Association of SPOP Expression with the Immune Response to Salmonella Infection in Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement and Animal Breeding
2.2. Bacterial Strains
2.3. Experimental Infection and Sample Collection
2.4. Measurement of IgA Concentrations and Bacterial Loads
2.5. Cell Culture and LPS Stimulation
2.6. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction
2.7. Statistical Analysis
3. Results
3.1. Association of SPOP Expression with the Immune Response in HD11 Cells
3.2. Changes in SPOP Expression after Salmonella Infection in Chickens
3.3. Association of SPOP Expression with the Immune Response After Salmonella Infection in Chickens
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sever, N.K.; Akan, M.; Mehmet, A. Molecular analysis of virulence genes of Salmonella Infantis isolated from chickens and turkeys. Microb. Pathog. 2019, 126, 199–204. [Google Scholar] [CrossRef] [PubMed]
- Snow, L.C.; Davies, R.H.; Christiansen, K.H.; Carrique-Mas, J.J.; Wales, A.D.; O’Connor, J.L.; Cook, A.J.C.; Evans, S.J. Survey of the prevalence of Salmonella species on commercial laying farms in the United Kingdom. Veter. Rec. 2007, 161, 471–476. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuang, X.; Hao, H.; Dai, M.; Wang, Y.; Ahmad, I.; Liu, Z.; Hui, Y.Z. Serotypes and antimicrobial susceptibility of Salmonella spp. isolated from farm animals in China. Front. Microbiol. 2015, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wigley, P. Immunity to bacterial infection in the chicken. Dev. Comp. Immunol. 2013, 41, 413–417. [Google Scholar] [CrossRef]
- Li, P.; Fan, W.; Everaert, N.; Liu, R.; Li, Q.; Zheng, M.; Cui, H.; Zhao, G.; Wen, J. Messenger RNA Sequencing and Pathway Analysis Provide Novel Insights Into the Susceptibility to Salmonella enteritidis Infection in Chickens. Front. Genet. 2018, 9, 256. [Google Scholar] [CrossRef]
- Medzhitov, R.; Janeway, C., Jr. Innate immunity. N. Engl. J. Med. 2000, 343, 338–344. [Google Scholar] [CrossRef]
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen Recognition and Innate Immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [Green Version]
- Gou, Z.; Liu, R.; Zhao, G.; Zheng, M.; Li, P.; Wang, H.; Zhu, Y.; Chen, J.; Wen, J. Epigenetic Modification of TLRs in Leukocytes Is Associated with Increased Susceptibility to Salmonella enteritidis in Chickens. PLoS ONE 2012, 7, e33627. [Google Scholar] [CrossRef] [Green Version]
- Li, P.; Xia, P.; Wen, J.; Zheng, M.; Chen, J.; Zhao, J.; Jiang, R.; Liu, R.; Zhao, G. Up-regulation of the MyD88-dependent pathway of TLR signaling in spleen and caecum of young chickens infected with Salmonella serovar Pullorum. Veter. Microbiol. 2010, 143, 346–351. [Google Scholar] [CrossRef]
- Weiss, D.S.; Raupach, B.; Takeda, K.; Akira, S.; Zychlinsky, A. Toll-Like Receptors Are Temporally Involved in Host Defense. J. Immunol. 2004, 172, 4463–4469. [Google Scholar] [CrossRef] [Green Version]
- Takeda, K.; Akira, S. Toll-Like Receptors. Curr. Protoc. Immunol. 2015, 109, 335–376. [Google Scholar] [CrossRef] [PubMed]
- Ting, J.P.-Y.; Davis, B.K. CATERPILLER: A Novel Gene Family Important in Immunity, Cell Death, and Diseases. Annu. Rev. Immunol. 2005, 23, 387–414. [Google Scholar] [CrossRef] [PubMed]
- Koppe, U.; Suttorp, N.; Opitz, B. Recognition of Streptococcus pneumoniae by the innate immune system. Cell. Microbiol. 2012, 14, 460–466. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. The role of pattern-recognition receptors in innate immunity: Update on Toll-like receptors. Nat. Immunol. 2010, 11, 373–384. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhang, P.; Jiang, X.; Du, H.; Yang, C.; Zhang, Z.; Men, S.; Zhang, Z.; Jiang, W.; Wang, H. Differences in expression of genes in the MyD88 and TRIF signalling pathways and methylation of TLR4 and TRIF in Tibetan chickens and DaHeng S03 chickens infected with Salmonella enterica serovar enteritidis. Veter. Immunol. Immunopathol. 2017, 189, 28–35. [Google Scholar] [CrossRef]
- Li, P.; Wang, H.; Zhao, X.; Gou, Z.; Liu, R.; Song, Y.; Li, Q.; Zheng, M.; Cui, H.; Everaert, N.; et al. Allelic variation in TLR4 is linked to resistance to Salmonella Enteritidis infection in chickens. Poult. Sci. 2017, 96, 2040–2048. [Google Scholar] [CrossRef]
- Tao, Z.; Zhu, C.; Song, W.; Xu, W.; Zhang, S.; Liu, H.; Li, H. Inductive expression of the NOD1 signalling pathway in chickens infected with Salmonella pullorum. Br. Poult. Sci. 2017, 58, 242–250. [Google Scholar] [CrossRef]
- Sun, W.; Liu, R.; Li, P.; Li, Q.; Cui, H.; Zheng, M.; Wen, J.; Zhao, G. Chicken gga-miR-1306-5p targets Tollip and plays an important role in host response against Salmonella enteritidis infection. J. Anim. Sci. Biotechnol. 2019, 10, 59. [Google Scholar] [CrossRef] [Green Version]
- Huang, C.J.; Chen, C.Y.; Chen, H.H.; Tsai, S.F.; Choo, K.B. TDPOZ, a family of bipartite animal and plant proteins that contain the TRAF (TD) and POZ/BTB domains. Gene 2004, 324, 117–127. [Google Scholar] [CrossRef]
- Kwon, J.E.; La, M.; Oh, K.H.; Oh, Y.M.; Kim, G.R.; Seol, J.H.; Baek, S.H.; Chiba, T.; Tanaka, K.; Bang, O.S.; et al. BTB Domain-containing Speckle-type POZ Protein (SPOP) Serves as an Adaptor of Daxx for Ubiquitination by Cul3-based Ubiquitin Ligase. J. Boil. Chem. 2006, 281, 12664–12672. [Google Scholar] [CrossRef] [Green Version]
- Cai, H.; Liu, A. Spop promotes skeletal development and homeostasis by positively regulating Ihh signaling. Proc. Natl. Acad. Sci. USA 2016, 113, 14751–14756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fong, K.-W.; Zhao, J.C.; Song, B.; Zheng, B.; Yu, J. TRIM28 protects TRIM24 from SPOP-mediated degradation and promotes prostate cancer progression. Nat. Commun. 2018, 9, 5007. [Google Scholar] [CrossRef] [PubMed]
- Guillamot, M.; Ouazia, D.; Dolgalev, I.; Yeung, S.T.; Kourtis, N.; Dai, Y.; Corrigan, K.; Zea-Redondo, L.; Saraf, A.; Florens, L.; et al. The E3 ubiquitin ligase SPOP controls resolution of systemic inflammation by triggering MYD88 degradation. Nat. Immunol. 2019, 20, 1196–1207. [Google Scholar] [CrossRef] [PubMed]
- Keestra, A.M.; Van Putten, J.P.M. Unique properties of the chicken TLR4/MD-2 complex: Selective lipopolysaccharide activation of the MyD88-dependent pathway. J. Immunol. 2008, 181, 4354–4362. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
- Grivennikov, S.I.; Greten, F.R.; Karin, M. Immunity, Inflammation, and Cancer. Cell 2010, 140, 883–899. [Google Scholar] [CrossRef] [Green Version]
- Peng, S.; Li, C.; Wang, X.; Liu, X.; Han, C.; Jin, T.; Liu, S.; Zhang, X.; Zhang, H.; He, X.; et al. Increased Toll-Like Receptors Activity and TLR Ligands in Patients with Autoimmune Thyroid Diseases. Front. Immunol. 2016, 7, 44. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.S.; Park, J.S.; Kim, J.H.; Jung, S.M.; Lee, J.Y.; Kim, S.J.; Park, H.P. Smad6-specific recruitment of Smurf E3 ligases mediates TGF-beta1-induced degradation of MyD88 in TLR4 signalling. Nat. Commun. 2011, 2, 460. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Chen, T.; Zhang, J.; Yang, M.; Li, N.; Xu, X.; Cao, X. The E3 ubiquitin ligase Nrdp1 ’preferentially’ promotes TLR-mediated production of type I interferon. Nat. Immunol. 2009, 10, 744–752. [Google Scholar] [CrossRef]
- Han, C.; Jin, J.; Xu, S.; Liu, H.; Li, N.; Cao, X. Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting degradation of MyD88 and TRIF via Cbl-b. Nat. Immunol. 2010, 11, 734–742. [Google Scholar] [CrossRef]
- Liu, A.; Desai, B.M.; Stoffers, D.A. Identification of PCIF1, a POZ Domain Protein That Inhibits PDX-1 (MODY4) Transcriptional Activity. Mol. Cell. Boil. 2004, 24, 4372–4383. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, J.; Chen, M.; Zhu, Y.; Dai, X.; Dang, F.; Ren, J.; Ren, S.; Shulga, Y.V.; Beca, F.; Gan, W.; et al. SPOP Promotes Nanog Destruction to Suppress Stem Cell Traits and Prostate Cancer Progression. Dev. Cell 2019, 48, 329–344.e5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cross, A.; Asher, L.; Seguin, M.; Yuan, L.; Kelly, N.; Hammack, C.; Sadoff, J.; Gemski, P. The importance of a lipopolysaccharide-initiated, cytokine-mediated host defense mechanism in mice against extraintestinally invasive Escherichia coli. J. Clin. Investig. 1995, 96, 676–686. [Google Scholar] [CrossRef] [PubMed]
- Cohen, J. The immunopathogenesis of sepsis. Nature 2002, 420, 885–891. [Google Scholar] [CrossRef]
- Clark, I.A.; Vissel, B. The meteorology of cytokine storms, and the clinical usefulness of this knowledge. Semin. Immunopathol. 2017, 39, 505–516. [Google Scholar] [CrossRef] [Green Version]
- Webb, T.; Goodman, H.C. The structure and function of immunoglobulins. Mod. Trends Immunol. 1967, 2, 151–187. [Google Scholar]
Name | Forward(5’-3′) | Reverse(5’-3′) |
---|---|---|
SPOP | AGGCTTGGATGAGGAGAGT | CGCTGGCTCTCCATTGCTT |
IL-1β | GCATCAAGGGCTACAAGCTCT | CCAGGCGGTAGAAGATGAAG |
IL-8 | TCCTCCTGGTTTCAGCTGCT | GTGGATGAACTTAGAATGAGTG |
β-actin | GAGAAATTGTGCGTGACATCA | CCTGAACCTCTCATTGCCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, F.; Li, Q.; Wang, Q.; Zheng, M.; Wen, J.; Zhao, G. Association of SPOP Expression with the Immune Response to Salmonella Infection in Chickens. Animals 2020, 10, 307. https://doi.org/10.3390/ani10020307
Wang F, Li Q, Wang Q, Zheng M, Wen J, Zhao G. Association of SPOP Expression with the Immune Response to Salmonella Infection in Chickens. Animals. 2020; 10(2):307. https://doi.org/10.3390/ani10020307
Chicago/Turabian StyleWang, Fei, Qinghe Li, Qiao Wang, Maiqing Zheng, Jie Wen, and Guiping Zhao. 2020. "Association of SPOP Expression with the Immune Response to Salmonella Infection in Chickens" Animals 10, no. 2: 307. https://doi.org/10.3390/ani10020307