KIT Somatic Mutations and Immunohistochemical Expression in Canine Oral Melanoma
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. First Case Selection
2.2. Nucleic Acid Extraction
2.3. aCGH Analysis and Second Case Selection
2.4. Exon Amplification and Sequencing
2.5. Immunohistochemistry and Immunohistochemical Assessment
2.6. Statistical Analysis
3. Results
3.1. aCGH Analysis
3.2. Epidemiological Data
3.3. Identification of Somatic Mutations
3.4. Immunohistochemistry
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Yarden, Y.; Kuang, W.J.; Yang-Feng, T.; Coussens, L.; Munemitsu, S.; Dull, T.J.; Chen, E.; Schlessinger, J.; Francke, U.; Ullrich, A. Human proto-oncogene c-kit: A new cell surface receptor tyrosine kinase for an unidentified ligand. Embo J. 1987, 6, 3341–3351. [Google Scholar] [CrossRef]
- Nishikawa, S.; Kusakabe, M.; Yoshinaga, K.; Ogawa, M.; Hayashi, S.; Kunisada, T.; Era, T.; Sakakura, T.; Nishikawa, S. In utero manipulation of coat color formation by a monoclonal anti-c-kit antibody: Two distinct waves of c-kit-dependency during melanocyte development. Embo J. 1991, 10, 2111–2118. [Google Scholar] [CrossRef]
- Babaei, M.A.; Kamalidehghan, B.; Mohammad, S.; Huri, H.; Ahmadipour, F. Receptor tyrosine kinase (c-Kit) inhibitors: A potential therapeutic target in cancer cells. Drug Des. Devel. 2016, 10, 2443–2459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garrido, M.; Bastian, B.C. Kit as a therapeutic target in melanoma. J. Invest. Derm. 2010, 130, 20–27. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alexeev, V.; Yoon, K. Distinctive role of the cKit receptor tyrosine kinase signaling in mammalian melanocytes. J. Investig. Dermatol. 2006, 126, 1102–1110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Curtin, J.A.; Busam, K.; Pinkel, D.; Bastian, B.C. Somatic activation of KIT in distinct subtypes of melanoma. J. Clin. Oncol. 2006, 24, 4340–4346. [Google Scholar] [CrossRef] [PubMed]
- Dumaz, N.; André, J.; Sadoux, A.; Laugier, F.; Podgorniak, M.P.; Mourah, S.; Lebbé, C. Driver KIT mutations in melanoma cluster in four hotspots. Melanoma Res. 2015, 25, 88–90. [Google Scholar] [CrossRef]
- Beadling, C.; Jacobson-Dunlop, E.; Hodi, F.S.; Le, C.; Warrick, A.; Patterson, J.; Town, A.; Harlow, A.; Cruz, F.; Azar, S.; et al. KIT gene mutations and copy number in melanoma subtypes. Clin. Cancer Res. 2008, 14, 6821–6828. [Google Scholar] [CrossRef] [Green Version]
- Torres-cabala, C.A.; Wang, W.; Trent, J.; Yang, D.; Chen, S.; Kim, K.B.; Woodman, S.; Davies, M.; Plaza, J.A.; Nash, J.W.; et al. Correlation between KIT expression and KIT mutation in melanoma: A study of 173 cases with emphasis on the acral- lentiginous/mucosal type. Mod. Pathol. 2009, 22, 1446–1456. [Google Scholar] [CrossRef] [Green Version]
- Wong, K.; van der Weyden, L.; Schott, C.R.; Foote, A.; Constantino-Casas, F.; Smith, S.; Dobson, J.M.; Murchison, E.P.; Wu, H.; Yeh, I.; et al. Cross-species genomic landscape comparison of human mucosal melanoma with canine oral and equine melanoma. Nat. Commun. 2019, 10. [Google Scholar] [CrossRef]
- Antonescu, C.R.; Busam, K.J.; Francone, T.D.; Wong, G.C.; Guo, T.; Agaram, N.P.; Besmer, P.; Jungbluth, A.; Gimbel, M.; Chen, C.T.; et al. L576P KIT mutation in anal melanomas correlates with KIT protein expression and is sensitive to specific kinase inhibition. Int. J. Cancer 2007, 121, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Rivera, R.S.; Nagatsuka, H.; Gunduz, M.; Cengiz, B.; Gunduz, E.; Siar, C.H.; Tsujigiwa, H.; Tamamura, R.; Han, K.N.; Nagai, N. C-kit protein expression correlated with activating mutations in KIT gene in oral mucosal melanoma. Virchows Arch. 2008, 452, 27–32. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.; Wu, Y.; Zhang, T.; Song, H.; Jv, H.; Guo, W.; Ren, G. The clinical significance of c-Kit mutations in metastatic oral mucosal melanoma in China. Oncotarget 2017, 8, 82661–82673. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- London, C.A. Tyrosine kinase inhibitors in veterinary medicine. Top. Companion Anim. Med. 2009, 24, 106–112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smith, S.H.; Goldschmidt, M.H.; McManus, P.M. A comparative review of melanocytic neoplasms. Vet. Pathol. 2002, 39, 651–678. [Google Scholar] [CrossRef] [PubMed]
- Todoroff, R.J.; Brodey, R.S. Oral and pharyngeal neoplasia in the dog: A retrospective survey of 361 cases. J. Am. Vet. Med. Assoc. 1979, 175, 567–571. [Google Scholar] [PubMed]
- Goldschmidt, M.H. Benign and malignant melanocytic neoplasms of domestic animals. Am. J. Derm. 1985, 7, 203–212. [Google Scholar] [CrossRef]
- Curtin, J.A.; Fridlyand, J.; Kageshita, T.; Patel, H.N.; Busam, K.J.; Kutzner, H.; Cho, K.H.; Aiba, S.; Bröcker, E.B.; LeBoit, P.E.; et al. Distinct sets of genetic alterations in melanoma. N. Engl. J. Med. 2005, 353, 2135–2147. [Google Scholar] [CrossRef]
- Furney, S.J.; Turajlic, S.; Stamp, G.; Nohadani, M.; Carlisle, A.; Thomas, J.M.; Hayes, A.; Strauss, D.; Gore, M.; Van Den Oord, J.; et al. Genome sequencing of mucosal melanomas reveals that they are driven by distinct mechanisms from cutaneous melanoma. J. Pathol. 2013, 230, 261–269. [Google Scholar] [CrossRef]
- Lyu, J.; Song, Z.; Chen, J.; Shepard, M.J.; Song, H.; Ren, G.; Li, Z.; Guo, W.; Zhuang, Z.; Shi, Y. Whole-exome sequencing of oral mucosal melanoma reveals mutational profile and therapeutic targets. J. Pathol. 2018, 244, 358–366. [Google Scholar] [CrossRef]
- Hayward, N.K.; Wilmott, J.S.; Waddell, N.; Johansson, P.A.; Field, M.A.; Nones, K.; Patch, A.M.; Kakavand, H.; Alexandrov, L.B.; Burke, H.; et al. Whole-genome landscapes of major melanoma subtypes. Nature 2017, 545, 175–180. [Google Scholar] [CrossRef] [PubMed]
- Poorman, K.; Borst, L.; Moroff, S.; Roy, S.; Labelle, P.; Motsinger-Reif, A.; Breen, M. Comparative cytogenetic characterization of primary canine melanocytic lesions using array CGH and fluorescence in situ hybridization. Chromosom. Res. 2015, 23, 171–186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hendricks, W.P.D.; Zismann, V.; Sivaprakasam, K.; Legendre, C.; Poorman, K.; Tembe, W.; Kiefer, J.; Liang, W.; DeLuca, V.; Stark, M.; et al. Somatic inactivating PTPRJ mutations and dysregulated pathways identified in canine malignant melanoma by integrated comparative genomic analysis. PLoS Genet. 2018, 14, e1007589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giannuzzi, D.; Marconato, L.; Ramy, E.; Ferraresso, S.; Scarselli, E.; Fariselli, P.; Nicosia, A.; Pegolo, S.; Leoni, G.; Laganga, P.; et al. Longitudinal transcriptomic and genetic landscape of radiotherapy response in canine melanoma. Vet. Comp. Oncol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Brocca, G.; Ferraresso, S.; Zamboni, C.; Martinez-Merlo, E.M.; Ferro, S.; Goldschmidt, M.H.; Castagnaro, M. Array Comparative Genomic Hybridization analysis reveals significantly enriched pathways in Canine Oral Melanoma. Front. Oncol. 2019, 9, 1397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ashida, A.; Takata, M.; Murata, H.; Kido, K.; Saida, T. Pathological activation of KIT In metastatic tumors of acral and mucosal melanomas. Int. J. Cancer 2009, 124, 863–868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, X.; Mao, L.; Chi, Z.; Sheng, X.; Cui, C.; Kong, Y.; Dai, J.; Wang, X.; Li, S.; Tang, B.; et al. Efficacy evaluation of imatinib for the treatment of melanoma: Evidence from a retrospective study. Oncol. Res. 2019, 27, 495–501. [Google Scholar] [CrossRef]
- Chen, F.; Zhang, Q.; Wang, Y.; Wang, S.; Feng, S.; Qi, L.Y.; Li, X.; Ding, C. KIT, NRAS, BRAF and FMNL2 mutations in oral mucosal melanoma and a systematic review of the literature. Oncol. Lett. 2018, 15, 9786–9792. [Google Scholar] [CrossRef] [Green Version]
- Yun, J.; Lee, J.; Jang, J.; Lee, E.J.; Jang, K.T.; Kim, J.H.; Kim, K.M. KIT amplification and gene mutations in acral/mucosal melanoma in Korea. Apmis 2011, 119, 330–335. [Google Scholar] [CrossRef]
- Omholt, K.; Grafström, E.; Kanter-Lewensohn, L.; Hansson, J.; Ragnarsson-Olding, B.K. KIT pathway alterations in mucosal melanomas of the vulva and other sites. Clin. Cancer Res. 2011, 17, 3933–3942. [Google Scholar] [CrossRef] [Green Version]
- Zebary, A.; Jangard, M.; Omholt, K.; Ragnarsson-Olding, B.; Hansson, J. KIT, NRAS and BRAF mutations in sinonasal mucosal melanoma: A study of 56 cases. Br. J. Cancer 2013, 109, 559–564. [Google Scholar] [CrossRef] [PubMed]
- Satzger, I.; Schaefer, T.; Kuettler, U.; Broecker, V.; Voelker, B.; Ostertag, H.; Kapp, A.; Gutzmer, R. Analysis of c-KIT expression and KIT gene mutation in human mucosal melanomas. Br. J. Cancer 2008, 99, 2065–2069. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chu, P.Y.; Pan, S.L.; Liu, C.H.; Lee, J.; Yeh, L.S.; Liao, A.T. KIT gene exon 11 mutations in canine malignant melanoma. Vet. J. 2013, 196, 226–230. [Google Scholar] [CrossRef] [PubMed]
- Murakami, A.; Mori, T.; Sakai, H.; Murakami, M.; Yanai, T.; Hoshino, Y.; Maruo, K. Analysis of KIT expression and KIT exon 11 mutations in canine oral malignant melanomas. Vet. Comp. Oncol. 2011, 9, 219–224. [Google Scholar] [CrossRef] [PubMed]
- Morini, M.; Bettini, G.; Preziosi, R.; Mandrioli, L. C-kit gene product (CD117) immunoreactivity in canine and feline paraffin sections. J. Histochem. Cytochem. 2004, 52, 705–708. [Google Scholar] [CrossRef] [Green Version]
- Sabattini, S.; Bettini, G. An Immunohistochemical analysis of canine haemangioma and haemangiosarcoma. J. Comp. Pathol. 2009, 140, 158–168. [Google Scholar] [CrossRef]
- Yu, C.H.; Hwang, D.N.; Yhee, J.Y.; Kim, J.H.; Im, K.S.; Nho, W.G.; Lyoo, Y.S.; Sur, J.H. Comparative immunohistochemical characterization of canine seminomas and Sertoli cell tumors. J. Vet. Sci. 2009, 10, 1–7. [Google Scholar] [CrossRef]
- Frost, D. Gastrointestinal stromal tumors and leiomyomas in the dog: A histopathologic, immunohistochemical, and molecular genetic study of 50 cases. Vet. Pathol. 2003, 40, 42–54. [Google Scholar] [CrossRef]
- Newman, S.J.; Jankovsky, J.M.; Rohrbach, B.W.; LeBlanc, A.K. C-kit expression in canine mucosal melanomas. Vet. Pathol. 2012, 49, 760–765. [Google Scholar] [CrossRef] [Green Version]
- Hodi, F.S.; Corless, C.L.; Giobbie-Hurder, A.; Fletcher, J.A.; Zhu, M.; Marino-Enriquez, A.; Friedlander, P.; Gonzalez, R.; Weber, J.S.; Gajewski, T.F.; et al. Imatinib for melanomas harboring mutationally activated or amplified kit arising on mucosal, acral, and chronically sun-damaged skin. J. Clin. Oncol. 2013, 31, 3182–3190. [Google Scholar] [CrossRef] [Green Version]
- Heinrich, M.C.; Corless, C.L.; Demetri, G.D.; Blanke, C.D.; Von Mehren, M.; Joensuu, H.; McGreevey, L.S.; Chen, C.J.; Van Den Abbeele, A.D.; Druker, B.J.; et al. Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J. Clin. Oncol. 2003, 21, 4342–4349. [Google Scholar] [CrossRef] [PubMed]
- Deininger, M.; Buchdunger, E.; Druker, B.J. The development of imatinib as a therapeutic agent for chronic myeloid leukemia. Blood 2005, 105, 2640–2653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pardanani, A. Systemic mastocytosis in adults: 2019 update on diagnosis, risk stratification and management. Am. J. Hematol. 2019, 94, 363–377. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Isotani, M.; Ishida, N.; Tominaga, M.; Tamura, K.; Yagihara, H.; Ochi, S.; Kato, R.; Kobayashi, T.; Fujita, M.; Fujino, Y.; et al. Effect of tyrosine kinase inhibition by imatinib mesylate on mast cell tumors in dogs. J. Vet. Intern. Med. 2008, 22, 985–988. [Google Scholar] [CrossRef] [PubMed]
- Irie, M.; Takeuchi, Y.; Ohtake, Y.; Suzuki, H.; Nagata, N.; Miyoshi, T.; Kagawa, Y.; Yamagami, T. Imatinib mesylate treatment in a dog with gastrointestinal stromal tumors with a c-kit mutation. J. Vet. Med. Sci. 2015, 77, 1535–1539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kobayashi, M.; Kuroki, S.; Ito, K.; Yasuda, A.; Sawada, H.; Ono, K.; Washizu, T.; Bonkobara, M. Imatinib-associated tumour response in a dog with a non-resectable gastrointestinal stromal tumour harbouring a c-kit exon 11 deletion mutation. Vet. J. 2013, 198, 271–274. [Google Scholar] [CrossRef] [PubMed]
- Bonkobara, M. Dysregulation of tyrosine kinases and use of imatinib in small animal practice. Vet. J. 2015, 205, 180–188. [Google Scholar] [CrossRef] [Green Version]
- Smedley, R.C.; Spangler, W.L.; Esplin, D.G.; Kitchell, B.E.; Bergman, P.J.; Ho, H.Y.; Bergin, I.L.; Kiupel, M. Prognostic markers for canine melanocytic neoplasms: A comparative review of the literature and goals for future investigation. Vet Pathol. 2011, 48, 54–72. [Google Scholar] [CrossRef]
- Bergin, I.L.; Smedley, R.C.; Esplin, D.G.; Spangler, W.L.; Kiupel, M. Prognostic evaluation of Ki67 threshold value in canine oral melanoma. Vet. Pathol. 2011, 48, 41–53. [Google Scholar] [CrossRef] [Green Version]
- Ensembl. Available online: https://www.ensembl.org/index.html (accessed on 9 December 2020).
- Primer3web. Available online: https://primer3.ut.ee/ (accessed on 9 December 2020).
- Multiple Sequence Alignment by CLUSTALW. Available online: https://www.genome.jp/tools-bin/clustalw (accessed on 9 December 2020).
- Fonseca-Alves, C.E.; Kobayashi, P.E.; Palmieri, C.; Laufer-Amorim, R. Investigation of c-KIT and Ki67 expression in normal, preneoplastic and neoplastic canine prostate. Bmc Vet. Res. 2017, 13, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Teixeira, T.F.; Da Silva, T.C.; Cogliati, B.; Nagamine, M.K.; Dagli, M.L.Z. Retrospective study of melanocytic neoplasms in dogs and cats. Braz. J. Vet. Pathol. 2010, 3, 100–104. [Google Scholar]
- Eckhart, L.; Bach, J.; Ban, J.; Tschachler, E. Melanin binds reversibly to thermostable DNA polymerase and inhibits its activity. Biochem. Biophys. Res. Commun. 2000, 271, 726–730. [Google Scholar] [CrossRef] [PubMed]
- Lassam, N.; Bickford, S. Loss of c-kit expression in cultured melanoma cells. Oncogene 1992, 7, 51–56. [Google Scholar] [PubMed]
- Montone, K.T.; van Belle, P.; Elenitsas, R.; Elder, D.E. Proto-oncogene c-kit expression in malignant melanoma: Protein loss without tumor progression. Mod. Pathol. 1997, 10, 939–944. [Google Scholar]
- Prouteau, A.; Chocteau, F.; de Brito, C.; Cadieu, E.; Primot, A.; Botherel, N.; Degorce, F.; Cornevin, L.; Lagadic, M.A.; Cabillic, F.; et al. Prognostic value of somatic focal amplifications on chromosome 30 in canine oral melanoma. Vet. Comp. Oncol. 2020, 18, 214–223. [Google Scholar] [CrossRef]
Case ID | Site (Oral Cavity) | Breed | Age (Years) | Sex | Pigmentation [48] | KIT locus Amplification | Prognosis [49] | Ki67 Index * [49] | KIT Index * |
---|---|---|---|---|---|---|---|---|---|
1 | Mandible | West Highland White Terrier | 11 | M | <50% | yes | G | 16.2 | 8.6 |
2 | Cheek | Cross breed | 17 | M | <50% | yes | B | 137.4 | 0.8 |
3 | Oral | Rottweiler | 12 | FN | <50% | no | B | 29.6 | 1.4 |
4 | Lip | American Cocker Spaniel | 10 | MN | <50% | yes | B | 54.2 | 5 |
5 | Upper lip | Golden Retriever | 12 | M | <50% | yes | B | 113.4 | 6.6 |
6 | Lip | Cocker Spaniel | 10 | F | <50% | no | B | 26.2 | 6.6 |
7 | Mandible | Pug | 11 | M | <50% | yes | B | 37.4 | NA |
8 | Oral | Collie | 11 | M | ≥50% | yes | B | 30 | 0 |
9 | Upper lip | German Shepherd | 11 | M | <50% | yes | B | 22.6 | 0.6 |
10 | Mandible | Cocker Spaniel | 11 | F | ≥50% | no | B | 21.6 | 2 |
11 | Upper lip | Pinscher | 17 | M | ≥50% | no | G | 7.6 | 3 |
12 | Upper lip | Cocker Spaniel | 10 | M | ≥50% | no | B | 265 | 3.8 |
13 | Upper lip | Basset Hound | 11 | M | <50% | no | G | 9.8 | 0 |
14 | Upper lip | Golden Retriever | 13 | M | <50% | no | B | 102.4 | 1.6 |
Mean | 62.4 | 3.1 |
Primer Sequence | Primer Length | Annealing Temp | Primer Genomic Location | Amplicon Size (bp) | CDS Covered (%) | ||
---|---|---|---|---|---|---|---|
Exon 13 | F Primer | TGGCTTGCCAAATTTGCTTCT | 21 | 59.58° C | 13:47108547–47108567 | 247 bp | 100% |
R Primer | AACCAAGCACTGTCGCAATG | 20 | 59.69 °C | 13:47108774–47108793 | |||
Exon 17 | F Primer | TGACATAGCAGCATTCTCGTGT | 22 | 60.09 °C | 13:47113635–47113656 | 257 bp | 100% |
R Primer | TCCTTCACTGGACTGTCAAGC | 21 | 59.93 °C | 13:47113871–47113891 | |||
Exon 18 | R Primer | CATTGCCGGATCTGTTGTGC | 20 | 60.18 °C | 13:47117315–47117334 | 211 bp | 100% |
F Primer | AGGACCCTGCTAACCCCTTA | 20 | 59.58 °C | 13:47117506–47117525 |
Case ID | DNA | Ex-13 | Ex-17 | Ex-18 |
---|---|---|---|---|
1 | H | yes | yes | yes |
P | yes | yes | yes | |
2 | H | yes | yes | yes |
P | yes | yes | yes | |
3 | H | yes | yes | yes |
P | yes | yes | yes | |
4 | H | yes | yes | yes |
P | yes | yes | yes | |
5 | H | yes | yes | yes |
P | yes | yes | yes | |
6 | H | yes | yes | yes |
P | yes | yes | yes | |
7 | H | yes | yes | yes |
P | yes | yes | yes | |
8 | H | yes | yes | yes |
P | yes | yes | yes | |
9 | H | yes | yes | yes |
P | yes | yes | yes | |
10 | H | yes | yes | yes |
P | yes | yes | yes | |
11 | H | yes | yes | yes |
P | yes | yes | yes | |
12 | H | yes | yes | yes |
P | no | no | yes | |
13 | H | yes | yes | yes |
P | yes | yes | yes | |
14 | H | yes | yes | yes |
P | yes | yes | yes |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brocca, G.; Poncina, B.; Sammarco, A.; Cavicchioli, L.; Castagnaro, M. KIT Somatic Mutations and Immunohistochemical Expression in Canine Oral Melanoma. Animals 2020, 10, 2370. https://doi.org/10.3390/ani10122370
Brocca G, Poncina B, Sammarco A, Cavicchioli L, Castagnaro M. KIT Somatic Mutations and Immunohistochemical Expression in Canine Oral Melanoma. Animals. 2020; 10(12):2370. https://doi.org/10.3390/ani10122370
Chicago/Turabian StyleBrocca, Ginevra, Beatrice Poncina, Alessandro Sammarco, Laura Cavicchioli, and Massimo Castagnaro. 2020. "KIT Somatic Mutations and Immunohistochemical Expression in Canine Oral Melanoma" Animals 10, no. 12: 2370. https://doi.org/10.3390/ani10122370