Multiple Tick-Borne Pathogens in Ixodes ricinus Ticks Collected from Humans in Romania
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Tick Collection and Species Identification
4.2. DNA Isolation
4.3. Tick-Borne Pathogen Detection
4.4. DNA Sequencing
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dantas-Torres, F.; Otranto, D. Best Practices for Preventing Vector-Borne Diseases in Dogs and Humans. Trends Parasitol. 2016, 32, 43–55. [Google Scholar]
- Mihalca, A.D.; Sándor, A.D. The role of rodents in the ecology of Ixodes ricinus and associated pathogens in central and Eastern Europe. Front. Cell. Infect. Microbiol. 2013, 4, 3–5. [Google Scholar]
- Kalmár, Z.; Sándor, A.D.; Matei, I.A.; Ionicǎ, A.; D’Amico, G.; Gherman, C.M.; Mihalca, A.D. Borrelia spp. in small mammals in Romania. Parasit. Vectors 2019, 12, 1–6. [Google Scholar]
- Briciu, V.T.; Meyer, F.; Sebah, D.; Ţǎţulescu, D.F.; Coroiu, G.; Lupşe, M.; Carstina, D.; Mihalca, A.D.; Hizo-Teufel, C.; Klier, C.; et al. Real-time PCR-based identification of Borrelia burgdorferi sensu lato species in ticks collected from humans in Romania. Ticks Tick Borne Dis. 2014, 5, 575–581. [Google Scholar]
- Briciu, V.T.; Sebah, D.; Coroiu, G.; Lupşe, M.; Cârstina, D.; Ţăţulescu, D.F.; Mihalca, A.D.; Gherman, C.M.; Leucuţa, D.; Meyer, F.; et al. Immunohistochemistry and real-time PCR as diagnostic tools for detection of Borrelia burgdorferi sensu lato in ticks collected from humans. Exp. Appl. Acarol. 2016, 69, 49–60. [Google Scholar]
- Briciu, V.T.; Flonta, M.; Ţăţulescu, D.F.; Meyer, F.; Sebah, D.; Cârstina, D.; Mihalca, A.D.; Gherman, C.M.; Hizo-Teufel, C.; Huber, I.; et al. Clinical and serological one-year follow-up of patients after the bite of Ixodes ricinus ticks infected with Borrelia burgdorferi sensu lato. Infect. Dis. 2017, 49, 277–285. [Google Scholar]
- Matei, I.A.; Kalmár, Z.; Lupşe, M.; D’Amico, G.; Ionică, A.M.; Dumitrache, M.O.; Gherman, C.M.; Mihalca, A.D. The risk of exposure to rickettsial infections and human granulocytic anaplasmosis associated with Ixodes ricinus tick bites in humans in Romania: A multiannual study. Ticks Tick Borne Dis. 2017, 8, 375–378. [Google Scholar]
- Andersson, M.O.; Marga, G.; Banu, T.; Dobler, G.; Chitimia-Dobler, L. Tick-borne pathogens in tick species infesting humans in Sibiu County, central Romania. Parasitol. Res. 2018, 117, 1591–1597. [Google Scholar]
- Otranto, D.; Dantas-Torres, F.; Santos-Silvia, M.M. Ixodes ricinus (Linnaeus, 1758). In Ticks of Europe and North Africa, a guide to species identification; Estrada-Peña, A., Mihalca, A.D., Petney, T., Eds.; Springer: Berlin, Germany, 2017; pp. 189–195. [Google Scholar]
- Coipan, E.C.; Vladimirescu, A.F. First report of lyme disease spirochetes in ticks from Romania (Sibiu County). Exp. Appl. Acarol. 2010, 52, 193–197. [Google Scholar]
- Coipan, E.C.; Vladimirescu, A.F. Ixodes ricinus ticks (Acari: Ixodidae): Vectors for Lyme disease spirochetes in Romania. Exp. Appl. Acarol. 2011, 54, 293–300. [Google Scholar]
- Kalmár, Z.; Mihalca, A.D.; Dumitrache, M.O.; Gherman, C.M.; Magdaş, C.; Mircean, V.; Oltean, M.; Domşa, C.; Matei, I.A.; Mǎrcuţan, D.I.; et al. Geographical distribution and prevalence of Borrelia burgdorferi genospecies in questing Ixodes ricinus from Romania: A countrywide study. Ticks Tick Borne Dis. 2013, 4, 403–408. [Google Scholar]
- Kalmár, Z.; Sprong, H.; Mihalca, A.D.; Gherman, C.M.; Dumitrache, M.O.; Coipan, E.C.; Fonville, M.; Cozma, V. Borrelia miyamotoi and Candidatus Neoehrlichia mikurensis in Ixodes ricinus ticks, Romania. Emerg. Infect. Dis. 2016, 22, 550–551. [Google Scholar]
- Matei, I.A.; Kalmár, Z.; Magdaş, C.; Magdaş, V.; Toriay, H.; Dumitrache, M.O.; Ionică, A.M.; D’Amico, G.; Sándor, A.D.; Mărcuţan, D.I.; et al. Anaplasma phagocytophilum in questing Ixodes ricinus ticks from Romania. Ticks Tick Borne Dis. 2015, 6, 408–413. [Google Scholar]
- Raileanu, C.; Moutailler, S.; Pavel, I.; Porea, D.; Mihalca, A.D.; Savuta, G.; Vayssier-Taussat, M. Borrelia diversity and co-infection with other tick-borne pathogens in ticks. Front. Cell. Infect. Microbiol. 2017, 7, 1–12. [Google Scholar]
- Gherman, C.M.; Sándor, A.D.; Kalmár, Z.; Marinov, M.; Mihalca, A.D. First report of Borrelia burgdorferi sensu lato in two threatened carnivores: The marbled polecat, Vormela peregusna and the European mink, Mustela lutreola (Mammalia: Mustelidae). BMC Vet. Res. 2012, 8, 2–5. [Google Scholar]
- Patiu, A.I.; Matei, I.A.; Mihalca, A.D.; D’Amico, G.; Dumitrache, M.O.; Kalmár, Z.; Sándor, A.D.; Lefkaditis, M.; Gherman, C.M.; Cozma, V. Zoonotic pathogens associated with Hyalomma aegyptium in endangered tortoises: Evidence for host-switching behaviour in ticks? Parasit. Vectors 2012, 5, 5–10. [Google Scholar]
- Dumitrache, M.O.; Paştiu, A.I.; Kalmár, Z.; Mircean, V.; Sándor, A.D.; Gherman, C.M.; Peştean, C.; Mihalca, A.D.; Cozma, V. Northern white-breasted hedgehogs Erinaceus roumanicus as hosts for ticks infected with Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in Romania. Ticks Tick Borne Dis. 2013, 4, 214–217. [Google Scholar]
- Dumitrache, M.O.; Matei, I.A.; Ionicə, A.M.; Kalmár, Z.; D’Amico, G.; Sikó-Barabási, S.; Ionescu, D.T.; Gherman, C.M.; Mihalca, A.D. Molecular detection of Anaplasma phagocytophilum and Borrelia burgdorferi sensu lato genospecies in red foxes (Vulpes vulpes) from Romania. Parasit. Vectors 2015, 8, 1–5. [Google Scholar]
- Mǎrcuţan, I.D.; Kalmár, Z.; Ionicǎ, A.M.; D’Amico, G.; Mihalca, A.D.; Vasile, C.; Sándor, A.D. Spotted fever group rickettsiae in ticks of migratory birds in Romania. Parasit. Vectors 2016, 9, 3–9. [Google Scholar]
- Corduneanu, A.; Hrazdilová, K.; Sándor, A.D.; Matei, I.A.; Ionicǎ, A.M.; Barti, L.; Ciocǎnǎu, M.A.; Mǎntoiu, D.Ş.; Coroiu, I.; Hornok, S.; et al. Babesia vesperuginis, a neglected piroplasmid: New host and geographical records, and phylogenetic relations. Parasit. Vectors 2017, 10, 1–8. [Google Scholar]
- Corduneanu, A.; Sándor, A.D.; Ionicǎ, A.M.; Hornok, S.; Leitner, N.; Bagó, Z.; Stefke, K.; Fuehrer, H.P.; Mihalca, A.D. Bartonella DNA in heart tissues of bats in central and eastern Europe and a review of phylogenetic relations of bat-associated bartonellae. Parasit. Vectors 2018, 11, 1–7. [Google Scholar]
- Matei, I.A.; D’Amico, G.; Ionicǎ, A.M.; Kalmár, Z.; Corduneanu, A.; Sándor, A.D.; Fiţ, N.; Bogdan, L.; Gherman, C.M.; Mihalca, A.D. New records for Anaplasma phagocytophilum infection in small mammal species. Parasit. Vectors 2018, 11, 1–6. [Google Scholar]
- Otranto, D.; Dantas-Torres, F.; Giannelli, A.; Latrofa, M.S.; Cascio, A.; Cazzin, S.; Ravagnan, S.; Montarsi, F.; Zanzani, S.A.; Manfredi, M.T.; et al. Ticks infesting humans in Italy and associated pathogens. Parasit. Vectors 2014, 7, 1–9. [Google Scholar]
- Battisti, E.; Zanet, S.; Boraso, F.; Minniti, D.; Giacometti, M.; Duscher, G.G.; Ferroglio, E. Survey on tick-borne pathogens in ticks removed from humans in Northwestern Italy. Vet. Parasitol. Reg. Stud. Reports 2019, 18, 100352. [Google Scholar]
- Lernout, T.; De Regge, N.; Tersago, K.; Fonville, M.; Suin, V.; Sprong, H. Prevalence of pathogens in ticks collected from humans through citizen science in Belgium. Parasit. Vectors 2019, 12, 1–11. [Google Scholar]
- Rizzoli, A.; Hauffe, H.C.; Carpi, G.; Vourc’h, G.I.; Neteler, M.; Rosà, R. Lyme borreliosis in Europe. Euro Surveill. 2011, 16, 1–8. [Google Scholar]
- Cogǎlniceanu, D.; Rozylowicz, L.; Székely, P.; Samoilǎ, C.; Stǎnescu, F.; Tudor, M.; Székely, D.; Iosif, R. Diversity and distribution of reptiles in Romania. ZooKeys 2013, 341, 49–76. [Google Scholar]
- Van Duijvendijk, G.; Coipan, C.; Wagemakers, A.; Fonville, M.; Ersöz, J.; Oei, A.; Földvári, G.; Hovius, J.; Takken, W.; Sprong, H. Larvae of Ixodes ricinus transmit Borrelia afzelii and B. miyamotoi to vertebrate hosts. Parasit. Vectors 2016, 9, 1–7. [Google Scholar]
- Hauck, D.; Jordan, D.; Springer, A.; Schunack, B.; Pachnicke, S.; Fingerle, V.; Strube, C. Transovarial transmission of Borrelia spp., Rickettsia spp. and Anaplasma phagocytophilum in Ixodes ricinus under field conditions extrapolated from DNA detection in questing larvae. Parasit. Vectors 2020, 13, 1–11. [Google Scholar]
- Wagemakers, A.; Staarink, P.J.; Sprong, H.; Hovius, J.W.R. Borrelia miyamotoi: A widespread tick-borne relapsing fever spirochete. Trends Parasitol. 2015, 31, 260–269. [Google Scholar]
- Jensen, P.M.; Christoffersen, C.S.; Moutailler, S.; Michelet, L.; Klitgaard, K.; Bødker, R. Transmission differentials for multiple pathogens as inferred from their prevalence in larva, nymph and adult of Ixodes ricinus (Acari: Ixodidae). Exp. Appl. Acarol. 2017, 71, 171–182. [Google Scholar]
- Richter, D.; Matuschka, F.R. “Candidatus Neoehrlichia mikurensis,” Anaplasma phagocytophilum, and Lyme Disease spirochetes in questing European vector ticks and in feeding ticks removed from people. J. Clin. Microbiol. 2012, 50, 943–947. [Google Scholar]
- Andersson, M.; Zaghdoudi-Allan, N.; Tamba, P.; Stefanache, M.; Chitimia, L. Co-infection with “Candidatus Neoehrlichia mikurensis” and Borrelia afzelii in an Ixodes ricinus tick that has bitten a human in Romania. Ticks Tick Borne Dis. 2014, 5, 706–708. [Google Scholar]
- Yabsley, M.J.; Shock, B.C. Natural history of Zoonotic Babesia: Role of wildlife reservoirs. Int. J. Parasitol. Parasites Wildl. 2013, 2, 18–31. [Google Scholar]
- Imre, M.; Farkas, R.; Ilie, M.S.; Imre, K.; Dǎrǎbuş, G. Survey of babesiosis in symptomatic dogs from Romania: Occurrence of Babesia gibsoni associated with breed. Ticks Tick Borne Dis. 2013, 4, 500–502. [Google Scholar]
- Zintl, A.; Finnerty, E.J.; Murphy, T.M.; De Waal, T.; Gray, J.S. Babesias of red deer (Cervus elaphus) in Ireland. Vet. Res. 2011, 42, 1–6. [Google Scholar]
- Ionita, M.; Silaghi, C.; Mitrea, I.L.; Edouard, S.; Parola, P.; Pfister, K. Molecular detection of Rickettsia conorii and other zoonotic spotted fever group rickettsiae in ticks, Romania. Ticks Tick Borne Dis. 2016, 7, 150–153. [Google Scholar]
- Paduraru, O.A.; Buffet, J.P.; Cote, M.; Bonnet, S.; Moutailler, S.; Paduraru, V.; Femenia, F.; Eloit, M.; Savuta, G.; Vayssier-Taussat, M. Zoonotic transmission of pathogens by Ixodes ricinus ticks, Romania. Emerg. Infect. Dis. 2012, 18, 2089–2090. [Google Scholar]
- Angelakis, E.; Raoult, D. Pathogenicity and treatment of Bartonella infections. Int. J. Antimicrob. Agents 2014, 44, 16–25. [Google Scholar]
- Regier, Y.; Ballhorn, W.; Kempf, V.A.J. Molecular detection of Bartonella henselae in 11 Ixodes ricinus ticks extracted from a single cat. Parasit. Vectors 2017, 10, 1–5. [Google Scholar]
- Pawełczyk, A.; Bednarska, M.; Kowalska, J.D.; Uszyńska-Kałuża, B.; Radkowski, M.; Welc-Falęciak, R. Seroprevalence of six pathogens transmitted by the Ixodes ricinus ticks in asymptomatic individuals with HIV infection and in blood donors. Sci. Rep. 2019, 9, 1–10. [Google Scholar]
- Corrain, R.; Drigo, M.; Fenati, M.; Menandro, M.L.; Mondin, A.; Pasotto, D.; Martini, M. Study on Ticks and Tick-Borne Zoonoses in Public Parks in Italy. Zoonoses Public Health 2012, 59, 468–476. [Google Scholar]
- Heylen, D.; Tijsse, E.; Fonville, M.; Matthysen, E.; Sprong, H. Transmission dynamics of Borrelia burgdorferi s.l. in a bird tick community. Environ. Microbiol. 2013, 15, 663–673. [Google Scholar]
- Sytykiewicz, H.; Karbowiak, G.; Werszko, J.; Czerniewicz, P.; Sprawka, I.; Mitrus, J. Molecular screening for Bartonella henselae and Borrelia burgdorferi sensu lato co-existence within Ixodes ricinus populations in central and eastern parts of Poland. Ann. Agric. Environ. Med. 2012, 19, 451–456. [Google Scholar]
- Hornok, S.; Szoke, K.; Meli, M.L.; Sándor, A.D.; Görföl, T.; Estók, P.; Wang, Y.; Tu, V.T.; Kováts, D.; Boldogh, S.A.; et al. Molecular detection of vector-borne bacteria in bat ticks (Acari: Ixodidae, Argasidae) from eight countries of the Old and New Worlds. Parasit. Vectors 2019, 12, 1–7. [Google Scholar]
- Hornok, S.; Szöke, K.; Kováts, D.; Estók, P.; Görföl, T.; Boldogh, S.A.; Takács, N.; Kontschán, J.; Földvári, G.; Barti, L.; et al. DNA of piroplasms of ruminants and dogs in ixodid bat ticks. PLoS ONE 2016, 11, 1–14. [Google Scholar]
- Sprong, H.; Tijsse-Klasen, E.; Langelaar, M.; De Bruin, A.; Fonville, M.; Gassner, F.; Takken, W.; Van Wieren, S.; Nijhof, A.; Jongejan, F.; et al. Prevalence of Coxiella burnetii in ticks after a large outbreak of Q Fever. Zoonoses Public Health 2012, 59, 69–75. [Google Scholar]
- Carvalho, C.L.; Lopes de Carvalho, I.; Zé-Zé, L.; Núncio, M.S.; Duarte, E.L. Tularaemia: A challenging zoonosis. Comp. Immunol. Microbiol. Infect. Dis. 2014, 37, 85–96. [Google Scholar]
- Gehringer, H.; Schacht, E.; Maylaender, N.; Zeman, E.; Kaysser, P.; Oehme, R.; Pluta, S.; Splettstoesser, W.D. Presence of an emerging subclone of Francisella tularensis holarctica in Ixodes ricinus ticks from south-western Germany. Ticks Tick Borne Dis. 2013, 4, 93–100. [Google Scholar]
- Michelet, L.; Delannoy, S.; Devillers, E.; Umhang, G.; Aspan, A.; Juremalm, M.; Chirico, J.; van der Wal, F.J.; Sprong, H.; Boye Pihl, T.P.; et al. High-throughput screening of tick-borne pathogens in Europe. Front. Cell. Infect. Microbiol. 2014, 4, 1–13. [Google Scholar]
- Moutailler, S.; Valiente Moro, C.; Vaumourin, E.; Michelet, L.; Tran, F.H.; Devillers, E.; Cosson, J.F.; Gasqui, P.; Van, V.T.; Mavingui, P.; et al. Co-infection of Ticks: The Rule Rather Than the Exception. PLoS Negl. Trop. Dis. 2016, 10, 1–17. [Google Scholar]
- Klitgaard, K.; Kjær, L.J.; Isbrand, A.; Hansen, M.F.; Bødker, R. Multiple infections in questing nymphs and adult female Ixodes ricinus ticks collected in a recreational forest in Denmark. Ticks Tick Borne Dis. 2019, 10, 1060–1065. [Google Scholar]
- Krause, P.J.; McKay, K.; Thompson, C.A.; Sikand, V.K.; Lentz, R.; Lepore, T.; Closter, L.; Christianson, D.; Telford, S.R.; Persing, D.; et al. Disease-Specific Diagnosis of Coinfecting Tickborne Zoonoses: Babesiosis, Human Granulocytic Ehrlichiosis, and Lyme Disease. Clin. Infect. Dis. 2002, 34, 1184–1191. [Google Scholar]
- Estrada-Peña, A.; Ayllón, N.; de la Fuente, J. Impact of climate trends on tick-borne pathogen transmission. Front. Physiol. 2012, 3, 1–12. [Google Scholar]
- Coipan, E.C.; Jahfari, S.; Fonville, M.; Maassen, C.B.; van der Giessen, J.; Takken, W.; Takumi, K.; Sprong, H. Spatiotemporal dynamics of emerging pathogens in questing Ixodes ricinus. Front. Cell. Infect. Microbiol. 2013, 4, 1–11. [Google Scholar]
- Hovius, J.W.R.; De Wever, B.; Sohne, M.; Brouwer, M.C.; Coumou, J.; Wagemakers, A.; Oei, A.; Knol, H.; Narasimhan, S.; Hodiamont, C.J.; et al. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet 2013, 382, 658. [Google Scholar]
- Coipan, C.E.; Van Duijvendijk, G.L.A.; Hofmeester, T.R.; Takumi, K.; Sprong, H. The genetic diversity of Borrelia afzelii is not maintained by the diversity of the rodent hosts. Parasit. Vectors 2018, 11, 1–7. [Google Scholar]
- Szekeres, S.; Coipan, E.C.; Rigó, K.; Majoros, G.; Jahfari, S.; Sprong, H.; Földvári, G. Eco-epidemiology of Borrelia miyamotoi and Lyme borreliosis spirochetes in a popular hunting and recreational forest area in Hungary. Parasit. Vectors 2015, 8, 1–8. [Google Scholar]
- Jahfari, S.; Fonville, M.; Hengeveld, P.; Reusken, C.; Scholte, E.J.; Takken, W.; Heyman, P.; Medlock, J.M.; Heylen, D.; Kleve, J.; et al. Prevalence of Neoehrlichia mikurensis in ticks and rodents from North-west Europe. Parasit. Vectors 2012, 5, 1–10. [Google Scholar]
- Hodžić, A.; Alić, A.; Fuehrer, H.P.; Harl, J.; Wille-Piazzai, W.; Duscher, G.G. A molecular survey of vector-borne pathogens in red foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasit. Vectors 2015, 8, 1–7. [Google Scholar]
- Kamani, J.; Baneth, G.; Mitchell, M.; Mumcuoglu, K.Y.; Gutiérrez, R.; Harrus, S. Bartonella species in bats (Chiroptera) and bat flies (Nycteribiidae) from Nigeria, West Africa. Vector Borne Zoonotic Dis. 2014, 14, 625–632. [Google Scholar]
- Forsman, M.; Sandstrom, G.; Sjostedt, A. Analysis of 16S ribosomal DNA sequences of Francisella strains and utilization for determination of the phylogeny of the genus and for identification of strains by PCR. Int. J. Syst. Bacteriol. 1994, 44, 38–46. [Google Scholar]
- Alsaleh, A.; Pellerin, J.L.; Rodolakis, A.; Larrat, M.; Cochonneau, D.; Bruyas, J.F.; Fieni, F. Presence of an emerging subclone of Francisella tularensis holarctica in Ixodes ricinus ticks from south-western Germany. Comp. Immunol. Microbiol. Infect. Dis. 2011, 34, 355–360. [Google Scholar]
Pathogen | Prevalence % (+/n; 95% CI) | |||
---|---|---|---|---|
Year | Larvae | Nymphs | Female | Total |
B. afzelii | ||||
2013 | - | 5.80 (8/138; 2.54–11.10) | 0 (0/16) | 5.19 (8/154; 2.27–9.98) |
2014 | 6.25 (1/16; 0.16–30.2) | 2.54 (3/118; 0.53–7.25) | 7.14 (3/42; 1.50–19.48) | 3.98 (7/176; 1.61–8.02) |
2015 | 0 (0/5) | 6.83 (11/161; 3.46–11.90) | 11.54 (3/26; 2.45–30.15) | 7.29 (14/192; 4.04–11.93) |
Average | 4.76 (1/21; 0.12–23.82) | 5.28 (22/417; 3.51–7.86) | 7.14 (6/84; 2.67–14.90) | 5.56 (29/522; 3.90–7.86) |
B. garinii | ||||
2013 | - | 3.62 (5/138; 1.19–8.25) | 6.25 (1/16; 0.16–30.23) | 3.9 (6/154; 1.44–8.29) |
2014 | 0 (0/16) | 5.08 (6/118; 1.89–10.74) | 4.76 (2/42; 0.58–16.16) | 4.55 (8/176; 1.98–8.76) |
2015 | 0 (0/5) | 0.62 (1/161; 0.02–3.41) | 0 (0/26) | 0.52 (1/192; 0.01–2.87) |
Average | 0 (0/21) | 2.88 (12/417; 1.65–4.96) | 3.57 (3/84; 0.74–10.08) | 2.87 (15/522; 1.75–4.69) |
B. lusitaniae | ||||
2013 | - | 0 (0/138) | 0 (0/16) | 0 (0/154) |
2014 | 0 (0/16) | 5.93 (7/118; 2.42–11.84) | 7.14 (3/42; 1.50–19.48) | 5.68 (10/176; 2.76–10.20) |
2015 | 0 (0/5) | 1.86 (3/161; 0.39–5.35) | 0 (0/26) | 1.56 (3/192; 0.32–4.50) |
Average | 0 (0/21) | 2.40 (10/417; 1.31–4.36) | 3.57 (3/84; 0.74–10.08) | 2.49 (13/522; 1.46–4.21) |
B. valaisiana | ||||
2013 | - | 0 (0/138) | 0 (0/16) | 0 (0/154) |
2014 | 0 (0/16) | 0 (0/161) | 0 (0/42) | 0 (0/16) |
2015 | 0 (0/5) | 4.35 (7/161; 1.77–8.75) | 7.69 (2/26; 0.95–25.13) | 4.69 (9/192; 2.17–8.71) |
Average | 0 (0/21) | 1.68 (7/417; 0.82–3.42) | 2.38 (2/84; 0.29–8.34) | 1.72 (9/522; 0.91–3.24) |
B. miyamotoi | ||||
2013 | - | 0 (0/138) | 0 (0/16) | 0 (0/154) |
2014 | 6.25 (1/16; 0.16–30.23) | 2.54 (3/118; 0.53–7.25) | 4.76 (2/42; 0.58–16.16) | 3.41 (6/176; 1.26–7.27) |
2015 | 0 (0/5) | 1.24 (2/161; 0.15–4.42) | 0 (0/26) | 1.04 (2/192; 0.13–3.71) |
Average | 4.76 (1/21; 0.12–23.82) | 1.20 (5/417; 0.51–2.78) | 2.38 (2/84; 0.29–8.34) | 1.53 (8/522; 0.78–2.99) |
N. mikurensis | ||||
2013 | - | 0.72 (1/138; 0.02–3.97) | 0 (0/16) | 0.65 (1/154; 0.02–3.56) |
2014 | 0 (0/16) | 9.32 (11/118; 4.75–16.07) | 4.76 (2/42; 0.58–16.16) | 7.39 (13/176; 3.99–12.30) |
2015 | 0 (0/5) | 9.94 (16/161; 5.79–15.64) | 3.85 (1/26; 0.10–19.64) | 8.85 (17/192; 5.24–13.80) |
Average | 0 (0/21) | 6.71 (28/417; 4.69–9.53) | 3.57 (3/84; 0.74–10.08) | 5.94 (31/522; 4.21–8.31) |
B. microti | ||||
2013 | - | 0.72 (1/138; 0.02–3.97) | 0 (0/16) | 0.65 (1/154; 0.02–3.56) |
2014 | 0 (0/16) | 2.54 (3/118; 0.53–7.25) | 0 (0/42) | 1.70 (3/176; 0.35–4.90) |
2015 | 0 (0/5) | 3.73 (6/161; 1.38–7.93) | 3.85 (1/26; 0.10–19.64) | 3.65 (7/192; 1.48–7.37) |
Average | 0 (0/21) | 2.40 (10/417; 1.31–4.36) | 1.19 (1/84; 0.03–6.46) | 2.11 (11/522; 1.18–3.73) |
B. venatorum | ||||
2013 | - | 0.72 (1/138; 0.02–3.97) | 0 (0/16) | 0.65 (1/154; 0.02–3.56) |
2014 | 0 (0/16) | 0.85 (1/118; 0.02–4.63) | 0 (0/42) | 0.57 (1/176; 0.01–3.12) |
2015 | 0 (0/5) | 1.24 (2/161; 0.15–4.42) | 0 (0/26) | 1.04 (2/192; 0.13–3.71) |
Average | 0 (0/21) | 0.96 (4/417; 0.37–2.44) | 0 (0/84) | 0.77 (4/522; 0.30–195) |
Total 2013 | - | 10.87 (15/138; 6.21–17.29) | 6.25 (1/16; 0.16–30.23) | 10.39 (16/154; 6.06–16.31) |
Total 2014 | 12.5 (2/16; 1.55–38.35) | 25.42 (30/118; 17.86–34.26) | 28.57 (12/42; 15.72–44.58) | 25.00 (44/176; 18.79–32.07) |
Total 2015 | 0 (0/5) | 26.71 (43/161; 20.05–32.24) | 26.92 (7/26; 11.57–47.79) | 26.04 (50/192; 19.99–32.85) |
TOTAL | 9.52 (2/21; 1.17–30.38) | 20.86 (88/417; 17.24–82.76) | 23.82 (20/84; 15.19–34.35) | 21.07 (110/522; 17.79–24.78) |
Pathogens | Prevalence % (+/n; 95% CI) | |||
---|---|---|---|---|
2013 | 2014 | 2015 | Total | |
B. afzelii + B. microti | 6.25 (1/16; 0.16–30.23) | - | - | 0.91 (1/110; 0.02–4.96) |
B. afzelii + N. mikurensis | - | - | 2 (1/50; 0.05–10.65) | 0.91 (1/110; 0.02–4.96) |
B. garinii + N. mikurensis | - | 4.55 (2/44; 0.56–15.47 | - | 1.82 (2/110; 0.22–6.41) |
B. lusitaniae + N. mikurensis | - | 2.27 (1/44; 0.06–12.02) | - | 0.91 (1/110; 0.02–4.96) |
B. valaisiana + N. mikurensis | - | - | 2 (1/50; 0.05–10.65) | 0.91 (1/110; 0.02–4.96) |
B. valaisiana + N. mikurensis + B. venatorum | - | - | 2 (1/50; 0.05–10.65) | 0.91 (1/110; 0.02–4.96) |
N. mikurensis + B. microti | - | - | 2 (1/50; 0.05–10.65) | 0.91 (1/110; 0.02–4.96) |
N. mikurensis + B. venatorum | - | 2.27 (1/44; 0.06–12.02) | - | 0.91 (1/110; 0.02–4.96) |
TOTAL | 6.25 (1/16; 0.16–30.23) | 9.09 (4/44; 2.53–21.67) | 8 (4/50; 2.22–19.23) | 8.18 (9/110; 3.81–14.96) |
Pathogen | Primer name | Primer sequence (5′…′3) | Gene | PCR | References |
---|---|---|---|---|---|
Borrelia spp. | B_OspA_F | AATATTTATTGGGAATAGGTCTAA | ospA | mqPCR | [44] |
B_OspA_R | CTTTGTCTTTTTCTTTRCTTACA | ||||
B_OspA_P | FAM-AAGCAAAATGTTAGCAGCCTTGA-BHQ1 | ||||
BMiya_F | AGAAGGTGCTCAAGCAG | flaB | [57] | ||
BMiya_R | TCGATCTTTGAAAGTGACATA T | ||||
BMiya_P | Cy5-AGCACAACAGGAGGGAGTTCAAGC-BHQ2 | ||||
5SCB | GAGTTCGCGGGAGAGTAGGTTATTGCC | IGS | convPCR | [58] | |
23SN | TCAGGGTACTTAGATGGTTCACTTCC | ||||
OspA F | GCAAAATGTTAGCAGCCTTGAT | ospA | |||
OspA R | CTGTGTATTCAAGTCTGGTTCC | ||||
glpQ_BM_F | ATGGGTTCAAACA AAAAGTCACC | glpQ | [59] | ||
glpQ_BM_R | CCAGGGTCCAATTCCATCAGAATATTGTGCAAC | ||||
N. mikurensis | NMikGroEL-F2a | CCTTGAAAATATAGCAAGATCAGGTAG | groEL | qPCR | [60] |
NMikGroEL-R2b | CCACCACGTAACTTATTTAGTACTAAAG | ||||
NMikGroEL-P2a | FAM-CCTCTACTAATTATTGCTGAAGATGTAGAAGGTGAAGC-BHQ1 | ||||
NMik fo-groEL | GAAGYATAGTYTAGTATTTTTGTC | convPCR | |||
NMik re-groEL | TTAACTTCTACTTCACTTGAACC | ||||
Babesia spp. | BTH-1F | CCTGAGAAACGGCTACCACATCT | 18S rRNA | nPCR | [37,61] |
BTH-1R | TTGCGACCATACTCCCCCCA | ||||
GF2 | GTCTTGTAATTGGAATGATGG | ||||
GR2 | CCAAAGACTTTGATTTCTCTC | ||||
Bartonella spp. | 443F | GCTATGTCTGCATTCTATCA | glta | nPCR | [62] |
1210R | GATCYTCAATCATTTCTTTCCA | ||||
CSH1F | GCGAATGAAGCGTGCCTAAA | ||||
BhCS.1137 | AATGCAAAAAGAACAGTAAACA | ||||
F. tularensis | TUL4-435 | GCTGTATCATCATTTAATAAACTGCTG | 17 kDa lipoprotein | convPCR | [63] |
TUL4-863 | TTGGGAAGCTTGTATCATGGCACT | ||||
Coxiella spp. | Trans B | CAAGAATGATCGTAACGATGCGC | IS1111 | [64] | |
Trans M | CTCGTAATCACCAATCGCTTCG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kalmár, Z.; Dumitrache, M.O.; D’Amico, G.; Matei, I.A.; Ionică, A.M.; Gherman, C.M.; Lupșe, M.; Mihalca, A.D. Multiple Tick-Borne Pathogens in Ixodes ricinus Ticks Collected from Humans in Romania. Pathogens 2020, 9, 390. https://doi.org/10.3390/pathogens9050390
Kalmár Z, Dumitrache MO, D’Amico G, Matei IA, Ionică AM, Gherman CM, Lupșe M, Mihalca AD. Multiple Tick-Borne Pathogens in Ixodes ricinus Ticks Collected from Humans in Romania. Pathogens. 2020; 9(5):390. https://doi.org/10.3390/pathogens9050390
Chicago/Turabian StyleKalmár, Zsuzsa, Mirabela Oana Dumitrache, Gianluca D’Amico, Ioana Adriana Matei, Angela Monica Ionică, Călin Mircea Gherman, Mihaela Lupșe, and Andrei Daniel Mihalca. 2020. "Multiple Tick-Borne Pathogens in Ixodes ricinus Ticks Collected from Humans in Romania" Pathogens 9, no. 5: 390. https://doi.org/10.3390/pathogens9050390
APA StyleKalmár, Z., Dumitrache, M. O., D’Amico, G., Matei, I. A., Ionică, A. M., Gherman, C. M., Lupșe, M., & Mihalca, A. D. (2020). Multiple Tick-Borne Pathogens in Ixodes ricinus Ticks Collected from Humans in Romania. Pathogens, 9(5), 390. https://doi.org/10.3390/pathogens9050390