ZnO Nanoflower-Based NanoPCR as an Efficient Diagnostic Tool for Quick Diagnosis of Canine Vector-Borne Pathogens
Abstract
:1. Introduction
2. Materials and Methods
2.1. ZnO Nanoflower Synthesis and Characterization
2.2. Sample and DNA Isolation
2.3. ZnO Nanoflower-Assisted PCR
2.4. Concentration of the Amplified DNA
2.5. Statistical Analysis
2.6. Ethical Statement
3. Results
3.1. Structure and Morphological Analysis of ZnO Nanoflowers
3.2. ZnO Nanoflower-Assisted NanoPCR Effects of ZnO Nanoflowers on PCR Assay
3.3. Concentration, Yield, and Purity of the Amplified DNA
3.4. Statistical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Mullis, K.B.; Faloona, F.A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 1987, 155, 335–350. [Google Scholar] [PubMed]
- Orita, M.; Suzuki, Y.; Sekiya, T.; Hayashi, K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989, 5, 874–879. [Google Scholar] [CrossRef]
- Larsen, J.N.; Strøman, P.; Ipsen, H. PCR based cloning and sequencing of isogenes encoding the tree pollen major allergen Car b I from Carpinus betulus, hornbeam. Mol. Immunol. 1992, 29, 703–711. [Google Scholar] [CrossRef]
- Cheng, J.; Zhang, Y.; Li, Q. Real-time PCR genotyping using displacing probes. Nucleic Acids Res. 2004, 32, e61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huber, M.; Mundlein, A.; Dornstauder, E.; Schneeberger, C.; Tempfer, C.B.; Mueller, M.W.; Schmidt, W.M. Accessing single nucleotide polymorphisms in genomic DNA by direct multiplex polymerase chain reaction amplification on oligonucleotide microarrays. Anal. Biochem. 2002, 303, 25–33. [Google Scholar] [CrossRef] [PubMed]
- Shendure, J.; Ji, H. Next-generation DNA sequencing. Nat. Biotechnol. 2008, 26, 1135–1145. [Google Scholar] [CrossRef]
- Welsh, J.; McClelland, M. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 1990, 18, 7213–7218. [Google Scholar] [CrossRef] [Green Version]
- Rerkamnuaychoke, B.; Chantratita, W.; Jomsawat, U.; Thanakitgosate, J.; Rojanasunan, P. Paternity testing by PCR-based STR analysis. J. Med. Assoc. Thail. 2000, 83 (Suppl. 1), S55–S62. [Google Scholar]
- Lazcka, F.; Del Campo, J.; Munoz, F.X. Pathogen detection: A perspective of traditional methods and biosensors. Biosens. Bioelectron. 2007, 22, 1205–1217. [Google Scholar] [CrossRef]
- Kasai, K.; Nakamura, Y.; White, R. Amplification of a variable number of tandem repeats (VNTR) locus (pMCT118) by the polymerase chain reaction (PCR) and its application to forensic science. J. Forensic Sci. 1990, 35, 1196–1200. [Google Scholar] [CrossRef]
- Yang, S.; Rothman, R.E. PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. Lancet Infect. Dis. 2004, 4, 337–348. [Google Scholar] [CrossRef]
- Al-Soud, W.A.; Radstrom, P. Capacity of nine thermostable DNA polymerases to mediate DNA amplification in the presence of PCR-inhibiting samples. Appl. Environ Microbiol. 1998, 64, 3748–3753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akane, A.; Matsubara, K.; Nakamura, H.; Takahashi, S.; Kimura, K. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J. Forensic Sci. 1994, 39, 362–372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weyant, R.S.; Edmonds, P.; Swaminathan, B. Effect of ionic and nonionic detergents on the Taq polymerase. Biotechniques 1990, 9, 308–309. [Google Scholar] [PubMed]
- Varadaraj, K.; Skinner, D.M. Denaturants or cosolvents improve the specificity of PCR amplification of a G+ C-rich DNA using genetically engineered DNA polymerases. Gene 1994, 140, 1–5. [Google Scholar] [CrossRef]
- Sarkar, G.; Kapelner, S.; Sommer, S.S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 1990, 18, 7465. [Google Scholar] [CrossRef] [Green Version]
- Musso, M.; Bocciardi, R.; Parodi, S.; Ravazzolo, R.; Ceccherini, I. Betaine, dimethyl sulfoxide, and 7-deaza-dGTP, a powerful mixture for amplification of GC-rich DNA sequences. J. Mol. Diagn. 2006, 8, 544–550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jensen, M.A.; Fukushima, M.; Davis, R.W. DMSO and betaine greatly improve amplification of GC-rich constructs in de novo synthesis. PLoS ONE 2010, 5, e11024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Drexler, K.E. Engines of Creation: The Coming Era of Nanotechnology; Anchor Books; Doubleday: New York, NY, USA, 1986. [Google Scholar]
- Nel, E.; Madler, L.; Velegol, D.; Xia, T.; Hoek, E.M.V.; Somasundaran, P.; Klaessig, F.; Castranova, V.; Thompson, M. Understanding biophysicochemical interactions at the nano–bio interface. Nat. Mater. 2009, 8, 543–557. [Google Scholar] [CrossRef] [PubMed]
- Geim, K.; Novoselov, K.S. The Rise of Graphene. Nat. Mater. 2007, 6, 183–191. [Google Scholar] [CrossRef]
- Berber, S.; Kwon, Y.K.; Tomanek, D. Unusually high thermal conductivity of carbon nanotubes. Phys. Rev. Lett. 2000, 84, 4613–4616. [Google Scholar] [CrossRef] [Green Version]
- Choi, J.W.; Oh, B.K.; Kim, Y.K.; Min, J. Nanotechnology in biodevices. J. Microbiol. Biotechnol. 2007, 17, 5–14. [Google Scholar] [PubMed]
- Li, J.Y.; Wang, X.M.; Wang, C.X.; Chen, B.A.; Dai, Y.Y.; Zhang, R.Y.; Song, M.; Lv, G.; Fu, D.G. The enhancement effect of gold nanoparticles in drug delivery and as biomarkers of drug-resistant cancer cells. Chem. Med. Chem. 2007, 2, 374–378. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, Q.; Ashall, B.; Zerulla, D.; Lee, G.U. Magnetic-plasmonic dual modulated FePt-Au ternary heterostructured nanorods as a promising nano-bioprobe. Adv. Mater. 2012, 24, 2485–2490. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Rothberg, L. Colorimetric detection of DNA sequences based on electrostatic interactions with unmodified gold nanoparticles. Proc. Natl. Acad. Sci. USA 2004, 101, 14036–14039. [Google Scholar] [CrossRef] [Green Version]
- Hurst, S.J.; Han, M.S.; Lytton-Jean, A.K.; Mirkin, C.A. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach. Anal. Chem. 2007, 79, 7201–7205. [Google Scholar] [CrossRef]
- Rosi, N.L.; Giljohann, D.A.; Thaxton, C.S.; Lytton-Jean, A.K.; Han, M.S.; Mirkin, C.A. Oligonucleotide-modified gold nanoparticles for intracellular gene regulation. Science 2006, 3, 1027–1030. [Google Scholar] [CrossRef]
- Tran, T.D.; Kim, M.I. Organic-inorganic hybrid nanoflowers as potent materials for bio sensing and bio catalytic applications. BioChip J. 2018. [Google Scholar] [CrossRef]
- Lin, Y.C.; Wu, H.L. Nano-PCR: Breaking the Bottom Limit of the PCR Denaturation Temperature Using Nanogold. In Proceedings of the Transducers 2007-International Solid-State Sensors, Actuators and Microsystems Conference, Lyon, France, 10–14 June 2007; pp. 391–394. [Google Scholar]
- Cui, D.; Tian, F.; Kong, Y.; Titushikin, I.; Gao, H. Effects of single-walled carbon nanotubes on the polymerase chain reaction. Nanotechnology 2004, 15, 154–157. [Google Scholar] [CrossRef]
- Li, H.; Huang, J.; Lv, J.; An, H.; Zhang, X.; Zhang, Z.; Fan, C.; Hu, J. Nanoparticle PCR: Nanogold-assisted PCR with enhanced specificity. Angew. Chem. Int. Ed. Engl. 2005, 44, 5100–5103. [Google Scholar] [CrossRef]
- Li, M.; Lin, Y.; Wu, C.; Liu, H. Enhancing the efficiency of a PCR using gold nanoparticles. Nuclic Acids Res. 2005, 33, e184. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Haber, A.L.; Griffiths, K.R.; Jamting, A.K.; Emslie, K.R. Addition of gold nanoparticles to real-time PCR: Effect on PCR profile and SYBR Green I fluorescence. Anal. Bioanal. Chem. 2008, 392, 887–896. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.H.; Yang, T.C.; Tsai, M.H.; Tsai, I.S.; Lu, H.C.; Chuang, P.H.; Wan, L.; Lin, Y.J.; Lai, C.H.; Lin, C.W. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus. Nanotechnology 2008, 19, 405101. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Wang, M.; An, H. An aqueous suspension of carbon nanopowder enhances the efficiency of PCR. Nanotechnology 2007, 18, 355706. [Google Scholar] [CrossRef]
- A Method to Optimize PCR Based on Nanoalloy with Pending. China Patent 200610016039.8, 2006.
- Zhang, Z.; Shen, C.; Wang, M.; Han, H.; Cao, X. Aqueous suspension of carbon nanotubes enhances the efficiency of long PCR. BioTechniques 2008, 44, 537–545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, W.; Shen, C.; Ji, Q.; An, H.; Wang, J.; Liu, Q.; Zhang, Z. Food storage material silver nanoparticles interfere with DNA replication fidelity and bind with DNA. Nanotechnology 2009, 20, 085102. [Google Scholar] [CrossRef]
- Xu, S.Y.; Yao, M.S. NanoPCR detection of bacterial aerosols. J. Aerosol Sci. 2013, 65, 1–9. [Google Scholar] [CrossRef]
- Wang, X.; Bai, A.; Zhang, J.; Kong, M.; Cui, Y.; Ma, X.; Ai, X.; Tang, Q.; Cui, S. A new nanoPCR molecular assay for detection of porcine bocavirus. J. Virol. Methods 2014, 202, 106–111. [Google Scholar] [CrossRef]
- Ma, X.J.; Cui, Y.C.; Qiu, Z.; Zhang, B.K.; Cui, S.J. A nanoparticle-assisted PCR assay to improve the sensitivity for rapid detection and differentiation of wild-type pseudorabies virus and gene-deleted vaccine strains. J. Virol. Methods 2013, 193, 374–378. [Google Scholar] [CrossRef]
- Cui, Y.; Wang, Z.; Ma, X.; Liu, J.; Cui, S.A. Sensitive and specific nanoparticle-assisted PCR assay for rapid detection of porcine parvovirus. Lett. Appl. Microbiol. 2014, 58, 163–167. [Google Scholar] [CrossRef] [Green Version]
- Lou, X.; Zhang, Y. Mechanism studies on nanoPCR and applications of gold nanoparticles in genetic analysis. ACS Appl. Mater. Interfaces 2013, 5, 6276–6284. [Google Scholar] [CrossRef] [PubMed]
- Jia, J.; Sun, L.; Hu, N.; Huang, G.; Weng, J. Graphene enhances the specificity of the polymerase chain reaction. Small 2012, 8, 2011–2015. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, L.; He, S.; Huang, J.; Cao, L.; Yang, F.; Li, L. Maximizing specificity and yield of PCR by the quantum dot itself rather than property of the quantum dot surface. Biochimie 2009, 91, 969–973. [Google Scholar] [CrossRef] [PubMed]
- Hwang, S.-H.; Im, S.-G.; Hah, S.S.; Cong, V.T.; Lee, E.J.; Lee, Y.-S.; Lee, G.K.; Lee, D.-H.; Son, S.J. Effects of upconversion nanoparticles on polymerase chain reaction. PLoS ONE 2013, 8, e73408. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liang, Y.; Luo, F.; Lin, Y.; Zhou, Q.; Jiang, G. C60 affects DNA replication in vitro by decreasing the melting temperature of DNA templates. Carbon 2009, 47, 1457–1465. [Google Scholar] [CrossRef]
- Williams, R.M.; Nayeem, S.; Dolash, B.D.; Sooter, L.J. The effect of DNA-dispersed single-walled carbon nanotubes on the polymerase chain reaction. PLoS ONE 2014, 9, e94117. [Google Scholar] [CrossRef] [Green Version]
- Tong, W.; Cao, X.; Wen, S.; Guo, R.; Shen, M.; Wang, J.; Shi, X. Enhancing the specificity and efficiency of polymerase chain reaction using polyethyleneimine-based derivatives and hybrid nanocomposites. Int. J. Nanomed. 2012, 7, 1069–1078. [Google Scholar]
- Kim, J.E.; Kim, H.; An, S.S.A.; Maeng, E.H.; Kim, M.K.; Song, Y.J. In vitro cytotoxicity of SiO2 or ZnO nanoparticles with different sizes and surface charges on U373Mg human glioblastoma cells. Int. J. Nanomed. 2014, 9, 235–241. [Google Scholar]
- Papavlassopoulos, H.; Mishra, Y.K.; Kaps, S.; Paulowicz, I.; Abdelaziz, R.; Elbahri, M.; Maser, E.; Adelung, R.; Röhl, C. Toxicity of functional nano-micro zinc oxide tetrapods: impact of cell culture conditions, cellular age and material properties. PLoS ONE 2014, 9, e84983. [Google Scholar] [CrossRef] [Green Version]
- Wahab, R.; Kaushik, N.; Khan, F.; Kaushik, N.K.; Choi, E.H.; Musarrat, J.; Al-Khedhairy, A.A. Self-styled ZnO nanostructures promotes the cancer cell damage and supresses the epithelial phenotype of glioblastoma. Sci. Rep. 2016, 6, 19950. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.T.; Lu, L.L.; Hu, Q.C.; Huang, F.; Lin, Z. ZnO nanoflowers based photo electrochemical Enzyme sensor for the detection of Pb2+. Biosens. Bioelectron. 2014, 56, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Ram, M.K.; Adami, M.; Paddeu, S.; Nicolini, C. Nano-assembly of glucose oxidase on the in situ self-assembled films of polypyrrole and its optical, surface and electrochemical characterizations. Nanotechnology 2000, 11, 112–119. [Google Scholar] [CrossRef]
- Zhu, X.L.; Yuri, I.; Gan, X.; Suzuki, I.; Li, G.X. Electrochemical study of the effect of nano-zinc oxide on micro peroxidase and its application to more sensitive hydrogen peroxide biosensor preparation. Biosens. Bioelectron. 2007, 22, 1600–1604. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.F.; Wang, X.L.; Ai, S.Y.; Sun, Z.D.; Wan, Q.; Zhu, Z.Q.; Xian, Y.Z.; Jin, L.T.; Yamamoto, K. Immobilization of uricase on ZnO nanorods for a reagent less uric acid biosensor. Anal. Chem. Acta 2004, 519, 155–160. [Google Scholar] [CrossRef]
- Singh, S.P.; Arya, S.K.; Pandey, P.; Malhotra, B.D.; Saha, S.; Sreenivas, K.; Gupta, V. Cholesterol biosensor based on rf sputtered zinc oxide nonporous thin film. Appl. Phys. Lett. 2007, 91, 63901–63903. [Google Scholar] [CrossRef]
- Zhao, Z.W.; Chen, X.J.; Tay, B.K.; Chen, J.S.; Han, Z.J.; Khor, K.A. A novel Amperometric biosensor based on ZnO: Co nanoclusters for biosensing glucose. Biosens. Bioelectron. 2007, 23, 135–139. [Google Scholar] [CrossRef]
- Cui, J.; Jia, S. Organic–inorganic hybrid nanoflowers: A novel host platform for immobilizing biomolecules. Coord. Chem. Rev. 2017. [Google Scholar] [CrossRef]
- Ma, Y.; Lu, Y.; Guan, G.; Luo, J.; Niu, Q.; Lui, J.; Yin, H.; Lui, G. Flower-like ZnO nanostructure assisted loop-mediated isothermal amplification assay for detection of Japanese encephalitis virus. Virus Res. 2017. [Google Scholar] [CrossRef]
- Kledmanee, K.; Suwanpakdee, S.; Krajangwong, S.; Chatsiriwech, J.; Suksai, P.; Suwannachat, P.; Sariya, L.; Buddhirongawatr, R.; Charoonrut, P.; Chaichoun, K. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood. Southeast Asian. J. Trop. Med. Public Health 2009, 40, 35–39. [Google Scholar]
- Inokuma, H.; Okuda, M.; Ohno, K.; Shimoda, K.; Onishi, T. Analysis of the 18S rRNA gene sequence of a Hepatozoon detected in two Japanese dogs. Vet. Parasitol. 2002, 106, 265–271. [Google Scholar] [CrossRef]
- Nie, L.; Gao, L.; Feng, P.; Zhang, J.; Fu, X.; Liu, Y.; Yan, X.; Wang, T. Three-dimensional functionalized tetrapod-like ZnO nanostructures for plasmid DNA delivery. Small 2006, 2, 621–625. [Google Scholar] [CrossRef] [PubMed]
- Pan, J.; Li, H.; Cao, X.; Huang, J.; Zhang, X.; Fan, C.; Hu, J. Nanogold-assited multi-round PCR. J. Nanosci. Nanotechnol. 2007, 7, 4428–4433. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Li, J.; Cao, X.; Wang, Z. Silver nanoparticles enhance the speci-ficity of repeated long PCR amplification. J. Tianjin Univ. Sci. Technol. 2007, 22, 1–5. [Google Scholar]
- Dun, P.; Yangqin, W.; Lijuan, M.; Chunhai, F.; Jun, H. Nanomaterials-based Polymerase Chain Reactions for DNA Detection; Laboratory of Physical Biology, Shanghai Institute of Applied Physics, Chinese Academy of Sciences: Shanghai, China, 2011. [Google Scholar]
- Fadhil, A.M.A.; Al-Jeboory, M.R.; Al-Jailawi, M.H. Improving and enhancement of PCR amplification by using ZnO and TiO2 nanoparticles. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 549–557. [Google Scholar]
- Abdul Khaliq, R.; Sonawane, P.J.; Sasi, B.K.; Sahu, B.S.; Pradeep, T.; Das, S.K.; Mahapatra, N.R. Enhancement in the efficiency of polymerase chain reaction by TiO2 nanoparticles: crucial role of enhanced thermal conductivity. Nanotechnology 2010, 21, 255704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nie, L.; Gao, L.; Yan, X.; Wang, T. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery. Nanotechnology 2007, 18, 015101. [Google Scholar] [CrossRef]
- Petralia, S.; Barbuzzi, T.; Ventimiglia, G. Polymerase chain reaction efficiency improved by water soluble β-cyclodextrins capped platinum nanoparticles. Mater. Sci. Eng. C 2012, 32, 848–850. [Google Scholar] [CrossRef]
- Chan, W.C.W.; Udugama, B.; Kadhiresan, P.; Kim, J.; Mubareka, S.; Weiss, P.S.; Parak, W.J. Patients, here comes more nanotechnology. ACS Nano 2016, 10, 8139–8142. [Google Scholar] [CrossRef] [Green Version]
Set A | PCR Mix Components | PCR Mix 1 (without ZnO Nanoflower Solution) | PCR Mix 2 (with ZnO Nanoflower Solution) | Thermal Cycling Conditions for PCR | |
PCR buffer mix (TransGen Biotech) | 12.5 μL | 12.5 μL | 94 °C | 5 min | |
Primer (forward/reverse) | 0.5 μL | 0.5 μL | 94 °C 54 °C 72 °C | 1 min (35cycles) | |
ddH2O | 9.5 μL | 4.5 μL | 72 °C | 5 min | |
Nanomaterial (ZnO nanoflower solution) | NA | 5 μL | 4 °C | ∞ | |
DNA (Babesia canis vogeli/Hepatozoon canis) | 2 μL | 2 μL | |||
Set B | PCR Mix Components | PCR Mix 1 (without ZnO Nanoflower Solution) | PCR Mix2 (with ZnO Nanoflower Solution) | Thermal Cycling Conditions for PCR (Modified Conditions) | |
PCR buffer mix (TransGen Biotech) | 12.5 μL | 12.5 μL | 94 °C | 2.5 min | |
Primer (forward/reverse) | 0.5 μL | 0.5 μL | 94 °C 54 °C 72 °C | 30 s 1 min (25 cycles) 30 s | |
ddH2O | 9.5 μL | 4.5 μL | 72 °C | 3 min | |
Nanomaterial (ZnO nanoflower solution) | NA | 5 μL | 4 °C | ∞ | |
DNA (B. canis vogeli/H. canis) | 2 μL | 2 μL |
Pathogen | Primer Sets | Product Size (bp) | Reference |
B. canis vogeli | Ba103F: CCAATCCTGACACAGGGAGGTAGTGACA Ba721R: CCCCAGAACCCAAAGACTTTGATTTCTCTCAAG | 619 | Kledmanee et al. (2009) [62] |
H. canis | HEP-F: ATACATGAGCAAAATCTCAAC HEP-R: CTTATTATTCCATGCTGCAG | 666 | Inokuma et al. (2002) [63] |
Set A | Sample | Average Concentration of Amplified DNA(ng/μL)± Standard Deviation | Purity A260/280 |
B1 | 676.2 ± 10 b | 1.8 | |
B2 | 811.2 ± 12 a | 1.8 | |
H1 | 799.5 ± 9 b | 1.7 | |
H2 | 849.6 ± 8 a | 1.8 | |
Set B | Sample | Concentration of Amplified DNA(ng/μL)± Standard Deviation | Purity A260/280 |
B3 | 550.2 ± 11 b | 1.2 | |
B4 | 815.9 ± 10 a | 1.8 | |
H3 | 648.6 ± 12 b | 1.6 | |
H4 | 847.6 ± 9 a | 1.8 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Upadhyay, A.; Yang, H.; Zaman, B.; Zhang, L.; Wu, Y.; Wang, J.; Zhao, J.; Liao, C.; Han, Q. ZnO Nanoflower-Based NanoPCR as an Efficient Diagnostic Tool for Quick Diagnosis of Canine Vector-Borne Pathogens. Pathogens 2020, 9, 122. https://doi.org/10.3390/pathogens9020122
Upadhyay A, Yang H, Zaman B, Zhang L, Wu Y, Wang J, Zhao J, Liao C, Han Q. ZnO Nanoflower-Based NanoPCR as an Efficient Diagnostic Tool for Quick Diagnosis of Canine Vector-Borne Pathogens. Pathogens. 2020; 9(2):122. https://doi.org/10.3390/pathogens9020122
Chicago/Turabian StyleUpadhyay, Archana, Huan Yang, Bilal Zaman, Lei Zhang, Yundi Wu, Jinhua Wang, Jianguo Zhao, Chenghong Liao, and Qian Han. 2020. "ZnO Nanoflower-Based NanoPCR as an Efficient Diagnostic Tool for Quick Diagnosis of Canine Vector-Borne Pathogens" Pathogens 9, no. 2: 122. https://doi.org/10.3390/pathogens9020122