC103828296 | Amino Carbox Synth 1 | 1-aminocyclopropane-1-carboxylate oxidase 1 |
Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Actin | TATGCTCTTCCACATGCTATTC | CCTTACGATTTCACGCTCTG |
103848557 | TTACTTCCACAAGCAAAAACCC | TTATCAACATCGAACAAAACCG |
103836113 | CGACCTCGTCCCTTTCACTA | AGCGTTCGCCTTTCTTCTCA |
103836339 | TCAGAACACTCTATTGCCACAT | CCTTCAAACGCCTTCCTCAT |
103829425 | CTATGGGCTACTCTGCTTCACT | CTCCGTCACCTCCTTACTCAA |
103837563 | CCAACGCACGACACCAAAGG | GAACGGAACCGCAAAGCCCC |
103834740 | CCTCTTTCGGCTTGCCATTA | TCCCATTTCTCCCGCTTTTA |
103836556 | GCTTCATCATCTTCAACCTC | CTTCTCTATCACCGCTCTCA |
103830390 | GGTCTTCACGCCAGGTTATG | ATTGTCTGTTTGCCGCTATT |
103836799 | GCAAAGTCCTCGTCAACATC | TCATCAGTAGCGTACCCAAA |
103835047 | CCTGGAGATGCTTTCTTGCT | TTAGTTCGGTTCGGGTTGTT |
103833884 | CATCCGCAAGAGCAAACTAC | CCATCCATATGAACAAACCG |
103828296 | GTGAAAATCTTGGTCTCCCTCG | CAGTATGTTCTCTCAGCCCTCT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nazir, T.; Hanan, A.; Basit, A.; Majeed, M.Z.; Anwar, T.; Nawaz, I.; Qiu, D. Putative Role of a Yet Uncharacterized Protein Elicitor PeBb1 Derived from Beauveria bassiana ARSEF 2860 Strain against Myzus persicae (Homoptera: Aphididae) in Brassica rapa ssp. pekinensis. Pathogens 2020, 9, 111. https://doi.org/10.3390/pathogens9020111
Nazir T, Hanan A, Basit A, Majeed MZ, Anwar T, Nawaz I, Qiu D. Putative Role of a Yet Uncharacterized Protein Elicitor PeBb1 Derived from Beauveria bassiana ARSEF 2860 Strain against Myzus persicae (Homoptera: Aphididae) in Brassica rapa ssp. pekinensis. Pathogens. 2020; 9(2):111. https://doi.org/10.3390/pathogens9020111
Chicago/Turabian StyleNazir, Talha, Abdul Hanan, Abdul Basit, Muhammad Zeeshan Majeed, Tauqir Anwar, Iqra Nawaz, and Dewen Qiu. 2020. "Putative Role of a Yet Uncharacterized Protein Elicitor PeBb1 Derived from Beauveria bassiana ARSEF 2860 Strain against Myzus persicae (Homoptera: Aphididae) in Brassica rapa ssp. pekinensis" Pathogens 9, no. 2: 111. https://doi.org/10.3390/pathogens9020111