Molecular Diagnostics and Pathogenesis of Fungal Pathogens on Bast Fiber Crops
Abstract
:1. Introduction
2. Bast Fiber Crops
3. Fungal Pathogens of Bast Fiber Crops
4. Development of Molecular Identification of Bast Fiber Fungal Pathogens
5. Target DNA Selection and Molecular Assays of Fungal Pathogens on Bast Fiber Crops
6. Conclusions and Future Prospects
Author Contributions
Funding
Conflicts of Interest
References
- Kang, Z.S. Current status and development strategy for research on plant fungal diseases in China. Plant Protect 2010, 36, 9–12. (In Chinese) [Google Scholar]
- Goyal, S.; Ramawat, K.G.; Mérillon, J.M. Different shades of fungal metabolites: An overview. In Fungal Metabolites; Reference Series in Phytochemistry; Mérillon, J.M., Ramawat, K., Eds.; Springer: Berlin/Heidelberg, Germany, 2017; pp. 1–29. [Google Scholar]
- Tsui, C.K.; Woodhall, J.; Chen, W.; Lévesque, C.A.; Lau, A.; Schoen, C.D.; Baschien, C.; Najafzadeh, M.J.; de Hoog, G.S. Molecular techniques for pathogen identification and fungus detection in the environment. IMA Fungus 2011, 2, 177–189. [Google Scholar] [CrossRef] [PubMed]
- Guillemette, T.; Iacomi-Vasilescu, B.; Simoneau, P. Conventional and real-time PCR-based assay for detecting pathogenic Alternaria brassicae in cruciferous seed. Plant Dis. 2004, 88, 490–496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lievens, B.; Brouwer, M.; Vanachter, A.C.R.C.; Cammue, B.P.A.; Thomma, B.P.H.J. Real-time PCR for detection and quantification of fungal and Oomycete tomato pathogens in plant and soil samples. Plant Sci. 2006, 171, 155–165. [Google Scholar] [CrossRef]
- Luchi, N.; Capretti, P.; Pazzagli, M.; Pinzani, P. Powerful qPCR assays for the early detection of latent invaders: Interdisciplinary approaches in clinical cancer research and plant pathology. Appl. Microbiol. Biot. 2016, 100, 5189–5204. [Google Scholar] [CrossRef]
- Wetzel, T.; Candresse, T.; Macquaire, G.; Ravelonandro, M.; Dunez, J. A highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus detection. J. Virol. Methods 1992, 39, 27–37. [Google Scholar] [CrossRef]
- Khoodoo, M.H.R.; Sahin, F.; Jaufeerally-Fakim, Y. Sensitive detection of Xanthomonas axonopodispv. dieffenbachiae on Anthurium andreanum by immunocapture-PCR (IC-PCR) using primers designed from sequence characterized amplified regions (SCAR) of the blight pathogen. Eur. J. Plant Pathol. 2005, 112, 379–390. [Google Scholar] [CrossRef]
- Hindson, B.J.; Ness, K.D.; Masquelier, D.A.; Belgrader, P.; Heredia, N.J.; (one of ~38 collaborators). High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal. Chem. 2011, 83, 8604–8610. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [Green Version]
- Alka, R.; Nerida, D.; Nitin, M. Review: The future of plant pathogen diagnostics in a nursery production system. Biosens. Bioelectron. 2019, 145, 111631. [Google Scholar] [CrossRef]
- Amann, R.I.; Ludwig, W.; Schleifer, K.H. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 1995, 59, 143–169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuzdralinski, A.; Kot, A.; Szczerba, H.; Nowak, M.; Muszynska, M. A review of conventional PCR assays for the detection of selected phytopathogens of wheat. J. Mol. Microbiol. Biotechnol. 2017, 27, 175–189. [Google Scholar] [CrossRef] [PubMed]
- Lau, H.Y.; Botella, J.R. Advanced DNA-based point-of-care diagnostic methods for plant diseases detection. Front. Plant Sci. 2017, 8, 2016. [Google Scholar] [CrossRef]
- Tedersoo, L.; Drenkhan, R.; Anslan, S.; Morales-Rodriguez, C.; Cleary, M. High-throughput identification and diagnostics of pathogens and pests: Overview and practical recommendations. Mol. Ecol. Resour. 2019, 19, 47–76. [Google Scholar] [CrossRef] [Green Version]
- McCartney, H.A.; Foster, S.J.; Fraaije, B.A.; Ward, E. Molecular diagnostics for fungal plant pathogens. Pest Manag. Sci. 2003, 59, 129–142. [Google Scholar] [CrossRef]
- Young, B.A.; Hanson, K.E.; Gomez, C.A. Molecular diagnostic advances in transplant infectious diseases. Curr. Infect. Dis. Rep. 2019, 21, 52. [Google Scholar] [CrossRef]
- Wickes, B.L.; Wiederhold, N.P. Molecular diagnostics in medical mycology. Nat. Commun. 2018, 9, 5135. [Google Scholar] [CrossRef] [Green Version]
- Powers-Fletcher, M.V.; Hanson, K.E. Nonculture diagnostics in fungal disease. Infect. Dis. Clin. North Am. 2016, 30, 37–49. [Google Scholar] [CrossRef]
- Pari, L.; Baraniecki, P.; Kaniewski, R.; Scarfone, A. Harvesting strategies of bast fiber crops in Europe and in China. Ind. Crops Prod. 2015, 68, 90–96. [Google Scholar] [CrossRef]
- Fangueiro, R.; Rana, S. Natural Fibers: Advances in Science and Technology towards Industrial Applications; Springer: Berlin/Heidelberg, Germany, 2010. [Google Scholar]
- Luo, S.Y.; Li, D.F.; Gong, Y.C.; Wang, Y.F.; Tang, S.W. Research on breeding of bast fiber crops of IBFC in the past 50 years. Plant Fiber Sci. China 2009, 31, 82–92. (In Chinese) [Google Scholar]
- Prihastuti, H.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Hyde, K.D. Characterization of Colletotrichum species associated with coffee berries in northern Thailand. Fungal Divers. 2009, 39, 89–109. [Google Scholar]
- Serdani, M.; Rooney-Latham, S.; Wallis, K.M.; Blomquist, C.L. First report of Colletotrichum phormii causing anthracnose on New Zealand flax in the United States. Plant Dis. 2013, 97, 1115. [Google Scholar] [CrossRef] [PubMed]
- Golzar, H.; Wang, C. First report of Colletotrichum phormii the cause of anthracnose on Phormium tenax in Australia. Aust. Plant Dis. Notes 2010, 5, 110–112. [Google Scholar] [CrossRef] [Green Version]
- Niu, X.; Gao, H.; Qi, J.; Chen, M.; Tao, A.; Xu, J.; Dai, Z.; Su, J. Colletotrichum species associated with jute (Corchorus capsularis L.) anthracnose in southeastern China. Sci. Rep. 2016, 6, 25179. [Google Scholar] [CrossRef] [PubMed]
- Niu, X.P.; Gao, H.; Chen, Y.; Qi, J.M. First report of anthracnose on white jute (Corchorus capsularis) caused by Colletotrichum fructicola and C. siamense in China. Plant Dis. 2016, 100, 1243. [Google Scholar] [CrossRef]
- Kwon, J.H.; Lee, S.T.; Choi, Y.J.; Lee, S.D.; Kim, J. Outbreak of anthracnose on Hibiscus cannabinus caused by Colletotrichum sp in Korea. Plant Dis. 2015, 99, 1643–1644. [Google Scholar] [CrossRef]
- Wang, X.X.; Chen, J.; Wang, B.; Liu, L.J.; Huang, X.; Ye, S.T.; Peng, D.X. First report of anthracnose on Boehmeria nivea caused by Colletotrichum higginsianum in China. Plant Dis. 2011, 95, 1318. [Google Scholar] [CrossRef]
- Wang, X.X.; Wang, B.; Liu, J.L.; Chen, J.; Cui, X.P.; Jiang, H.; Peng, D.X. First report of anthracnose caused by Colletotrichum gloeosporioides on ramie in China. Plant Dis. 2010, 94, 1508. [Google Scholar] [CrossRef]
- Yu, Y.T.; Chen, J.; Gao, C.S.; Zeng, L.B.; Li, Z.M.; Zhu, T.T.; Sun, K.; Cheng, Y.; Sun, X.P.; Yan, L.; et al. First report of brown root rot caused by Pythium vexans on ramie in Hunan, China. Can. J. Plant Pathol. 2016, 38, 405–410. [Google Scholar] [CrossRef]
- Punja, Z.K.; Rodriguez, G. Fusarium and Pythium species infecting roots of hydroponically grown marijuana (Cannabis sativa L.) plants. Can. J. Plant Pathol. 2018, 40, 498–513. [Google Scholar] [CrossRef] [Green Version]
- McGehee, C.S.; Apicella, P.; Raudales, R.; Berkowitz, G.; Ma, Y.; Durocher, S.; Lubell, J. First report of root rot and wilt caused by Pythium myriotylum on hemp (Cannabis sativa) in the United States. Plant Dis. 2019, 103, 3288. [Google Scholar] [CrossRef]
- Punja, Z.K.; Scott, C.; Chen, S. Root and crown rot pathogens causing wilt symptoms on field-grown marijuana (Cannabis sativa L.) plants. Can. J. Plant Pathol. 2018, 40, 528–541. [Google Scholar] [CrossRef] [Green Version]
- Beckerman, J.; Nisonson, H.; Albright, N.; Creswell, T. First report of Pythium aphanidermatum crown and root rot of industrial hemp in the United States. Plant Dis. 2017, 101, 1038–1039. [Google Scholar] [CrossRef]
- Beckerman, J.; Stone, J.; Ruhl, G.; Creswell, T. First report of Pythium ultimum crown and root rot of industrial hemp in the United States. Plant Dis. 2018, 102, 2045. [Google Scholar] [CrossRef]
- Blum, A.; Bressan, M.; Zahid, A.; Trinsoutrot-Gattin, I.; Driouich, A.; Laval, K. Verticillium wilt on fiber flax: Symptoms and pathogen development in planta. Plant Dis. 2018, 102, 2421–2429. [Google Scholar] [CrossRef]
- Bressan, M.; Blum, A.; Castel, L.; Trinsoutrot-Gattin, I.; Laval, K.; Gangneux, C. Assessment of Verticillium flax inoculum in agroecosystem soils using real-time PCR assay. Appl. Soil Ecol. 2016, 108, 176–186. [Google Scholar] [CrossRef]
- Debode, J.; Van Poucke, K.; Franca, S.C.; Maes, M.; Höfte, M.; Heungens, K. Detection of multiple Verticillium species in soil using density flotation and real-time polymerase chain reaction. Plant Dis. 2011, 95, 1571–1580. [Google Scholar] [CrossRef]
- Ullah, M.W.; Haque, M.S.; Islam, M.S. First report of Fusarium oxysporum causing fusarium wilt on jute (Corchorus olitorius) in Bangladesh. Plant Dis. 2019, 103, 2673. [Google Scholar] [CrossRef]
- Melo, M.P.; Beserra, J.J.E.A.; Matos, K.S.; Lima, C.S.; Pereira, O.L. First report of a new lineage in the Fusarium solani species complex causing root rot on sunn hemp in Brazil. Plant Dis. 2016, 100, 1784–1785. [Google Scholar] [CrossRef]
- Wang, C.L.; Dai, Y.L. First report of sunn hemp fusarium wilt caused by Fusarium udum f. spcrotalariae in Taiwan. Plant Dis. 2018, 102, 1031. [Google Scholar] [CrossRef]
- Szarka, D.; Tymon, L.; Amsden, B.; Dixon, E.; Judy, J.; Gauthier, N. First report of powdery mildew caused by Golovinomyces spadiceus on industrial hemp (Cannabis sativa) in Kentucky. Plant Dis. 2019, 103, 1773. [Google Scholar] [CrossRef]
- Pépin, N.; Punja, Z.K.; Joly, D.L. Occurrence of powdery mildew caused by Golovinomyces cichoracearum sensu lato on Cannabis sativa in Canada. Plant Dis. 2018, 102, 2644. [Google Scholar] [CrossRef]
- Gevens, A.J.; Maia, G.; Jordan, S.A. First report of powdery mildew caused fly Golovinomyces cichoracearum on Crotalaria juncea (‘Tropic Sun’ sunn hemp). Plant Dis. 2009, 93, 427. [Google Scholar] [CrossRef] [PubMed]
- Zeng, X.P.; Fu, M.Y.; He, S.; Wu, F.Z.; Wang, S.Y.; Chen, H.; Wang, H.F. Identification of the pathogen causing leaf spot disease on Cannabis sativa. Mol. Plant Breed. 2018, 16, 7094–7098. (In Chinese) [Google Scholar]
- Yu, Y.T.; Zeng, L.B.; Huang, L.l.; Yan, Z.; Sun, K.; Zhu, T.T.; Zhu, A.G. First report of black leaf spot caused by Alternaria alternata on ramie in China. J. Phytopathol. 2016, 164, 358–361. [Google Scholar] [CrossRef]
- Doyle, V.P.; Tonry, H.T.; Amsden, B.; Beale, J.; Dixon, E.; Li, H.; Szarka, D.; Gauthier, N.W. First report of Cercospora cf. flagellaris on industrial hemp (Cannabis saliva) in Kentucky. Plant Dis. 2019, 103, 1784. [Google Scholar] [CrossRef]
- Thiessen, L.D.; Schappe, T. First report of Exserohilum rostratum causing foliar blight of industrial hemp (Cannabis saliva). Plant Dis. 2019, 103, 1414. [Google Scholar] [CrossRef]
- Casano, S.; Hernandez, C.A.; Delgado, M.M.; Garcia-Tejero, I.F.; Gomez, S.O.; Puig, A.A.; Santos, B.D.L. First report of charcoal rot caused by Macrophomina phaseolina on hemp (Cannabis sativa) varieties cultivated in southern Spain. Plant Dis. 2018, 102, 1665–1666. [Google Scholar] [CrossRef]
- Koike, S.T.; Stangbellini, H.; Mauzey, S.J.; Burkhardt, A. First report of sclerotinia crown rot caused by Sclerotinia minor on hemp. Plant Dis. 2019, 103, 1771. [Google Scholar] [CrossRef]
- McPartland, J.M.; Cubeta, M.A. New species, combinations, host associations and location records of fungi associated with hemp (Cannabis sativa). Mycol. Res. 1997, 101, 853–857. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.E.; Zhao, T.T.; Choi, I.Y.; Choi, Y.J.; Shin, H.D. First report of powdery mildew caused by Podosphaera xanthii on ramie in Korea. Plant Dis. 2016, 100, 1495–1496. [Google Scholar] [CrossRef]
- Norhayati, M.; Erneeza, M.H.; Kamaruzaman, S. Morphological, pathogenic and molecular characterization of Lasiodiplodia theobromae: A causal pathogen of black rot disease on kenaf seeds in Malaysia. Int. J. Agric. Biol. 2016, 18, 80–85. [Google Scholar] [CrossRef]
- Choi, I.Y.; Kang, C.H.; Lee, G.H.; Park, J.H.; Shin, H.D. Sooty mould disease caused by Leptoxyphium kurandae on kenaf. Mycobiology 2015, 43, 347–350. [Google Scholar] [CrossRef] [Green Version]
- Laitinen, R.; Malinen, E.; Palva, A. PCR-ELISAI: Application to simultaneous analysis of mixed bacterial samples composed of intestinal species. Syst. Appl. Microbiol. 2002, 25, 241–248. [Google Scholar] [CrossRef]
- Zhang, S.M.; Li, J.; Wang, Y.X.; Zhao, X.Y.; Zhang, X.C.; Meng, L.Q.; Tian, J.P. Advances in molecular diagnosis of plant fungal pathogens. J. Anhui Agric 2010, 38, 597–599, 664. (In Chinese) [Google Scholar]
- Bluhm, B.H.; Flaherty, J.E.; Cousin, M.A.; Woloshuk, C.P. Multiplex polymerase chain reaction assay for the differential detection of trichothecene-and fumonisin-producing species of Fusarium in Cornmeal. J. Food Protect. 2002, 65, 1955–1961. [Google Scholar] [CrossRef]
- Demeke, T.; Clear, R.M.; Patrick, S.K.; Gaba, D. Species specific PCR-based assays for the detection of Fusarium species and a comparison with the whole seed agar plate method and trichothecene analysis. Int. J. Food. Microbiol. 2005, 103, 271–284. [Google Scholar] [CrossRef] [PubMed]
- Torp, M.; Nirenberg, H.I. Fusarium langsethiae sp. nov. on cereals in Europe. Int. J. Food Microbiol. 2004, 95, 247–256. [Google Scholar] [CrossRef]
- White, T.J.; Bruns, T.; Lee, S.; Tailor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Edwards, S.G.; O’Callaghan, J.; Dobson, A.D.W. PCR-based detection and quantification of mycotoxigenic fungi. Mycol. Res. 2002, 106, 1005–1025. [Google Scholar] [CrossRef]
- Edel, V.; Steinberg, C.; Gautheron, N.; Alabouvette, C. Evaluation of restriction analysis of polymerase chain reaction (PCR)-amplified ribosomal DNA for the identification of Fusarium species. Mycol. Res. 1997, 101, 179–187. [Google Scholar] [CrossRef]
- Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Fungal Barcode Consortium (one of ~100 collaborators). Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc. Natl. Acad. Sci. USA 2012, 109, 6241–6246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, J. Fungal DNA barcoding. Genome 2016, 59, 913–932. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hughes, K.W.; Petersen, R.H.; Lickey, E.B. Using heterozygosity to estimate a percentage DNA sequence similarity for environmental species’ delimitation across basidiomycete fungi. New Phytol. 2009, 182, 795–798. [Google Scholar] [CrossRef] [PubMed]
- Ioos, R.; Fourrier, C.; Wilson, V.; Webb, K.; Schereffer, J.L.; Labrouhe, D.T. An optimized duplex real-time PCR tool for sensitive detection of the quarantine oomycete Plasmopara halstedii in sunflower seeds. Phytopathology 2012, 9, 908–917. [Google Scholar] [CrossRef] [Green Version]
- Mulé, G.; Susca, A.; Stea, G.; Moretti, A. A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. Eur. J. Plant Pathol. 2004, 110, 495–502. [Google Scholar] [CrossRef]
- Chevrier, D.; Rasmusse, S.R.; Gues-Jon, J.L. PCR product quantification by non-radioactive hybridization procedures using an oligonucleotide covalently bound to microwells. Mol. Cell. Probes 1993, 7, 187–197. [Google Scholar] [CrossRef]
- Maiden, M.C.J.; Bygraves, J.A.; Feil, E.; Morelli, G.; Russell, J.E.; Urwin, R.; Zhang, Q.; Zhou, J.; Zurth, K.; Caugant, D.A.; et al. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA 1998, 95, 3140–3145. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Vilgalys, R.; Mitchell, T.G. Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 2000, 9, 1471–1481. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Zhou, G.Y.; Liu, J.A.; Xu, J. Population genetic analyses of the fungal pathogen Colletotrichum fructicola on tea-oil trees in China. PLoS ONE 2016, 11, e0156841. [Google Scholar] [CrossRef] [Green Version]
- Pilet, F.; Quaicoe, R.N.; Osagie, I.J.; Freire, M.; Foissac, X. Multilocus sequence analysis reveals three distinct populations of “Candidatus Phytoplasma palmicola” with a specific geographical distribution on the African continent. Appl. Environ. Microbiol. 2019, 85, e02716-18. [Google Scholar] [CrossRef] [Green Version]
Crop | Main Distribution | Main Characters of Growth Habitat | Main Applications | Main Fungal Diseases |
---|---|---|---|---|
Flax (Linum usitatissimum Linnaeus) | France, Russia, Netherlands, Belarus, Belgium, Canada, Kazakhstan, China, India | Well-drained loam and cool, moist, temperate climates | Linen, flax yarn, flax seed, linseed oil | flax wilt, flax blight, flax anthracnose |
Hemp (Cannabis sativa Linnaeus) | China, Canada, USA, Europe, East Asia, Nepal | Grows at 16–27 °C, sufficient rain at the first six weeks of growth, short day length. | Textiles, hempseed oil, prescription drugs | hemp powdery mildew, hemp leaf spot disease, hemp blight, hemp root and crown rot wilt, hemp charcoal rot |
Jute (Corchorus capsularis Linnaeus) | India, Bangladesh, Burma, China | Tropical lowland areas, humidity of 60% to 90%, rain-fed crop | Textiles, medicine | jute anthracnose, jute brown wilt, jute leaf spot |
Kenaf (Hibiscus cannabinus Linnaeus) | India, Bangladesh, China, Malaysia, Thailand | Sandy loam and warm, humid subtropical, or tropical climates, few heavy rains or strong winds, at least 12 h light each day | Textiles | kenaf anthracnose, kenaf lack rot, kenaf sooty mold |
Ramie (Boehmeria nivea Linnaeus) Gaudich | China, Brazil, Philippines, India, Vietnam, Laos, Cambodia | Sandy soil and warm, wet climates, rainfall averaging at least 75 to 130 mm per month | Textiles, soil and water conservation, medicine | ramie anthracnose, ramie powdery mildew, ramie black leaf spot, ramie blight |
Sunn Hemp (Crotalaria juncea Linnaeus) | India, USA, China | Wide variety of soil condition, altitude from 100 to 1000 m, temperatures above 28 °C, photoperiod-sensitive | Cover crop or green manure, forage producer | sunn hemp fusarium wilt, sunn hemp root rot, sunn hemp powdery mildew |
Pathogen | Disease | Method | Marker | Host Plant | Geographic Region(s) | Reference | |
---|---|---|---|---|---|---|---|
Alternaria | |||||||
A. alternata | Hemp leaf spot | Conventional PCR | ITS | Cannabis sativa | Shanxi, China | [46] | |
A. alternata | Ramie black leaf spot | Conventional PCR | ITS, GAPDH | Boehmeria nivea | Hunan, Hubei, China | [47] | |
Cercospora | |||||||
Cercospora cf. flagellaris | Hemp leaf spot disease | Not mentioned | ITS, EF-1α, CAL, H3, actin | Cannabis sativa | Kentucky, USA | [48] | |
Colletotrichum | |||||||
C. corchorum capsularis | Jute anthracnose | Conventional PCR | ACT, TUB2, CAL, GAPDH, GS, and ITS | Corchorus capsularis L. | Zhejiang, Fujian, Guangxi, and Henan, China | [27] | |
C. fructicola | Jute anthracnose | Conventional PCR | ACT, TUB2, CAL, GAPDH, GS, and ITS | Corchorus capsularis L. | Zhejiang, Fujian, Guangxi, and Henan, China | [26] | |
C. fructicola | Jute anthracnose | Conventional PCR | ACT, TUB2, CAL, GAPDH, GS, and ITS | Corchorus capsularis L. | Zhejiang, Fujian, Guangxi, and Henan, China | [27] | |
C. gloeosporioides | Ramie anthracnose | Conventional PCR | ITS | Boehmeria nivea | HuBei, HuNan, JiangXi, and SiChuan, China | [30] | |
C. higginsianum | Ramie anthracnose | Conventional PCR | ITS | Boehmeria nivea | HuBei, China | [29] | |
C. phormii | New Zealand flax anthracnose | Conventional PCR | ITS | Phormium tenax | California, USA | [24] | |
C. phormii | New Zealand flax anthracnose | Conventional PCR | ITS | Phormium tenax | Perth, Australia | [25] | |
C. siamense | Jute anthracnose | Conventional PCR | ACT, TUB2, CAL, GAPDH, GS, and ITS | Corchorus capsularis L. | Zhejiang, Fujian, Guangxi, and Henan, China | [26] | |
Colletotrichum sp. | Kenaf anthracnose | Conventional PCR | ITS | Corchorus olitorius | South Korea | [28] | |
Curvularia | |||||||
C. cymbopogonis | Hemp leaf spot | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Exserohilum | |||||||
E. rostratum | Hemp floral blight | Not mentioned | ITS, RPB2 | Cannabis sativa | North Carolina, USA | [49] | |
Fusarium | |||||||
F. oxysporum | Hemp roots and crown rot | Conventional PCR | ITS, EF-1α | Cannabis sativa | Canada | [32] | |
F. oxysporum | Jute brown wilt | Conventional PCR | ITS | Corchorus olitorius | Dhaka, Manikgonj, Kishorgonj, Rangpur, and Monirampur, Bangladesh | [40] | |
F. oxysporum | Hemp wilt | Conventional PCR | ITS, EF-1α | Cannabis sativa | California, USA | [34] | |
F. solani | Hemp crown root | Conventional PCR | ITS, EF-1α | Cannabis sativa | Canada | [32] | |
F. solani | Hemp wilt | Conventional PCR | ITS, EF-1α | Cannabis sativa | California, USA | [34] | |
F. solani | Sunn hemp root rot and wilt | Conventional PCR | ITS, EF-1α | Crotalaria juncea | Ceará, Brazil | [41] | |
F. brachygibbosum | Hemp wilt | Conventional PCR | ITS, EF-1α | Cannabis sativa | California, USA | [34] | |
F. udum f. sp. crotalariae | Sunn hemp fusarium wilt | Conventional PCR | EF-1α, β-tubulin | Crotalaria juncea | Tainan, China | [42] | |
Glomus | |||||||
G. mosseae | Hemp root rot | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Golovinomyces | |||||||
G. spadiceus | Hemp powdery mildew | Not mentioned | ITS, 28S | Cannabis sativa | Kentucky, USA | [43] | |
G. cichoracearum sensu lato | Hemp powdery mildew | Conventional PCR | ITS | Cannabis sativa | Atlantic Canada and British Columbia. | [44] | |
G. cichoracearum | Sunn hemp powdery mildew | Not mentioned | ITS | Crotalaria juncea | Florida, USA | [45] | |
Lasiodiplodia | |||||||
L. theobromae | Kenaf black rot | Conventional PCR | ITS | Corchorus olitorius | Kangar Perlis, Malaysia | [54] | |
Leptoxyphium | |||||||
L. kurandae | Kenaf sooty mould | Conventional PCR | ITS | Corchorus olitorius | Iksan, Korea | [55] | |
Macrophomina | |||||||
Macrophomina phaseolina | Hemp charcoal rot | Conventional PCR | EF-1α, CAL | Cannabis sativa | Southern Spain | [50] | |
Micropeltopsis | |||||||
Micropeltopsis cannabis | Unknown | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Orbilia | |||||||
Orbilia luteola | Unknown | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Pestalotiopsis | |||||||
Pestalotiopsissp. | Hemp spot blight | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Podosphaera | |||||||
P. xanthii | Ramie powdery mildew | Conventional PCR | ITS | Boehmeria nivea | Naju, Korea | [53] | |
Pythium | |||||||
P. dissotocum | Browning and a reduction in root mass, stunting | Conventional PCR | ITS, EF-1α | Cannabis sativa | Canada | [32] | |
P. myriotylum | Browning and a reduction in root mass, stunting | Conventional PCR | ITS, EF-1α | Cannabis sativa | Canada | [32] | |
P. myriotylum | Hemp root rot and Wilt | Conventional PCR | ITS, COI, COII | Cannabis sativa | Connecticut, USA | [33] | |
P. aphanidermatum | Hemp root rot and crown wilt | Conventional PCR | ITS | Cannabis sativa | California, USA | [34] | |
P. aphanidermatum | Hemp crown and root Rot | Conventional PCR | ITS | Cannabis sativa | Indiana, USA | [35] | |
P. ultimum | Hemp crown and root Rot | Conventional PCR | ITS | Cannabis sativa | Indiana, USA | [36] | |
Rhizoctonia | |||||||
Binucleate R. spp. | Hemp wilt | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Sclerotinia | |||||||
Sclerotinia minor | Hemp crown rot | Conventional PCR | ITS | Cannabis sativa | San Benito County, Canada | [51] | |
Sphaerotheca | |||||||
S. macularis | Hemp powdery mildew | Conventional PCR | 25S | Cannabis sativa | USA | [52] | |
Verticillium | |||||||
V. dahliae | flax wilt | Conventional PCR | ITS | Linum usitatissimum | La Haye Aubrée, France | [37] | |
V. dahliae | flax wilt | qPCR | ITS | Linum usitatissimum | Normandy, France | [38] | |
V. dahliae | flax wilt | qPCR | ß-tubulin | Linum usitatissimum | Germany | [39] | |
V. tricorpus | flax wilt | qPCR | ITS | Linum usitatissimum | Germany | [39] | |
V. longisporum | flax wilt | qPCR | ß-tubuIin | Linum usitatissimum | Germany | [39] |
Target DNA | Primer Name and Sequence (5′-3′) | Size of PCR Product (bp) | Reference | |
---|---|---|---|---|
18S | NS3 | GCAAGTCTGGTGCCAGCAGCC | Not mentioned | [31] |
NS4 | CTTCCGTCAATTCCTTTAAG | |||
28S | LR0R | GCAAGTCTGGTGCCAGCAGCC | Not mentioned | [31] |
LR3 | GCAAGTCTGGTGCCAGCAGCC | |||
25S | LROR | ACCCGCTGAACTTAAGC | 1431 | [52] |
LR7 | TACTACCACCAAGATCT | |||
ACT | ACT-512F | ATGTGCAAGGCCGGTTTCGC | 300 | [48] |
ACT-783R | TACGAGTCCTTCTGGCCCAT | |||
ß-tubulin | Vd-btub-1F | GCGACCTTAACCACCTCGTT | Not mentioned | [38] |
Vd-btub-1R | CGCGGCTGGTCAGAGGA | |||
VertBt-F | AACAACAGTCCGATGGATAATTC | Not mentioned | [38] | |
VertBt-R | GTACCGGGCTCGAGATCG | |||
VITubF2 | GCAAAACCCTACCGGGTTATG | 143 | [39] | |
VITubRl | AGATATCCATCGGACTGTTCGTA | |||
VdTubF2 | GGCCAGTGCGTAAGTTATTCT | 82 | [39] | |
VdTubR4 | ATCTGGTTACCCTGTTCATCC | |||
Bt2a | GGTAACCAAATCGGTGCTGCTTTC | Not mentioned | [26] | |
Bt2b | ACCCTCAGTGTAGTGACCCTTGGC | |||
CAL | CL1 | GARTWCAAGGAGGCCTTCTC | Not mentioned | [26] |
CL2 | TTTTTGCATCATGAGTTGGAC | |||
CAL-228F | GAGTTCAAGGAGGCCTTCTCCC | Not mentioned | [50] | |
CAL-737R | CATCTTTCTGGCCATCATGG | |||
EF-1α | EF-1 | ATGGGTAAGGAGGACAAGAC | 700 | [34] |
EF-2 | GGAGGTACCAGTGATCATGTT | |||
EF1-728F | CATCGAGAAGTTCGAGAAGG | Not mentioned | [50] | |
EF2 | GGAGGTACCAGTGATCATGTT | |||
EF1-728F | CATCGAGAAGTTCGAGAAGG | 350 | [48] | |
EF1-983R | TACTTGAAGGAACCCTTACC | |||
Endochitinase | Vd-endoch-1F | CTCGGAGGTGCCATGTACTG | Not mentioned | [38] |
Vd-endoch-1R | ACTGCCTGGCCCAGGTTC | |||
GAPDH | Vd-G3PD-2F | CACGGCGTCTTCAAGGGT | Not mentioned | [38] |
Vd-G3PD-1R | CAGTGGACTCGACGACGTAC | |||
GDF1 | GCCGTCAACGACCCCTTCATTGA | Not mentioned | [26] | |
GDR1 | GGGTGGAGTCGTACTTGAGCATGT | |||
gpd-1 | CAACGGCTTCGGTCGCATTG | Not mentioned | [47] | |
gpd-2 | GCCAAGCAGTTGGTTGTGC | |||
GS | GSF1 | ATGGCCGAGTACATCTGG | Not mentioned | [26] |
GSR1 | GAACCGTCGAAGTTCCAC | |||
ITS | ITS1 | TCCGTAGGTGAACCTGCGG | 334-738 | [24,30,35,36,37,38] |
ITS4 | TCCTCCGCTTATTGATATGC | |||
Vd-ITS1-45-F | CCGGTCCATCAGTCTCTCTG | 334 | [37] | |
Vd-ITS2-379-R | ACTCCGATGCGAGCTGTAAC | |||
ITS1-F | CTTGGTCATTTAGAGGAAGTAA | 700 | [34] | |
ITS4 | TCCTCCGCTTATTGATATGC | |||
VtF4 | CCGGTGTTGGGGATCTACT | 123 | [39] | |
VtR2 | GTAGGGGGTTTAGAGGCTG | |||
ITS 4 | TCCTCCGCTTATTGATATGC | Not mentioned | [26] | |
ITS 5 | GGAAGTAAAAGTCGTAACAAGG | |||
RPB2 | bRPB2-6F | TGGGGYATGGTNTGYCCYGC | Not mentioned | [49] |
bRPB2-7R | GAYTGRTTRTGRTCRGGGAAVGG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, Y.; Tang, X.; Gao, C.; Li, Z.; Chen, J.; Guo, L.; Wang, T.; Xu, J. Molecular Diagnostics and Pathogenesis of Fungal Pathogens on Bast Fiber Crops. Pathogens 2020, 9, 223. https://doi.org/10.3390/pathogens9030223
Cheng Y, Tang X, Gao C, Li Z, Chen J, Guo L, Wang T, Xu J. Molecular Diagnostics and Pathogenesis of Fungal Pathogens on Bast Fiber Crops. Pathogens. 2020; 9(3):223. https://doi.org/10.3390/pathogens9030223
Chicago/Turabian StyleCheng, Yi, Xiaoyu Tang, Chunsheng Gao, Zhimin Li, Jia Chen, Litao Guo, Tuhong Wang, and Jianping Xu. 2020. "Molecular Diagnostics and Pathogenesis of Fungal Pathogens on Bast Fiber Crops" Pathogens 9, no. 3: 223. https://doi.org/10.3390/pathogens9030223