Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples and Collection of Data
2.2. Isolation of DNA and Primer Design
2.3. DNA Pool Establishment and PCR Amplification
2.4. Statistical Analysis
3. Results
3.1. Electrophoresis Detection of Four Indels
3.2. Polymorphism of rs665862918
3.3. Effect of the rs665862918 Polymorphism on Prowth Traits
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wang, K.; Yan, H.; Xu, H.; Yang, Q.; Zhang, S.; Pan, C.; Chen, H.; Zhu, H.; Liu, J.; Qu, L.; et al. A novel indel within goat casein alpha S1 gene is significantly associated with litter size. Gene 2018, 671, 161–169. [Google Scholar] [CrossRef]
- Dai, B.; Liang, H.; Guo, D.-d.; Bi, Z.-w.; Yuan, J.-l.; Jin, Y.; Huan, L.; Guo, X.-d.; Cang, M.; Liu, D.-j. The overexpression of tβ4 in the hair follicle tissue of Alpas cashmere goats increases cashmere yield and promotes hair follicle development. Animals 2019, 10, 75. [Google Scholar] [CrossRef]
- Jin, Y.; Yang, Q.; Gao, J.; Tang, Q.; Duan, B.; Yu, T.; Qi, X.; Liu, J.; Wang, R.; Dang, R.; et al. Detection of Insertions/Deletions Within SIRT1, SIRT2 and SIRT3 Genes and Their Associations with Body Measurement Traits in Cattle. Biochem. Genet. 2018, 56, 663–676. [Google Scholar] [CrossRef]
- Wang, X.; Yang, Q.; Wang, K.; Zhang, S.; Pan, C.; Chen, H.; Qu, L.; Yan, H.; Lan, X. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim. Genet. 2017, 48, 735–736. [Google Scholar] [CrossRef]
- Yan, H.L.; Jiang, E.H.; Zhu, H.J.; Hu, L.Y.; Liu, J.W.; Qu, L. The novel 22 bp insertion mutation in a promoter region of the PITX2 gene is associated with litter size and growth traits in goats. Arch. Anim. Breed 2018, 61, 329–336. [Google Scholar] [CrossRef]
- Wang, K.; Cui, Y.; Wang, Z.; Yan, H.; Meng, Z.; Zhu, H.; Qu, L.; Lan, X.; Pan, C. One 16bp insertion/deletion (indel) within the KDM6A gene revealing strong associations with growth traits in goat. Gene 2019, 686, 16–20. [Google Scholar] [CrossRef] [PubMed]
- Marques, D.; Ferreira-Costa, L.R.; Ferreira-Costa, L.L.; Correa, R.d.S.; Borges, A.M.P.; Ito, F.R.; Ramos, C.C.d.O.; Bortolin, R.H.; Luchessi, A.D.; Ribeiro-Dos-Santos, Â.; et al. Association of insertion-deletions polymorphisms with colorectal cancer risk and clinical features. World J. Gastroenterol. 2017, 23, 6854–6867. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Liu, D.; Tang, S.; Li, D.; Han, R.; Tian, Y.; Li, H.; Li, G.; Li, W.; Liu, X.; et al. A multiallelic indel in the promoter region of the Cyclin-dependent kinase inhibitor 3 gene is significantly associated with body weight and carcass traits in chickens. Poult. Sci. 2019, 98, 556–565. [Google Scholar] [CrossRef]
- Ren, T.; Li, W.; Liu, D.; Liang, K.; Wang, X.; Li, H.; Jiang, R.; Tian, Y.; Kang, X.; Li, Z. Two insertion/deletion variants in the promoter region of the QPCTL gene are significantly associated with body weight and carcass traits in chickens. Anim. Genet. 2019, 50, 279–282. [Google Scholar] [CrossRef]
- Yang, Q.; Zhang, S.; Liu, L.; Cao, X.; Lei, C.; Qi, X.; Lin, F.; Qu, W.; Qi, X.; Liu, J.; et al. Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene. Prion 2016, 10, 409–419. [Google Scholar] [CrossRef]
- Wang, Z.; Zhang, X.; Jiang, E.; Yan, H.; Zhu, H.; Chen, H.; Liu, J.; Qu, L.; Pan, C.; Lan, X. InDels within caprine IGF2BP1 intron 2 and the 3′-untranslated regions are associated with goat growth traits. Anim. Genet. 2019. [Google Scholar] [CrossRef]
- Xu, W.; He, H.; Zheng, L.; Xu, J.W.; Lei, C.Z.; Zhang, G.M.; Dang, R.H.; Niu, H.; Qi, X.L.; Chen, H.; et al. Detection of 19-bp deletion within PLAG1 gene and its effect on growth traits in cattle. Gene 2018, 675, 144–149. [Google Scholar] [CrossRef] [PubMed]
- He, X.; Chao, Y.; Zhou, G.; Chen, Y. Fibroblast growth factor 5-short (FGF5s) inhibits the activity of FGF5 in primary and secondary hair follicle dermal papilla cells of cashmere goats. Gene 2016, 575, 393–398. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Li, A.; Cai, H.; Zhang, C.; Lei, C.; Lan, X.; Chen, H. Intron retention as an alternative splice variant of the cattle ANGPTL6 gene. Gene 2019, 709, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Matsuo, N.; Kawamoto, S.; Matsubara, K.; Okubo, K. Cloning of a cDNA encoding a novel sugar transporter expressed in the neonatal mouse hippocampus. Biochem. Biophys. Res. Commun. 1997, 238, 126–129. [Google Scholar] [CrossRef] [PubMed]
- Sreedharan, S.; Stephansson, O.; Schioth, H.B.; Fredriksson, R. Long evolutionary conservation and considerable tissue specificity of several atypical solute carrier transporters. Gene 2011, 478, 11–18. [Google Scholar] [CrossRef]
- El-Gebali, S.; Bentz, S.; Hediger, M.A.; Anderle, P. Solute carriers (SLCs) in cancer. Mol. Aspects Med. 2013, 34, 719–734. [Google Scholar] [CrossRef]
- Lekholm, E.; Perland, E.; Eriksson, M.M.; Hellsten, S.V.; Lindberg, F.A.; Rostami, J.; Fredriksson, R. Putative Membrane-Bound Transporters MFSD14A and MFSD14B Are Neuronal and Affected by Nutrient Availability. Front. Mol. Neurosci. 2017, 10, 11. [Google Scholar] [CrossRef]
- Zhang, B.; Chang, L.; Lan, X.; Asif, N.; Guan, F.; Fu, D.; Li, B.; Yan, C.; Zhang, H.; Zhang, X.; et al. Genome-wide definition of selective sweeps reveals molecular evidence of trait-driven domestication among elite goat (Capra species) breeds for the production of dairy, cashmere, and meat. Gigascience 2018, 7. [Google Scholar] [CrossRef]
- Hu, Z.L.; Park, C.A.; Reecy, J.M. Developmental progress and current status of the Animal QTLdb. Nucleic Acids Res. 2016, 44, D827–D833. [Google Scholar] [CrossRef]
- Liu, J.J.; Liang, A.X.; Campanile, G.; Plastow, G.; Zhang, C.; Wang, Z.; Salzano, A.; Gasparrini, B.; Cassandro, M.; Yang, L.G. Genome-wide association studies to identify quantitative trait loci affecting milk production traits in water buffalo. J. Dairy Sci. 2018, 101, 433–444. [Google Scholar] [CrossRef]
- Doran, J.; Walters, C.; Kyle, V.; Wooding, P.; Hammett-Burke, R.; Colledge, W.H. Mfsd14a (Hiat1) gene disruption causes globozoospermia and infertility in male mice. Reproduction 2016, 152, 91–99. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, R.P.; Bailey, D.R.; Shannon, N.H. Linear body measurements of cattle before and after 20 years of selection for postweaning gain when fed two different diets. J. Anim. Sci. 1993, 71, 1712–1720. [Google Scholar] [CrossRef] [PubMed]
- Kang, Z.; Zhang, S.; He, L.; Zhu, H.; Wang, Z.; Yan, H.; Huang, Y.; Dang, R.; Lei, C.; Chen, H.; et al. A 14-bp functional deletion within the CMTM2 gene is significantly associated with litter size in goat. Theriogenology 2019, 139, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Zhang, S.; Li, J.; Wang, X.; Peng, K.; Lan, X.; Pan, C. Development of a touch-down multiplex PCR method for simultaneously rapidly detecting three novel insertion/deletions (indels) within one gene: An example for goat GHR gene. Anim. Biotechnol. 2019, 30, 366–371. [Google Scholar] [CrossRef] [PubMed]
- Jiang, E.; Kang, Z.; Wang, X.; Liu, Y.; Liu, X.; Wang, Z.; Li, X.; Lan, X. Detection of insertions/deletions (InDels) within the goat Runx2 gene and their association with litter size and growth traits. Anim. Biotechnol. 2019, 1–9. [Google Scholar] [CrossRef]
- Wang, K.; Kang, Z.; Jiang, E.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. Genetic effects of DSCAML1 identified in genome-wide association study revealing strong associations with litter size and semen quality in goat (Capra hircus). Theriogenology 2020, 146, 20–25. [Google Scholar] [CrossRef]
- Wang, X.; Lian, L.; Zhao, C.; Deng, X.; Wu, C. Nature Identification of Nontargeted Bands Accompanied with Heterozygote in Nondenatured Polyacrylamide Gel Electrophoresis. J. Agric. Biotechnol. 2010, 18, 616–622. [Google Scholar]
- Ren, F.; Yu, S.; Chen, R.; Lv, X.; Pan, C. Identification of a novel 12-bp insertion/deletion (indel) of iPS-related Oct4 gene and its association with reproductive traits in male piglets. Anim. Reprod. Sci. 2017, 178, 55–60. [Google Scholar] [CrossRef]
- Zhang, Y.; Cui, W.; Yang, H.; Wang, M.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. A novel missense mutation (L280V) within POU1F1 gene strongly affects litter size and growth traits in goat. Theriogenology 2019, 135, 198–203. [Google Scholar] [CrossRef]
- Song, X.; Li, J.; Fei, P.; Zhang, X.; Pan, C.; Chen, H.; Qu, L.; Lan, X. Polymorphisms within the boule gene detected by tetra-primer amplification refractory mutation system PCR (t-arms-pcr) are significantly associated with goat litter size. Animals 2019, 9, 910. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Zhang, Y.; Bai, Y.; Yang, H.; Yan, H.; Liu, J.; Shi, L.; Song, X.; Li, L.; Dong, S.; et al. Relationship between SNPs of POU1F1 gene and litter size and growth traits in Shaanbei white cashmere goats. Animals 2019, 9, 114. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yang, Q.; Zhang, S.; Zhang, X.; Pan, C.; Chen, H.; Zhu, H.; Lan, X. Genetic effects of single nucleotide polymorphisms in the goat GDF9 gene on prolificacy: True or false positive? Animals 2019, 9, 886. [Google Scholar] [CrossRef] [PubMed]
- Bi, Y.; Feng, B.; Wang, Z.; Zhu, H.; Qu, L.; Lan, X.; Pan, C.; Song, X. Myostatin (MSTN) gene indel variation and its associations with body traits in Shaanbei white cashmere goat. Animals 2020, 10, 168. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, K.; Liu, J.; Zhu, H.; Qu, L.; Chen, H.; Lan, X.; Pan, C.; Song, X. An 11-bp indel polymorphism within the CSN1S1 gene is associated with milk performance and body measurement traits in chinese goats. Animals 2019, 9, 1114. [Google Scholar] [CrossRef]
- Whitworth, K.M.; Zhao, J.; Spate, L.D.; Li, R.; Prather, R.S. Scriptaid corrects gene expression of a few aberrantly reprogrammed transcripts in nuclear transfer pig blastocyst stage embryos. Cell Reprogram 2011, 13, 191–204. [Google Scholar] [CrossRef]
- Thomsen, B.; Horn, P.; Panitz, F.; Bendixen, E.; Petersen, A.H.; Holm, L.E.; Nielsen, V.H.; Agerholm, J.S.; Arnbjerg, J.; Bendixen, C. A missense mutation in the bovine SLC35A3 gene, encoding a UDP-N-acetylglucosamine transporter, causes complex vertebral malformation. Genome Res. 2006, 16, 97–105. [Google Scholar] [CrossRef][Green Version]
- Kadri, N.K.; Sahana, G.; Charlier, C.; Iso-Touru, T.; Guldbrandtsen, B.; Karim, L.; Nielsen, U.S.; Panitz, F.; Aamand, G.P.; Schulman, N.; et al. A 660-Kb deletion with antagonistic effects on fertility and milk production segregates at high frequency in Nordic Red cattle: Additional evidence for the common occurrence of balancing selection in livestock. PLoS Genet. 2014, 10, e1004049. [Google Scholar] [CrossRef]
- Marini, C.; Hardies, K.; Pisano, T.; May, P.; Weckhuysen, S.; Cellini, E.; Suls, A.; Mei, D.; Balling, R.; Jonghe, P.D.; et al. Recessive mutations in SLC35A3 cause early onset epileptic encephalopathy with skeletal defects. Am. J. Med. Genet. A 2017, 173, 1119–1123. [Google Scholar] [CrossRef]
- Maszczak-Seneczko, D.; Sosicka, P.; Kaczmarek, B.; Majkowski, M.; Luzarowski, M.; Olczak, T.; Olczak, M. UDP-galactose (SLC35A2) and UDP-N-acetylglucosamine (SLC35A3) Transporters Form Glycosylation-related Complexes with Mannoside Acetylglucosaminyltransferases (Mgats). J. Biol. Chem. 2015, 290, 15475–15486. [Google Scholar] [CrossRef]
- Baralle, F.E.; Giudice, J. Alternative splicing as a regulator of development and tissue identity. Nat. Rev. Mol. Cell Biol. 2017, 18, 437–451. [Google Scholar] [CrossRef] [PubMed]
Primers | Location | Primer Sequences (5′ to 3′) | Length (bp) | Tm |
---|---|---|---|---|
rs658176778 | 5′ UTR | F:ATAGCATGGACAGAGGAGCCT | 192/178 | TD-PCR |
R:TCCCTGGTAAAGAACAGCAAG | ||||
rs665862918 | Intron | F:AGAGCCTCAGTTTCGCTTATT | 183/198 | TD-PCR |
R:GAGTTTATGAATCCAGCAGTTGT | ||||
rs672419140 | Intron | F:GGATGACAGAGGATGAGATGG | 137/145 | TD-PCR |
R:CAGTCGTGTCTGACTCTTTGTG | ||||
rs668363704 | Intron | F:GTTAGGCAGCAATAGCTCAAGG | 166/158 | TD-PCR |
R:AAAACCCAACAAATGGAAGATG |
Genotype Frequencies | Allele Frequencies | HWE | Population Parameters | |||||
---|---|---|---|---|---|---|---|---|
p-Value | Ho | He | Ne | PIC | ||||
DD | 0.639 (n = 647) | I | 0.203 | 0.520 | 0.677 | 0.323 | 1.478 | 0.271 |
ID | 0.317 (n = 321) | |||||||
D | 0.797 | |||||||
II | 0.044 (n = 45) |
Traits | Observed Genotypes (Least Squares Means) | p-Values | ||
---|---|---|---|---|
DD (647) | ID (321) | II (45) | ||
BH (cm) | 56.22 ± 0.18 | 56.48 ± 0.28 | 57.76 ± 0.78 | 0.092 |
BL (cm) | 63.76 b ± 0.20 | 64.29 a,b ± 0.32 | 66.73 a ± 1.04 | 0.022 |
CW (cm) | 18.87 B ± 0.14 | 19.85 A ± 0.24 | 20.92 A ± 0.37 | 1.57 × 10−5 |
CD (cm) | 26.80 B ± 0.14 | 27.48 A ± 0.21 | 28.94 A ± 0.63 | 8.85 × 10−5 |
HG (cm) | 79.79 B ± 0.44 | 83.53 A ± 0.66 | 86.56 A ± 1.81 | 1.05 × 10−7 |
HHC (cm) | 58.58 b ± 0.21 | 59.18 a,b ± 0.35 | 60.81 a ± 0.87 | 0.023 |
CC (cm) | 7.85 ± 0.11 | 7.96 ± 0.05 | 8.10 ± 0.11 | 0.660 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, J.; Song, X.; Wu, H.; Tang, Q.; Wei, Z.; Wang, X.; Lan, X.; Zhang, B. Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats. Animals 2020, 10, 358. https://doi.org/10.3390/ani10020358
Gao J, Song X, Wu H, Tang Q, Wei Z, Wang X, Lan X, Zhang B. Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats. Animals. 2020; 10(2):358. https://doi.org/10.3390/ani10020358
Chicago/Turabian StyleGao, Jiayang, Xiaoyue Song, Hui Wu, Qi Tang, Zhenyu Wei, Xinyu Wang, Xianyong Lan, and Bao Zhang. 2020. "Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats" Animals 10, no. 2: 358. https://doi.org/10.3390/ani10020358
APA StyleGao, J., Song, X., Wu, H., Tang, Q., Wei, Z., Wang, X., Lan, X., & Zhang, B. (2020). Detection of rs665862918 (15-bp Indel) of the HIAT1 Gene and its Strong Genetic Effects on Growth Traits in Goats. Animals, 10(2), 358. https://doi.org/10.3390/ani10020358