Variability of ACOX1 Gene Polymorphisms across Different Horse Breeds with Regard to Selection Pressure
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Single-Nucleotide Polymorphism (SNP) Identification and Genotyping
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Warmuth, V.; Manica, A.; Eriksson, A.; Barker, G.; Bower, M. Autosomal genetic diversity in non-breed horses from eastern Eurasia provides insights into historical population movements. Anim. Genet. 2013, 44, 53–61. [Google Scholar] [CrossRef] [PubMed]
- Gu, J.; Orr, N.; Park, S.D.; Katz, L.M.; Sulimova, G.; MacHugh, D.E.; Hill, E.W. A genome scan for positive selection in thoroughbred horses. PLoS ONE 2009, 4, e5767. [Google Scholar] [CrossRef] [PubMed]
- Schubert, M.; Jónsson, H.; Chang, D.; der Sarkissian, C.; Ermini, L.; Ginolhac, A.; Albrechtsen, A.; Dupanloup, I.; Foucal, A.; Petersen, B.; et al. Prehistoric genomes reveal the genetic foundation and cost of horse domestication. Proc. Natl. Acad. Sci. USA 2014, 111, E5661–E5669. [Google Scholar] [CrossRef] [PubMed]
- Al Abri, M.A.; Holl, H.M.; Kalla, S.E.; Sutter, N.B.; Brooks, S.A. Whole Genome Detection of Sequence and Structural Polymorphism in Six Diverse Horses. PLoS ONE 2020, 15, e0230899. [Google Scholar] [CrossRef] [PubMed]
- Ropka-Molik, K.; Stefaniuk-Szmukier, M.; Zukowski, K.; Piórkowska, K.; Bugno-Poniewierska, M. Exercise-induced modification of the skeletal muscle transcriptome in Arabian horses. Physiol. Genom. 2017, 49, 318–326. [Google Scholar] [CrossRef] [PubMed]
- Morais, S.; Knoll-Gellida, A.; Andre, M.; Barthe, C.; Babin, P.J. Conserved expression of alternative splicing variants of peroxisomal acyl-CoA oxidase 1 in vertebrates and developmental and nutritional regulation in fish. Physiol. Genom. 2007, 28, 239–252. [Google Scholar] [CrossRef] [PubMed]
- Wallner, B.; Palmieri, N.; Vogl, C.; Rigler, D.; Bozlak, E.; Druml, T.; Jagannathan, V.; Leeb, T.; Fries, R.; Tetens, J.; et al. Y Chromosome Uncovers the Recent Oriental Origin of Modern Stallions. Curr. Biol. CB 2017, 27, 2029–2035.e5. [Google Scholar] [CrossRef]
- Sandoval-Castellanos, E.; Wutke, S.; Gonzalez-Salazar, C.; Ludwig, A. Coat colour adaptation of post-glacial horses to increasing forest vegetation. Nat. Ecol. Evol. 2017, 1, 1816–1819. [Google Scholar] [CrossRef]
- Georgescu, S.E.; Manea, M.A.; Dudu, A.; Costache, M. Phylogenetic relationships of the Hucul horse from Romania inferred from mitochondrial D-loop variation. Genet. Mol. Res. 2011, 10, 4104–4113. [Google Scholar] [CrossRef]
- López-Rivero, J.L.; Aguera, E.; Monterde, J.G.; Rodriguez-Barbudo, M.V.; Miro, F. Comparative study of muscle fiber type compositions in the middle gluteal muscle of and Andalusian, Thoroughbred and Arabian horses. J. Equine Vet. Sci. 1989, 9, 337–340. [Google Scholar] [CrossRef]
- Musiał, A.D.; Ropka-Molik, K.; Piórkowska, K.; Jaworska, J.; Stefaniuk-Szmukier, M. ACTN3 genotype distribution across horses representing different utility types and breeds. Mol. Biol. Rep. 2019, 46, 5795–5803. [Google Scholar] [CrossRef] [PubMed]
- Polak, G. Genetic Variability of Cold-Blooded Horses Participating in Genetic Resources Conservation Programs, Using Pedigree Analysis. Ann. Anim. Sci. 2019, 19, 49–60. [Google Scholar] [CrossRef]
- FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 24 June 2020).
- Dodt, M.; Roehr, J.T.; Ahmed, R.; Dieterich, C. FLEXBAR—Flexible Barcode and Adapter Processing for Next-Generation Sequencing Platforms. Biology 2012, 1, 895–905. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef]
- Picard Tools Broad Institute. GitHub Repository. Available online: http://broadinstitute.github.io/picard/ (accessed on 24 June 2020).
- Garrison, E.; Marth, G. Haplotype-based variant detection from short-read sequencing. arXiv 2012, arXiv:1207.3907. [Google Scholar]
- Preacher, K.J. Calculation for the Chi-Square Test: An Interactive Calculation Tool for Chi-Square Tests of Goodness of Fit and Independence [Computer Software]. 2001. Available online: http://quantpsy.org (accessed on 24 June 2020).
- Varanasi, U.; Chu, R.; Chu, S.; Espinosa, R.; LeBeau, M.M.; Reddy, J.K. Isolation of the human peroxisomal acyl-CoA oxidase gene: Organization, promoter analysis, and chromosomal localization. Proc. Natl. Acad. Sci. USA 1994, 91, 3107–3111. [Google Scholar] [CrossRef]
- Poirier, Y.; Antonenkov, V.D.; Glumoff, T.; Hiltunen, J.K. Peroxisomal β-oxidation—A metabolic pathway with multiple functions. Biochim. Biophys. Acta (BBA). Mol. Cell Res. 2006, 1763, 1413–1426. [Google Scholar] [CrossRef]
- El Hajj, H.I.; Vluggens, A.; Andreoletti, P.; Ragot, K.; Mandard, S.; Kersten, S.; Waterham, H.R.; Lizard, G.; Wanders, R.J.A.; Reddy, J.K.; et al. The Inflammatory Response in Acyl-CoA Oxidase 1 Deficiency (Pseudoneonatal Adrenoleukodystrophy). Endocrinology 2012, 153, 2568–2575. [Google Scholar] [CrossRef]
- Abe, Y.; Honsho, M.; Nakanishi, H.; Taguchi, R.; Fujiki, Y. Very-long-chain Polyunsaturated Fatty Acids Accumulate in Phosphatidylcholine of Fibroblasts from Patients with Zellweger Syndrome and acyl-CoA oxidase1 Deficiency. Biochim. Biophys. Acta 2014, 1841, 610–619. [Google Scholar] [CrossRef]
- Boemer, F.; Detilleux, J.; Cello, C.; Amory, H.; Marcillaud-Pitel, C.; Richard, E.; van Galen, G.; van Loon, G.; Lefère, L.; Votion, D.M. Acylcarnitines profile best predicts survival in horses with atypical myopathy. PLoS ONE 2017, 12, e0182761. [Google Scholar] [CrossRef]
- Valentine, G. Living with Difference: Reflections on Geographies of Encounter. Prog. Hum. Geogr. 2008, 32, 323–337. [Google Scholar] [CrossRef]
- Reddy, J.K.; Hashimoto, T. Peroxisomal β-oxidation and peroxisome proliferator–activated receptor α: An Adaptive Metabolic System. Annu. Rev. Nutr. 2001, 21, 193–230. [Google Scholar] [CrossRef] [PubMed]
- Suárez, J.; Rivera, P.; Arrabal, S.; Crespillo, A.; Serrano, A.; Baixeras, E.; Pavón, F.J.; Cifuentes, M.; Nogueiras, R.; Ballesteros, J.; et al. Oleoylethanolamide enhances β-adrenergic-mediated thermogenesis and white-to-brown adipocyte phenotype in epididymal white adipose tissue in rat. Dis. Models Mech. 2014, 7, 129–141. [Google Scholar] [CrossRef] [PubMed]
- Bowen, K.; Kris-Etherton, P.M.; Shearer, G.C.; Jones, P.J.H. Oleic acid-derived oleoylethanolamide: A nutritional science perspective. Prog. Lipid Res. 2017, 67, 1–15. [Google Scholar] [CrossRef]
- Fu, J.; Gaetani, S.; Oveisi, F.; Lo Verme, J.; Serrano, A.; De Rodríguez Fonseca, F.; Rosengarth, A.; Luecke, H.; Di Giacomo, B.; Tarzia, G. Oleylethanolamide regulates feeding and body weight through activation of the nuclear receptor PPAR-alpha. Nature 2003, 425, 90–93. [Google Scholar] [CrossRef]
- Parker, K.L.; Gillingham, M.P.; Hanley, T.A.; Robbins, C.T. Seasonal patterns in body mass, body composition, and water transfer rates of free-ranging and captive black-tailed deer in Alaska. Can. J. Zool. 1993, 71, 1397–1404. [Google Scholar] [CrossRef]
- Kuntz, R.; Kubalek, C.; Ruf, T.; Tataruch, F.; Arnold, W. Seasonal adjustment of energy budget in a large wild mammal, the Przewalski horse (Equus ferus przewalskii) I. Energy intake. J. Exp. Biol. 2006, 209, 4557–4565. [Google Scholar] [CrossRef]
- Brinkmann, L.; Gerken, M.; Hambly, C.; Speakman, J.R.; Riek, A. Saving energy during hard times: Energetic adaptations of Shetland pony mares. J. Exp. Biol. 2014, 217, 4320–4327. [Google Scholar] [CrossRef]
- Pedersen, L.; Henriksen, A. Acyl-CoA Oxidase 1 from Arabidopsis thaliana. Structure of a Key Enzyme in Plant Lipid Metabolism. J. Mol. Biol. 2005, 345, 487–500. [Google Scholar] [CrossRef]
- Eivers, S.S.; McGivney, B.A.; Fonseca, R.G.; MacHugh, D.E.; Menson, K.; Park, S.D.; Rivero, J.L.; Taylor, C.T.; Katz, L.M.; Hill, E.W. Alterations in oxidative gene expression in equine skeletal muscle following exercise and training. Physiol. Genom. 2010, 40, 83–93. [Google Scholar] [CrossRef]
- Komosa, M.; Purzyc-Orwaszer, H. Konik and Hucul horses: A comparative study of exterior measurements. J. Anim. Sci. 2009, 87, 2245–2254. [Google Scholar] [CrossRef] [PubMed]
- Roman, K.; Wyrostek, A.; Czyż, K.; Janczak, M.; Patkowska-Sokoła, B. Characterization of the hair coat of the Polish Konik and Hucul pony focusing on the physical features and histological structure of different hair types. Sci. Ann. Pol. Soc. Anim. Prod. 2016, 12, 95–104. [Google Scholar] [CrossRef]
- Rakhshandehroo, M.; Knoch, B.; Müller, M.; Kersten, S. Peroxisome Proliferator-Activated Receptor Alpha Target Genes. PPAR Res. 2010, 2010. [Google Scholar] [CrossRef] [PubMed]
- Ahmadian, M.; Suh, J.M.; Hah, N.; Liddle, C.; Atkins, A.R.; Downes, M.; Evans, R.M. PPARγ signaling and metabolism: The good, the bad and the future. Nat. Med. 2013, 19, 557–566. [Google Scholar] [CrossRef] [PubMed]
- Barish, G.D.; Narkar, V.A.; Evans, R.M. PPAR Delta: A Dagger in the Heart of the Metabolic Syndrome. J. Clin. Investig. 2006, 116, 590–597. [Google Scholar] [CrossRef]
- Mach, N.; Plancade, S.; Pacholewska, A.; Lecardonnel, J.; Rivière, J.; Moroldo, M.; Vaiman, A.; Morgenthaler, C.; Beinat, M.; Nevot, A.; et al. Integrated mRNA and miRNA expression profiling in blood reveals candidate biomarkers associated with endurance exercise in the horse. Sci. Rep. 2016, 6, 22932. [Google Scholar] [CrossRef]
- Park, K.D.; Park, J.; Ko, J.; Kim, B.C.; Kim, H.S.; Ahn, K.; Do, K.T.; Choi, H.; Kim, H.M.; Song, S.; et al. Whole transcriptome analyses of six thoroughbred horses before and after exercise using RNA-Seq. BMC Genom. 2012, 13, 473. [Google Scholar] [CrossRef]
- Fontanel, M.; Todd, E.; Drabbe, A.; Ropka-Molik, K.; Stefaniuk-Szmukier, M.; Myćka, G.; Velie, B.D. Variation in the SLC16A1 and the ACOX1 Genes Is Associated with Gallop Racing Performance in Arabian Horses. J. Equine Vet. Sci. 2020, 93, 103202. [Google Scholar] [CrossRef]

| Gene | ACOX1 |
|---|---|
| Accession number | ENSECAG00000022905 |
| SNP | rs782885985 |
| NC_009154.3:g.6105340T>G | |
| ENSECAT00000024965.2:c.238T>G | |
| ENSECAP00000020757.2:p.Ser80Ala | |
| Primers | F: CAGCTGTGATTACGGGAGGT |
| R: TGAAAACGTGCAGTTTGAGC | |
| PCR-RFLP (PCR restriction fragment length polymorphism) conditions | DdeI endonuclease |
| Alleles: T–197, 145 bp; G–342 bp |
| Arabian | Polish Konik | Hucul | Polish Draft | Thoroughbred | |
|---|---|---|---|---|---|
| Arabian horses | ns | 0.0001 | <0.0001 | <0.0001 | |
| Polish Konik | ns | 0.00005 | 0.0002 | <0.0001 | |
| Hucul | 0.0001 | 0.00005 | <0.0001 | <0.0001 | |
| Polish draft horses | <0.0001 | 0.0002 | <0.0001 | 0.00002 | |
| Thoroughbred | <0.0001 | <0.0001 | <0.0001 | 0.00002 |
| Arabian | Polish Konik | Hucul | Polish Draft | Thoroughbred | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Genotype | GG | TG | TT | GG | TG | TT | GG | TG | TT | GG | TG | TT | GG | TG | TT |
| Number of horses | 212 | 73 | 5 | 65 | 27 | 2 | 65 | 2 | 0 | 28 | 33 | 9 | 14 | 41 | 39 |
| Percentage of genotypes (%) | 73.1 | 25.2 | 1.7 | 69.2 | 28.7 | 2.1 | 97.0 | 3.0 | 0.0 | 40.0 | 47.1 | 12.9 | 14.9 | 43.6 | 42.5 |
| HWE significance | 0.65 | 0.67 | 0.90 | 0.08 | 0.55 | ||||||||||
| Minor allele frequency | 0.14 | 0.16 | 0.01 | 0.30 | 0.63 | ||||||||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Myćka, G.; Musiał, A.D.; Stefaniuk-Szmukier, M.; Piórkowska, K.; Ropka-Molik, K. Variability of ACOX1 Gene Polymorphisms across Different Horse Breeds with Regard to Selection Pressure. Animals 2020, 10, 2225. https://doi.org/10.3390/ani10122225
Myćka G, Musiał AD, Stefaniuk-Szmukier M, Piórkowska K, Ropka-Molik K. Variability of ACOX1 Gene Polymorphisms across Different Horse Breeds with Regard to Selection Pressure. Animals. 2020; 10(12):2225. https://doi.org/10.3390/ani10122225
Chicago/Turabian StyleMyćka, Grzegorz, Adrianna D. Musiał, Monika Stefaniuk-Szmukier, Katarzyna Piórkowska, and Katarzyna Ropka-Molik. 2020. "Variability of ACOX1 Gene Polymorphisms across Different Horse Breeds with Regard to Selection Pressure" Animals 10, no. 12: 2225. https://doi.org/10.3390/ani10122225
APA StyleMyćka, G., Musiał, A. D., Stefaniuk-Szmukier, M., Piórkowska, K., & Ropka-Molik, K. (2020). Variability of ACOX1 Gene Polymorphisms across Different Horse Breeds with Regard to Selection Pressure. Animals, 10(12), 2225. https://doi.org/10.3390/ani10122225

