Prevalence, Antimicrobial Susceptibility, Virulence and Genotyping of Campylobacter jejuni with a Special Reference to the Anti-Virulence Potential of Eugenol and Beta-Resorcylic Acid on Some Multi-Drug Resistant Isolates in Egypt
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Isolation and Identification of Campylobacter jejuni
2.3. Antimicrobial Susceptibility Testing
2.4. Molecular Grouping of MDR C. jejuni Isolates
2.4.1. Extraction of DNA
2.4.2. PCR Assays and Cycling Parameters
2.5. Assessment of the Efficacy of Phytochemicals on MDR C. jejuni Strains
2.5.1. Phytochemicals
2.5.2. Determination of Subinhibitory Concentrations of the Used Phytochemicals
2.5.3. Effects of Beta-Resorcylic Acid and Eugenol on Virulence of Avian MDR C. jejuni Isolates
Evaluation of Phytochemicals’ Effects on C. jejuni Invasion of Chicken Intestinal Epithelial Cells
Evaluation of Phytochemicals’ Effects on C. jejuni Virulence Genes’ Expression by Real-Time Quantitative Reverse Transcription PCR Assay
2.6. Statistical Analysis
3. Results
3.1. Prevalence of C. jejuni in Different Samples at Sharkia Governorate, Egypt
3.2. Antimicrobial Susceptibility Tests of C. jejuni Isolates
3.3. Molecular Identification of Genus Campylobacter and C. jejuni
3.4. Molecular Investigation of Virulence-Related Genes
3.5. Genotyping and Phylogenetic Characterization of MDR C. jejuni Isolates Using ERIC-PCR Technique
3.6. The Discriminatory Power of Different Typing Methods for MDR C. jejuni Isolates
3.7. Effects of Beta-Resorcylic Acid and Eugenol on Virulence of Avian MDR C. jejuni Isolates
3.7.1. Efficacy of Sub-Inhibitory Concentrations of Beta-Resorcylic Acid and Eugenol on C. jejuni Invasion of Chicken Intestinal Cells
3.7.2. Effects of Sub-Inhibitory Concentrations of Beta-Resorcylic Acid and Eugenol on the Expression of Critical Virulence Genes Using the qRT-PCR Assay
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- EFSA, European Food Safety Authority. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2011. EFSA J. 2013, 11, 3129. [Google Scholar] [CrossRef]
- Ugarte-Ruiz, M.; Domínguez, L.; Corcionivoschi, N.; Wren, B.W.; Dorrell, N.; Gundogdu, O. Exploring the oxidative, antimicrobial and genomic properties of Campylobacter jejuni strains isolated from poultry. Res. Vet. Sci. 2018, 119, 170–175. [Google Scholar] [CrossRef] [PubMed]
- Silva, W.C.; Targino, B.N.; Gonçalves, A.G.; Silva, M.R.; Hungaro, H.M. Campylobacter: An important food safety issue. In Food Safety and Preservation; Elsevier: Cambridge, MA, USA, 2018; pp. 391–430. [Google Scholar]
- Bolton, D.J. Campylobacter virulence and survival factors. Food Microbiol. 2015, 48, 99–108. [Google Scholar] [CrossRef] [PubMed]
- García-Sánchez, L.; Melero, B.; Rovira, J. Campylobacter in the food chain. In Advances in Food and Nutrition Research; Academic Press Inc.: Cambridge, MA, USA, 2018; Volume 86, pp. 215–252. ISBN 9780128139776. [Google Scholar]
- Zhang, T.; Luo, Q.; Chen, Y.; Li, T.; Wen, G.; Zhang, R.; Luo, L.; Lu, Q.; Ai, D.; Wang, H.; et al. Molecular epidemiology, virulence determinants and antimicrobial resistance of campylobacter spreading in retail chicken meat in Central China. Gut Pathog. 2016, 8, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Bhunia, A.K. Campylobacter and arcobacter. In Foodborne Microbial Pathogens: Mechanisms and Pathogenesis; Springer: New York, NY, USA, 2018; pp. 289–299. [Google Scholar]
- Same, R.G.; Tamma, P.D. Campylobacter infections in children. Pediatrics Rev. 2018, 39, 533–541. [Google Scholar] [CrossRef]
- Hu, L.; Kopecko, D.D. Campylobacter Species. In Food Safety: Rapid Detection and Effective Prevention of Foodborne Hazards; Apple Academic Press: Palm Bay, FL, USA, 2018; pp. 55–92. [Google Scholar]
- Mouwen, D.J.M.; Weijtens, M.J.B.M.; Capita, R.; Alonso-Calleja, C.; Prieto, M. Discrimination of enterobacterial repetitive intergenic consensus PCR types of Campylobacter coli and Campylobacter jejuni by fourier transform infrared spectroscopy. Appl. Environ. Microbiol. 2005, 71, 4318–4324. [Google Scholar] [CrossRef] [Green Version]
- Malakauskas, M.; Malakauskas, A.; Christensen, H.; Olsen, J.E.; Brogren, C.H. Repetitive element sequence-based pcr typing for improved discrimination of Campylobacter jejuni. Vet. Zootech. 2017, 75, 43–53. [Google Scholar]
- EFSA, European Food Safety Authority. Analysis of the baseline survey on the prevalence of campylobacter in broiler batches and of campylobacter and salmonella on broiler carcasses, in the EU, 2008—Part B: Analysis of factors associated with campylobacter colonisation of broiler batches. EFSA J. 2010, 8. [Google Scholar] [CrossRef]
- García-Sánchez, L.; Melero, B.; Jaime, I.; Hänninen, M.L.; Rossi, M.; Rovira, J. Campylobacter jejuni survival in a poultry processing plant environment. Food Microbiol. 2017, 65, 185–192. [Google Scholar] [CrossRef]
- Georgiev, M.; Beauvais, W.; Guitian, J. Effect of enhanced biosecurity and selected on-farm factors on campylobacter colonization of chicken broilers. Epidemiol. Infect. 2017, 145, 553–567. [Google Scholar] [CrossRef] [Green Version]
- Upadhyay, A.; Arsi, K.; Wagle, B.R.; Upadhyaya, I.; Shrestha, S.; Donoghue, A.M.; Donoghue, D.J. Trans-Cinnamaldehyde, carvacrol, and eugenol reduce Campylobacter jejuni colonization factors and expression of virulence genes in vitro. Front. Microbiol. 2017, 8, 713. [Google Scholar] [CrossRef] [PubMed]
- Wagle, B.R.; Arsi, K.; Upadhyay, A.; Shrestha, S.; Venkitanarayanan, K.; Donoghue, A.M.; Donoghue, D.J. β-resorcylic acid, a phytophenolic compound, reduces Campylobacter jejuni in postharvest poultry. J. Food Prot. 2017, 80, 1243–1251. [Google Scholar] [CrossRef] [PubMed]
- Wagle, B.R.; Upadhyay, A.; Upadhyaya, I.; Shrestha, S.; Arsi, K.; Liyanage, R.; Venkitanarayanan, K.; Donoghue, D.J.; Donoghue, A.M. Trans-Cinnamaldehyde, eugenol and carvacrol reduce Campylobacter jejuni biofilms and modulate expression of select genes and proteins. Front. Microbiol. 2019, 10, 1837. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Upadhyay, A.; Upadhyaya, I.; Kollanoor-Johny, A.; Ananda Baskaran, S.; Mooyottu, S.; Karumathil, D.; Venkitanarayanan, K. Inactivation of Listeria monocytogenes on frankfurters by plant-derived antimicrobials alone or in combination with hydrogen peroxide. Int. J. Food Microbiol. 2013, 163, 114–118. [Google Scholar] [CrossRef] [PubMed]
- Mattson, T.E.; Johny, A.K.; Amalaradjou, M.A.R.; More, K.; Schreiber, D.T.; Patel, J.; Venkitanarayanan, K. Inactivation of Salmonella spp. on tomatoes by plant molecules. Int. J. Food Microbiol. 2011, 144, 464–468. [Google Scholar] [CrossRef] [PubMed]
- Food and Drug Administration (FDA). Everything Added to Food in the United States (EAFUS). Doc. No. 3045-2,4-Dihydroxybenzoic Acid. 2013. Available online: https://www.cfsanappsexternal.fda.gov/scripts/fdcc/index.cfm?set=FoodSubstances&sort=Sortterm&order=ASC&startrow=1&type=basic&search=3045 (accessed on 8 November 2020).
- Food and Drug Administration (FDA). Code of Federal Regulations Title 21 Part 172. 2012. Available online: https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfCFR/CFRSearch.cfm?.CFRPart1/4172 (accessed on 22 July 2020).
- Wagle, B.R.; Upadhyay, A.; Arsi, K.; Shrestha, S.; Venkitanarayanan, K.; Donoghue, A.M.; Donoghue, D.J. Application of β-Resorcylic acid as potential antimicrobial feed additive to reduce campylobacter colonization in broiler chickens. Front. Microbiol. 2017, 8, 599. [Google Scholar] [CrossRef] [Green Version]
- Wagle, B.R.; Upadhyay, A.; Shrestha, S.; Arsi, K.; Upadhyaya, I.; Donoghue, A.M.; Donoghue, D.J. Pectin or chitosan coating fortified with eugenol reduces Campylobacter jejuni on chicken wingettes and modulates expression of critical survival genes. Poult. Sci. 2019, 98, 1461–1471. [Google Scholar] [CrossRef]
- Blaser, M.J.; Berkowitz, I.D.; LaForce, F.M.; Cravens, J.; Reller, L.B.; Wang, W.L. Campylobacter enteritis: Clinical and epidemiologic features. Ann. Intern. Med. 1979, 91, 179–185. [Google Scholar] [CrossRef]
- On, S.L.W. Identification methods for campylobacters, helicobacters, and related organisms. Clin. Microbiol. Rev. 1996, 9, 405–422. [Google Scholar] [CrossRef]
- Bergey, D.; Krieg, N.R.; Holt, J.G. Bergey’s Manual of Systematic Bacteriology, 6th ed.; Williams & Wilkins: Baltimore, MD, USA, 1984; ISBN 9780683041088. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria; Proposed Guideline; CLSI Document M45; Clinical and Laboratory Standard Institute: Wayne, PA, USA, 2015; Volume 35. [Google Scholar]
- Clinical and Laboratory Standards Institute (CLSI). M100 Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
- Sandhu, R.; Dahiya, S.; Sayal, P. Evaluation of multiple antibiotic resistance (MAR) index and doxycycline susceptibility of Acinetobacter species among inpatients. Indian J. Microbiol. Res. 2016, 3, 299. [Google Scholar] [CrossRef]
- Versalovic, J.; Koeuth, T.; Lupski, R. Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial enomes. Nucleic Acids Res. 1991, 19, 6823–6831. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.; Clark, C.G.; Taylor, T.M.; Pucknell, C.; Barton, C.; Price, L.; Woodward, D.L.; Rodgers, F.G. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J. Clin. Microbiol. 2002, 40, 4744–4747. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bang, D.D.; Nielsen, E.M.; Scheutz, F.; Pedersen, K.; Handberg, K.; Madsen, M. PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J. Appl. Microbiol. 2003, 94, 1003–1014. [Google Scholar] [CrossRef] [PubMed]
- Datta, S.; Niwa, H.; Itoh, K. Prevalence of 11 pathogenic genes of Campylobacter jejuni by PCR in strains isolated from humans, poultry meat and broiler and bovine faeces. J. Med. Microbiol. 2003, 52, 345–348. [Google Scholar] [CrossRef] [PubMed]
- Talukder, K.A.; Aslam, M.; Islam, Z.; Azmi, I.J.; Dutta, D.K.; Hossain, S.; Nur-E-Kamal, A.; Nair, G.B.; Cravioto, A.; Sack, D.A.; et al. Prevalence of virulence genes and cytolethal distending toxin production in Campylobacter jejuni isolates from diarrheal patients in Bangladesh. J. Clin. Microbiol. 2008, 46, 1485–1488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shin, E.; Lee, Y. Comparison of three different methods for campylobacter isolation from porcine intestines. J. Microbiol. Biotechnol. 2009, 19, 647–650. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- Moroni, O.; Kheadr, E.; Boutin, Y.; Lacroix, C.; Fliss, I. Inactivation of adhesion and invasion of food-borne Listeria monocytogenes by bacteriocin-producing Bifidobacterium strains of human origin. Appl. Environ. Microbiol. 2006, 72, 6894–6901. [Google Scholar] [CrossRef] [Green Version]
- Yuan, J.S.; Reed, A.; Chen, F.; Stewart, C.N. Statistical analysis of real-time PCR data. BMC Bioinform. 2006, 7, 85. [Google Scholar] [CrossRef] [Green Version]
- Jaccard, P. The distribution of the flora in the alpine zone. New Phytol. 1912, 11, 37–50. [Google Scholar] [CrossRef]
- Hunter, P.R. Reproducibility and indices of discriminatory power of microbial typing methods. J. Clin. Microbiol. 1990, 28. [Google Scholar] [CrossRef] [Green Version]
- Hutchison, M.L.; Tchórzewska, M.A.; Harrison, D.; Madden, R.H.; Corry, J.E.L. Consequences of using two types of skin samples from chilled chicken broiler carcasses to measure the degree of contamination by Campylobacter spp. J. Food Prot. 2019, 82, 1124–1129. [Google Scholar] [CrossRef] [PubMed]
- Mohammed, A.N.; Abdel Aziz, S.A.A. The prevalence of Campylobacter species in broiler flocks and their environment: Assessing the efficiency of chitosan/zinc oxide nanocomposite for adopting control strategy. Environ. Sci. Pollut. Res. 2019, 26, 30177–30187. [Google Scholar] [CrossRef] [PubMed]
- Khalifa, N.O.; Afify, J.S.A.; Rabie, N.S. Zoonotic and molecular characterizations of Campylobacter jejuni and Campylobacter coli isolated from beef cattle and children. Glob. Vet. 2013, 11, 585–591. [Google Scholar] [CrossRef]
- Awadallah, M.; Ahmed, H.; El-Gedawy, A.; Saad, A. Molecular identification of C. jejuni and C. coli in chicken and humans, at Zagazig, Egypt, with reference to the survival of C. jejuni in chicken meat at refrigeration and freezing temperatures. Int. Food Res. J. 2014, 21, 1801–1812. [Google Scholar]
- Begum, S.; Sekar, M.; Gunaseelan, L.; Gawande, M.; Suganya, G.; Malar, P.A.S.; Karthikeyan, A. Molecular identification of Campylobacter jejuni and coli from chicken, calves and dogs to determine its potential threat on human being. Vet. World 2015, 8, 1420–1423. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, T.N.M.; Hotzel, H.; Njeru, J.; Mwituria, J.; El-Adawy, H.; Tomaso, H.; Neubauer, H.; Hafez, H.M. Antimicrobial resistance of campylobacter isolates from small scale and backyard chicken in Kenya. Gut Pathog. 2016, 8, 39. [Google Scholar] [CrossRef] [Green Version]
- Chatur, Y.A.; Brahmbhatt, M.N.; Modi, S.; Nayak, J.B. Fluoroquinolone resistance and detection of topoisomerase gene mutation in Campylobacter jejuni isolated from animal and human sources. Int. J. Curr. Microbiol. App. Sci. 2014, 3, 773–783. [Google Scholar]
- Wei, B.; Cha, S.Y.; Yoon, R.H.; Kang, M.; Roh, J.H.; Seo, H.S.; Lee, J.A.; Jang, H.K. Prevalence and antimicrobial resistance of Campylobacter spp. isolated from retail chicken and duck meat in South Korea. Food Control. 2016, 62, 63–68. [Google Scholar] [CrossRef]
- Samad, A.; Abbas, F.; Ahmed, Z.; Akbar, A.; Naeem, M.; Sadiq, M.B.; Ali, I.; Bugti, F.S.; Achakzai, S.K. Prevalence, antimicrobial susceptibility, and virulence of Campylobacter jejuni isolated from chicken meat. J. Food Saf. 2019, 39, e12600. [Google Scholar] [CrossRef]
- Zhang, T.; Dong, J.; Cheng, Y.; Lu, Q.; Luo, Q.; Wen, G.; Liu, G.; Shao, H. Genotypic diversity, antimicrobial resistance and biofilm-forming abilities of campylobacter isolated from chicken in Central China. Gut Pathog. 2017, 9, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Abd El-Aziz, N.K.; Ammar, A.M.; Hamdy, M.M.; Gobouri, A.A.; Azab, E.; Sewid, A.H. First report of aacC5-aadA7Δ4 Gene Cassette array and phage tail tape measure protein on Class 1 Integrons of Campylobacter Species isolated from animal and human sources in Egypt. Animals 2020, 10, 2067. [Google Scholar] [CrossRef] [PubMed]
- Ammar, A.M.; Abd El-Hamid, M.I.; Eid, S.E.A.; El Oksh, A.S. Insights into antimicrobial resistance and virulence genes of emergent multidrug resistant avian pathogenic Escherichia coli in Egypt: How closely related are they? Rev. Med. Vet. 2015, 166, 304–314. [Google Scholar]
- Abd El-Aziz, N.K.; Abd El-Hamid, M.I.; Bendary, M.M.; El-Azazy, A.A.; Ammar, A.M. Existence of vancomycin resistance among methicillin resistant S aurues recovered from animal and human sources in Egypt. Slov. Vet. Res. 2018, 55, 221–230. [Google Scholar] [CrossRef]
- Oh, J.Y.; Kwon, Y.K.; Wei, B.; Jang, H.K.; Lim, S.K.; Kim, C.H.; Jung, S.C.; Kang, M.S. Epidemiological relationships of Campylobacter jejuni strains isolated from humans and chickens in South Korea. J. Microbiol. 2017, 55, 13–20. [Google Scholar] [CrossRef]
- Abd El-Hamid, M.I.; Abd El-Aziz, N.K.; Samir, M.; El-Naenaeey, E.; Sayed, Y.; Abo Remela, E.M.; Mosbah, R.A.; Bendary, M.M. Genetic diversity of Campylobacter jejuni isolated from avian and human sources in Egypt. Front. Microbiol. 2019, 10. [Google Scholar] [CrossRef]
- Ahmed, H.A.; El Hofy, F.I.; Ammar, A.M.; Abd El Tawab, A.A.; Hefny, A.A. ERIC-PCR genotyping of some Campylobacter jejuni isolates of chicken and human origin in Egypt. Vector-Borne Zoonotic Dis. 2015, 15, 713–717. [Google Scholar] [CrossRef]
- Ramees, T.P.; Kumar, M.S.; Dubal, Z.B.; Sivakumar, M.; Gupta, S.; Dhama, K.; Javaid, M. Genotyping of Campylobacter jejuni and C. coli from different poultry sources and human by ERIC-PCR. J. Vet. Public Health 2015, 13, 93–98. [Google Scholar]
- Wieczorek, K.; Wolkowicz, T.; Osek, J. Antimicrobial resistance and virulence-associated traits of Campylobacter jejuni isolated from poultry food chain and humans with diarrhea. Front. Microbiol. 2018, 9. [Google Scholar] [CrossRef]
- Abd El-Hamid, M.I.; El-Sayed, M.E.; Ali, A.R.; Abdallah, H.M.; Arnaout, M.I.; El-mowalid, G.A. Marjoram extract down-regulates the expression of Pasteurella multocida adhesion, colonization and toxin genes: A potential mechanism for its antimicrobial activity. Comp. Immunol. Microbiol. Infect. Dis. 2019, 62, 101–108. [Google Scholar] [CrossRef]
- Elmowalid, G.A.; Abd El-Hamid, M.I.; Abd El-Wahab, A.M.; Atta, M.; Abd El-Naser, G.; Attia, A.M. Garlic and ginger extracts modulated broiler chicks innate immune responses and enhanced multidrug resistant Escherichia coli O78 clearance. Comp. Immunol. Microbiol. Infect. Dis. 2019, 66, 101334. [Google Scholar] [CrossRef]
- Abd El-Hamid, M.I.; El-Naenaeey, E.-S.Y.; M kandeel, T.; Hegazy, W.A.H.; Mosbah, R.A.; Nassar, M.S.; Bakhrebah, M.A.; Abdulaal, W.H.; Alhakamy, N.A.; Bendary, M.M. Promising antibiofilm agents: Recent breakthrough against biofilm producing methicillin-resistant Staphylococcus aureus. Antibiotics 2020, 9, 667. [Google Scholar] [CrossRef] [PubMed]
Antimicrobial Class | Antimicrobial Agent (Symbol) | Diameter of Inhibition Zone (mm) a | ||
---|---|---|---|---|
S | I | R | ||
Quinolones and fluoroquinolones | Nalidixic acid (NA) | ≥19 | 14–18 | ≤13 |
Ciprofloxacin (CIP) | ≥24 | 21–23 | ≤20 | |
Norfloxacin (NOR) | ≥17 | 13–16 | ≤12 | |
β—lactams | Cephalothin (KF) | ≥18 | 15–17 | ≤14 |
Ampicillin (AM) | ≥17 | 14–16 | ≤13 | |
Aminoglycosides | Gentamicin (CN) | ≥15 | 13–14 | ≤12 |
Kanamycin (K) | ≥18 | 14–17 | ≤13 | |
Macrolides | Erythromycin (E) | ≥16 | 13–15 | ≤12 |
Tetracyclines | Tetracycline (TE) | ≥26 | 23–25 | ≤22 |
Sulfonamides | Trimethoprim/sulfamethoxazole (SXT) | ≥16 | 11–15 | ≤10 |
Primer Name (Target Gene) | Primer Sequence (5’–3’) | Amplified Product (bp) | Reference |
---|---|---|---|
23 S (23S rRNA) | TATACCGGTAAGGAGTGCTGGAG | 650 | [31] |
ATCAATTAACCTTCGAGCACCG | |||
MapA (mapA) | CTATTTTATTTTTGAGTGCTTGTG | 589 | [35] |
GCTTTATTTGCCATTTGTTTTATTA | |||
FlaA (flaA) | AATAAAAATGCTGATAAAACAGGTG | 855 | [33] |
TACCGAACCAATGTCTGCTCTGATT | |||
VirB (virB11) | TCTTGTGAGTTGCCTTACCCCTTTT | 494 | |
CCTGCGTGTCCTGTGTTATTTACCC | |||
WlaN (wlaN) | TTAAGAGCAAGATATGAAGGTG | 672 | [34] |
CCATTTGAATTGATATTTTTG | |||
ERIC | ATGTAAGCTCCTGGGGATTCAC | Variable | [30] |
AAG TAAGTGACTGGGGTGAGCG |
Samples Source (No.) | Sample Type (Symbol, No) | No. of C. jejuni Isolates (%) * |
---|---|---|
Human (100) | Stool swabs (H, 100) | 30 (30) |
Broiler chicken (245) | Cloacal swabs (Ccs, 35) | 19 (54.3) |
Cecal parts (Ccp, 35) | 14 (40) | |
Neck skin (Cns, 35) | 9 (25.7) | |
Thigh meat (Ctm, 35) | 12 (34.3) | |
Breast meat (Cbm, 35) | 10 (28.6) | |
Liver (Cl, 35) | 11 (31.4) | |
Gizzard (Cg, 35) | 8 (22.9) | |
Total (345) | 113 (32.8) |
AMA | No. of C. jejuni Isolates from Different Origins Showing Antimicrobial Susceptibility Patterns (%) | ||||||||
---|---|---|---|---|---|---|---|---|---|
Human (30) | Chicken (83) | Total (113) | |||||||
R | I | S | R | I | S | R | I | S | |
AM | 30 (100) | - | 0 | 83 (100) | - | 0 | 113 (100) | - | 0 |
E | 30 (100) | - | 0 | 83 (100) | - | 0 | 113 (100) | - | 0 |
NA | 22 (73.3) | - | 8 (26.7) | 69 (83.1) | - | 14 (16.9) | 91 (80.5) | - | 22 (19.5) |
CIP | 14 (46.7) | - | 16 (53.3) | 43 (51.8) | - | 40 (48.2) | 57 (50.4) | - | 56 (49.6) |
NOR | 7 (23.3) | 5 (16.7) | 18 (60) | 16 (19.3) | 18 (21.7) | 49 (59) | 23 (20.4) | 23 (20.4) | 67 (59.3) |
KF | 23 (76.7) | 0 | 7 (23.3) | 62 (74.7) | 6 (7.2) | 15 (18.1) | 85 (75.2) | 6 (5.3) | 22 (19.5) |
CN | 8 (26.7) | 4 (13.3) | 18 (60) | 15 (18.1) | 7 (8.4) | 61 (73.5) | 23 (20.4) | 11 (9.7) | 79 (69.9) |
K | 3 (10) | 12 (40) | 15 (50) | 5 (6) | 17 (20.5) | 61 (73.5) | 8 (7.1) | 29 (25.7) | 76 (67.3) |
TE | 26 (86.7) | 1 (3.3) | 3 (10) | 76 (91.6) | 1 (1.2) | 6 (7.2) | 102 (90.3) | 2 (1.8) | 9 (8) |
SXT | 27 (90) | - | 3 (10) | 66 (79.5) | - | 17 (20.5) | 93 (82.3) | - | 20 (17.7) |
MAR Index | No. of Antimicrobial Agents to Which C. jejuni Were Resistant | No. of Resistant C. jejuni Isolates from Different Origins (%) | ||
---|---|---|---|---|
Human (30) | Chicken (83) | Total (113) | ||
0.3 | 3 | 0 | 1 (1.2) | 1 (0.9) |
0.4 | 4 | 0 | 3 (3.6) | 3 (2.7) |
0.5 | 5 | 7 (23.3) | 17 (20.5) | 24 (21.2) |
0.6 | 6 | 15 (50) | 35 (42.2) | 50 (44.2) |
0.7 | 7 | 0 (0) | 10 (12) | 10 (8.8) |
0.8 | 8 | 7 (23.3) | 15 (18.1) | 22 (19.5) |
0.9 | 9 | 1 (3.3) | 2 (2.4) | 3 (2.7) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ammar, A.M.; El-Naenaeey, E.-S.Y.; El-Malt, R.M.S.; El-Gedawy, A.A.; Khalifa, E.; Elnahriry, S.S.; Abd El-Hamid, M.I. Prevalence, Antimicrobial Susceptibility, Virulence and Genotyping of Campylobacter jejuni with a Special Reference to the Anti-Virulence Potential of Eugenol and Beta-Resorcylic Acid on Some Multi-Drug Resistant Isolates in Egypt. Animals 2021, 11, 3. https://doi.org/10.3390/ani11010003
Ammar AM, El-Naenaeey E-SY, El-Malt RMS, El-Gedawy AA, Khalifa E, Elnahriry SS, Abd El-Hamid MI. Prevalence, Antimicrobial Susceptibility, Virulence and Genotyping of Campylobacter jejuni with a Special Reference to the Anti-Virulence Potential of Eugenol and Beta-Resorcylic Acid on Some Multi-Drug Resistant Isolates in Egypt. Animals. 2021; 11(1):3. https://doi.org/10.3390/ani11010003
Chicago/Turabian StyleAmmar, Ahmed M., El-Sayed Y. El-Naenaeey, Rania M. S. El-Malt, Attia A. El-Gedawy, Eman Khalifa, Shimaa S. Elnahriry, and Marwa I. Abd El-Hamid. 2021. "Prevalence, Antimicrobial Susceptibility, Virulence and Genotyping of Campylobacter jejuni with a Special Reference to the Anti-Virulence Potential of Eugenol and Beta-Resorcylic Acid on Some Multi-Drug Resistant Isolates in Egypt" Animals 11, no. 1: 3. https://doi.org/10.3390/ani11010003