Metabolic Gene Expression in the Muscle and Blood Parameters of Broiler Chickens Stimulated In Ovo with Synbiotics
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. In Ovo Injection of Lactobacillus Synbiotics
2.2. Sample Collection and RNA Extraction
2.3. Gene Selection and Primer Design
2.4. RT-qPCR Reaction
2.5. Relative Quantification of Gene Expression
2.6. Hormonal and Biochemical Profiles
3. Results
3.1. Changes in the Metabolic Gene Expression in Muscles in Response to In Ovo Stimulation
3.2. Changes in Hormonal and Biochemical Profiles in Response to In Ovo Stimulation
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Scanes, C.G. The global importance of poultry. Poultr. Sci. 2007, 86, 1057–1058. [Google Scholar] [CrossRef] [PubMed]
- Tavárez, M.A.; Solis de los Santos, F. Impact of genetics and breeding on broiler production performance: A look into the past, present, and future of the industry. Anim. Front. 2016, 6, 37–41. [Google Scholar] [CrossRef]
- Śliżewska, K.; Markowiak, P.; Żbikowski, A.; Szeleszczuk, P. Effects of synbiotics on the gut microbiota, blood and rearing parameters of chickens. FEMS Microbiol. Lett. 2019, 366, fnz116. [Google Scholar] [CrossRef] [PubMed]
- Kabir, S.M.L. The role of probiotics in the poultry industry. Int. J. Mol. Sci. 2009, 10, 3531–3546. [Google Scholar] [CrossRef]
- Teng, P.Y.; Kim, W.K. Review: Roles of prebiotics in intestinal ecosystem of broilers. Front. Vet. Sci. 2018, 5, 245. [Google Scholar] [CrossRef]
- Ajithdoss, D.K.; Dowd, S.E.; Suchodolski, J.S. Genomics of Probiotic–Host Interactions. In Direct-Fed Microbials and Prebiotics for Animals; Springer: New York, NY, USA, 2012; pp. 35–60. [Google Scholar]
- Slawinska, A.; Plowiec, A.; Siwek, M.; Jaroszewski, M.; Bednarczyk, M. Long-Term Transcriptomic Effects of Prebiotics and Synbiotics Delivered In Ovo in Broiler Chickens. PLoS ONE 2016, 11, e0168899. [Google Scholar] [CrossRef]
- Dunislawska, A.; Slawinska, A.; Stadnicka, K.; Bednarczyk, M.; Gulewicz, P.; Jozefiak, D.; Siwek, M. Synbiotics for Broiler Chickens—In Vitro Design and Evaluation of the Influence on Host and Selected Microbiota Populations following In Ovo Delivery. PLoS ONE 2017, 12, e0168587. [Google Scholar] [CrossRef]
- Maiorano, G.; Sobolewska, A.; Cianciullo, D.; Walasik, K.; Elminowska-Wenda, G.; Slawinska, A.; Tavaniello, S.; Zylinska, J.; Bardowski, J.; Bednarczyk, M. Influence of in ovo prebiotic and synbiotic administration on meat quality of broiler chickens. Poult. Sci. 2012, 91, 2963–2969. [Google Scholar] [CrossRef]
- Pruszynska-Oszmalek, E.; Kolodziejski, P.A.; Stadnicka, K.; Sassek, M.; Chalupka, D.; Kuston, B.; Nogowski, L.; Mackowiak, P.; Maiorano, G.; Jankowski, J.; et al. In ovo injection of prebiotics and synbiotics affects the digestive potency of the pancreas in growing chickens. Poult. Sci. 2015, 94, 1909–1916. [Google Scholar] [CrossRef]
- Bogucka, J.; Dankowiakowska, A.; Elminowska-Wenda, G.; Sobolewska, A.; Szczerba, A.; Bednarczyk, M. Effects of Prebiotics and Synbiotics Delivered In Ovo on Broiler Small Intestine Histomorphology During the First Days After Hatching. Folia Biol. 2016, 64, 131–143. [Google Scholar] [CrossRef]
- Płowiec, A.; Sławińska, A.; Siwek, M.Z.; Bednarczyk, M.F. Effect of in ovo administration of inulin and Lactococcus lactis on immune-related gene expression in broiler chickens. Am. J. Vet. Res. 2015, 76, 975–982. [Google Scholar] [CrossRef] [PubMed]
- Dunislawska, A.; Slawinska, A.; Bednarczyk, M.; Siwek, M. Transcriptome modulation by in ovo delivered Lactobacillus synbiotics in a range of chicken tissues. Gene 2019, 698, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Dankowiakowska, A.; Bogucka, J.; Sobolewska, A.; Tavaniello, S.; Maiorano, G.; Bednarczyk, M. Effects of in ovo injection of prebiotics and synbiotics on the productive performance and microstructural features of the superficial pectoral muscle in broiler chickens. Poult. Sci. 2019, 98, 5157–5165. [Google Scholar] [CrossRef] [PubMed]
- Tavaniello, S.; Mucci, R.; Stadnicka, K.; Acaye, O.; Bednarczyk, M.; Maiorano, G. Effect of in ovo administration of different synbiotics on carcass and meat quality traits in broiler chickens. Poult. Sci. 2019, 98, 464–472. [Google Scholar] [CrossRef]
- Pluske, J.R.; Kim, J.C.; Black, J.L. Manipulating the immune system for pigs to optimise performance. Anim. Prod. Sci. 2018, 58, 666–680. [Google Scholar] [CrossRef]
- Bednarczyk, M.; Urbanowski, M.; Gulewicz, P.; Kasperczyk, K.; Maiorano, G.; Szwaczkowski, T. Field and in Vitro Study on Prebiotic Effect of Raffinose Family Oligosaccharides in Chickens. Bull. Vet. Inst. Pulawy 2011, 55, 465–469. [Google Scholar]
- Sibut, V.; Hennequet-Antier, C.; Le Bihan-Duval, E.; Marthey, S.; Duclos, M.J.; Berri, C. Identification of differentially expressed genes in chickens differing in muscle glycogen content and meat quality. BMC Genomics 2011, 12, 112. [Google Scholar] [CrossRef]
- De Boever, S.; Vangestel, C.; De Backer, P.; Croubels, S.; Sys, S.U. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Vet. Immunol. Immunopathol. 2008, 122, 312–317. [Google Scholar] [CrossRef]
- Sevane, N.; Bialade, F.; Velasco, S.; Rebolé, A.; Rodríguez, M.L.; Ortiz, L.T.; Cañón, J.; Dunner, S. Dietary inulin supplementation modifies significantly the liver transcriptomic profile of broiler chickens. PLoS ONE 2014, 9, e98942. [Google Scholar] [CrossRef]
- Sibut, V.; Le Bihan-Duval, E.; Tesseraud, S.; Godet, E.; Bordeau, T.; Cailleau-Audouin, E.; Chartrin, P.; Duclos, M.J.; Berri, C. Adenosine monophosphate-activated protein kinase involved in variations of muscle glycogen and breast meat quality between lean and fat chickens1. J. Anim. Sci. 2008, 86, 2888–2896. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1–research0034.11. [Google Scholar] [CrossRef] [PubMed]
- Kolodziejski, P.A.; Sassek, M.; Chalupka, D.; Leciejewska, N.; Nogowski, L.; Mackowiak, P.; Jozefiak, D.; Stadnicka, K.; Siwek, M.; Bednarczyk, M.; et al. GLP1 and GIP are involved in the action of synbiotics in broiler chickens. J. Anim. Sci. Biotechnol. 2018, 9, 13. [Google Scholar] [CrossRef] [PubMed]
- Siwek, M.; Slawinska, A.; Stadnicka, K.; Bogucka, J.; Dunislawska, A.; Bednarczyk, M. Prebiotics and synbiotics – in ovo delivery for improved lifespan condition in chicken. BMC Vet. Res. 2018, 14, 402. [Google Scholar] [CrossRef]
- Ding, S.; Wang, Y.; Yan, W.; Li, A.; Jiang, H.; Fang, J. Effects of Lactobacillus plantarum 15-1 and fructooligosaccharides on the response of broilers to pathogenic Escherichia coli O78 challenge. PLoS ONE 2019, 14, e0212079. [Google Scholar]
- Peng, Q.; Zeng, X.F.; Zhu, J.L.; Wang, S.; Liu, X.T.; Hou, C.L.; Thacker, P.A.; Qiao, S.Y. Effects of dietary Lactobacillus plantarum B1 on growth performance, intestinal microbiota, and short chain fatty acid profiles in broiler chickens. Poult. Sci. 2016, 95, 893–900. [Google Scholar] [CrossRef]
- Gao, Z.; Yin, J.; Zhang, J.; Ward, R.E.; Martin, R.J.; Lefevre, M.; Cefalu, W.T.; Ye, J. Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes 2009, 58, 1509–1517. [Google Scholar] [CrossRef]
- Maruta, H.; Yoshimura, Y.; Araki, A.; Kimoto, M.; Takahashi, Y.; Yamashita, H. Activation of AMP-Activated Protein Kinase and Stimulation of Energy Metabolism by Acetic Acid in L6 Myotube Cells. PLoS ONE 2016, 11, e0158055. [Google Scholar] [CrossRef]
- Xiong, Y.; Miyamoto, N.; Shibata, K.; Valasek, M.A.; Motoike, T.; Kedzierski, R.M.; Yanagisawa, M. Short-chain fatty acids stimulate leptin production in adipocytes through the G protein-coupled receptor GPR41. Proc. Natl. Acad. Sci. USA 2004, 101, 1045–1050. [Google Scholar] [CrossRef]
- Den Besten, G.; Van Eunen, K.; Groen, A.K.; Venema, K.; Reijngoud, D.J.; Bakker, B.M. The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. J. Lipid Res. 2013, 54, 2325–2340. [Google Scholar] [CrossRef]
- Taouis, M.; Dridi, S.; Cassy, S.; Benomar, Y.; Raver, N.; Rideau, N.; Picard, M.; Williams, J.; Gertler, A. Chicken leptin: Properties and actions. Domest. Anim. Endocrinol. 2001, 21, 319–327. [Google Scholar] [CrossRef]
- Minokoshi, Y.; Kim, Y.B.; Peroni, O.D.; Fryer, L.G.D.; Müller, C.; Carling, D.; Kahn, B.B. Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 2002, 415, 339–343. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Liu, H.; Chen, J.; Li, Y.; Qu, S. Multiple factors related to the secretion of glucagon-like peptide-1. Int. J. Endocrinol. 2015, 2015, 651757. [Google Scholar] [CrossRef] [PubMed]
- Connaughton, S.; Chowdhury, F.; Attia, R.R.; Song, S.; Zhang, Y.; Elam, M.B.; Cook, G.A.; Park, E.A. Regulation of pyruvate dehydrogenase kinase isoform 4 (PDK4) gene expression by glucocorticoids and insulin. Mol. Cell. Endocrinol. 2010, 315, 159–167. [Google Scholar] [CrossRef]
- Bosch, F.; Sabater, J.; Valera, A. Insulin Inhibits Liver Expression of the CCAAT/Enhancer-Binding Protein. Diabetes 1995, 44, 267–271. [Google Scholar] [CrossRef]
- Burwinkel, B.; Hu, B.; Schroers, A.; Clemens, P.R.; Moses, S.W.; Shin, Y.S.; Pongratz, D.; Vorgerd, M.; Kilimann, M.W. Muscle glycogenosis with low phosphorylase kinase activity: Mutations in PHKA1, PHKG1 or six other candidate genes explain only a minority of cases. Eur. J. Hum. Genet. 2003, 11, 516–526. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; McPherron, A.C. Regulation of myostatin activity and muscle growth. Proc. Natl. Acad. Sci. USA 2001, 98, 9306–9311. [Google Scholar] [CrossRef]
- Sáinz, N.; Rodríguez, A.; Catalán, V.; Becerril, S.; Ramírez, B.; Gómez-Ambrosi, J.; Frühbeck, G. Leptin administration favors muscle mass accretion by decreasing FoxO3a and increasing PGC-1α in ob/ob mice. PLoS ONE 2009, 4, e6808. [Google Scholar] [CrossRef]
- Holness, M.J.; Bulmer, K.; Gibbons, G.F.; Sugden, M.C. Up-regulation of pyruvate dehydrogenase kinase isoform 4 (PDK4) protein expression in oxidative skeletal muscle does not require the obligatory participation of peroxisome-proliferator-activated receptor α (PPARα). Biochem. J. 2002, 366, 839–846. [Google Scholar] [CrossRef]
Symbol | Gene Name | Gene ID | Description | Primer Sequence (Forward (F)/Reverse (R)) | Ref. |
---|---|---|---|---|---|
UB | Ubiquitin C | 396425 | reference gene; associated with DNA repair, protein degradation, cell cycle regulation, kinase modification, and regulation of cell signaling pathways | F: GGGATGCAGATATTCGTGAAAR: CTTGCCAGCAAAGATCAACCTT | [19] |
G6PD | Hexose-6-phosphate dehydrogenase | 428188 | reference gene; catalyzes the rate-limiting step of the oxidative pentose-phosphate pathway, provides reducing power (NADPH) and pentose phosphates for fatty acid and nucleic acid synthesis | F: CGGGAACCAAATGCACTTCGTR: GGCTGCCGTAGAGGTATGGGA | [20] |
FST | Follistatin | 396119 | binds directly to activin and functions as an activin antagonist; inhibits activin A signaling and regulates somatostatin phenotype; specific inhibitor of the biosynthesis and secretion of pituitary follicle-stimulating hormone (FSH) | F: AGGAGGACGTCAACGACAACR: TGGCAGATTCAGTTGCAAGA | [13] |
RGS2 | Regulator of G-protein signaling 2, 24 kDa | 378912 | regulates G protein-coupled receptor signaling cascades, inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form; involved in the negative regulation of the angiotensin-activated signaling pathway; plays a role in the regulation of blood pressure; binds EIF2B5 and blocks its activity | F: CTGACGCTGAAGGCAAAGAAAATCR: CAGAAACCGTGGGTACGAGTTG | [18] |
PDK4 | Pyruvate dehydrogenase kinase, isozyme 4 | 420570 | kinase that plays a key role in the regulation of glucose and fatty acid metabolism and homeostasis via phosphorylation of the pyruvate dehydrogenase subunits; it inhibits pyruvate dehydrogenase activity and thereby regulates metabolite flux through the TCA cycle, downregulates aerobic respiration, and inhibits the formation of acetyl-coenzyme A from pyruvate; regulates both fatty acid oxidation and de novo fatty acid biosynthesis | F: TGACTGGTGCATCCCAAGTAAAGR: GGAAGAATTTGCCTGTTTGGAGG | [18] |
CEBPB | CCAAT/enhancer binding protein (C/EBP), beta | 396185 | important transcriptional activator that regulates the expression of genes involved in immune and inflammatory responses; regulates the transcriptional induction of PPARγ; also plays a significant role in adipogenesis as well as in the gluconeogenic pathway, liver regeneration, and hematopoesis | F: GCAAGAACAAGCCCAAGAAGTGR: CAAGACTTTGTGCTGCGTCTCC | [18] |
PHKB | Phosphorylase kinase regulatory subunit beta | 415741 | Phosphorylase b kinase catalyzes the phosphorylation of serine in certain substrates, including troponin I; the beta chain acts as a regulatory unit and modulates the activity of the holoenzyme in response to phosphorylation; involved in the glycogen metabolism pathway | F: GCTTAACCGACGACAAATAGATGGR: CGTCATATCCGATAAGGTTGGTTG | [21] |
PRKAG3 | Protein kinase AMP-activated noncatalytic subunit gamma 3 | 424208 | AMP/ATP-binding subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism; in response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate, and lipid biosynthesis as well as cell growth and proliferation | F: CCGACAACAATTTCCAGAGCCR: TCTGCATCTTGCTGTCCCACAG | [21] |
ACSL1 | Acyl-CoA synthetase long-chain family member 1 | 422547 | catalyzes the conversion of long-chain fatty acids to their active form acyl-CoAs for both synthesis of cellular lipids and degradation via beta-oxidation; preferentially activates arachidonate than epoxyeicosatrienoic acids (EETs) or hydroxyeicosatetraenoic acids (HETEs) | F: CCTTCGCTGCATTAACACAATTCCR: CCACATTCATCATGGGGAAAAC | [18] |
ABHD5 | Abhydrolase domain containing 5 | 420673 | coenzyme A-dependent lysophosphatidic acid acyltransferase that catalyzes the transfer of an acyl group on a lysophosphatidic acid; functions in phosphatidic acid biosynthesis; may regulate the cellular storage of triacylglycerol through the activation of the phospholipase PNPLA2 | F: TTTTACCAGGGCTGGGGAATGGR: AATGCACTAATCTGCTGTGGGTG | [18] |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dunislawska, A.; Siwek, M.; Slawinska, A.; Lepczynski, A.; Herosimczyk, A.; Kolodziejski, P.A.; Bednarczyk, M. Metabolic Gene Expression in the Muscle and Blood Parameters of Broiler Chickens Stimulated In Ovo with Synbiotics. Animals 2020, 10, 687. https://doi.org/10.3390/ani10040687
Dunislawska A, Siwek M, Slawinska A, Lepczynski A, Herosimczyk A, Kolodziejski PA, Bednarczyk M. Metabolic Gene Expression in the Muscle and Blood Parameters of Broiler Chickens Stimulated In Ovo with Synbiotics. Animals. 2020; 10(4):687. https://doi.org/10.3390/ani10040687
Chicago/Turabian StyleDunislawska, Aleksandra, Maria Siwek, Anna Slawinska, Adam Lepczynski, Agnieszka Herosimczyk, Pawel A. Kolodziejski, and Marek Bednarczyk. 2020. "Metabolic Gene Expression in the Muscle and Blood Parameters of Broiler Chickens Stimulated In Ovo with Synbiotics" Animals 10, no. 4: 687. https://doi.org/10.3390/ani10040687
APA StyleDunislawska, A., Siwek, M., Slawinska, A., Lepczynski, A., Herosimczyk, A., Kolodziejski, P. A., & Bednarczyk, M. (2020). Metabolic Gene Expression in the Muscle and Blood Parameters of Broiler Chickens Stimulated In Ovo with Synbiotics. Animals, 10(4), 687. https://doi.org/10.3390/ani10040687