Effect of Neudesin Neurotrophic Factor on Differentiation of Bovine Preadipocytes and Myoblasts in a Co-Culture System
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Source
2.2. Isolation and Culture of Bovine Myoblasts and Preadipocytes
2.3. Establishment of a Co-Culture System
2.4. Detection of Differentiation of Preadipocytes and Myoblasts
2.5. Real-Time Quantitative PCR (RT-qPCR)
2.6. Western Blot Analysis
3. Results
3.1. Determination of the Optimal Concentration of NENF Recombinant Protein
3.2. Exogenous Addition of NENF Recombinant Protein Inhibits the Differentiation of Preadipocytes in Co-Culture System
3.3. Exogenous Addition of NENF Had no Significant Effect on the Differentiation of Myoblasts in Co-Culture System.
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, X.Z.; Yan, C.G.; Zan, L.S. Current situation and future prospects for beef production in China–A review. Asian-Australas. J. Anim. Sci. 2018, 31, 984–991. [Google Scholar] [CrossRef]
- Zhou, G.; Zhang, W.; Xu, X. China’s meat industry revolution: Challenges and opportunities for the future. Meat Sci. 2012, 92, 188–196. [Google Scholar] [CrossRef] [PubMed]
- Poleti, M.D.; Regitano, L.; Souza, G.; Cesar, A.; Simas, R.C.; Silva-Vignato, B.; Oliveira, G.B.; Andrade, S.; Cameron, L.C.; Coutinho, L.L. Longissimus dorsi muscle label-free quantitative proteomic reveals biological mechanisms associated with intramuscular fat deposition. J. Proteom. 2018, 179, 30–41. [Google Scholar] [CrossRef]
- Harwood, H.J., Jr. The adipocyte as an endocrine organ in the regulation of metabolic homeostasis. Neuropharmacology 2012, 63, 57–75. [Google Scholar] [CrossRef] [PubMed]
- Conde, J.; Scotece, M.; Gómez, R.; López, V.; Gómez-Reino, J.J.; Lago, F.; Gualillo, O. Adipokines: Biofactors from white adipose tissue. A complex hub among inflammation, metabolism, and immunity. BioFactors 2011, 37, 413–420. [Google Scholar] [CrossRef]
- Tersigni, C.; Di Nicuolo, F.; D’Ippolito, S.; Veglia, M.; Castellucci, M.; Di Simone, N. Adipokines: New emerging roles in fertility and reproduction. Obstet. Gynecol. Surv. 2011, 66, 47–63. [Google Scholar] [CrossRef] [PubMed]
- Han, K.H.; Lee, S.H.; Ha, S.A.; Kim, H.J.; Lee, C.; Kim, D.; Gong, K.H.; Yoo, J.; Kim, S.; Kim, J.W. The functional and structural characterization of a novel oncogene GIG47 involved in the breast tumorigenesis. BMC Cancer 2012, 12, 274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimura, I.; Konishi, M.; Asaki, T.; Furukawa, N.; Ukai, K.; Mori, M.; Hirasawa, A.; Tsujimoto, G.; Ohta, M.; Itoh, N.; et al. Neudesin, an extracellular heme-binding protein, suppresses adipogenesis in 3T3-L1 cells via the MAPK cascade. Biochem. Biophys. Res. Commun. 2009, 381, 75–80. [Google Scholar] [CrossRef]
- Kimura, I.; Nakayama, Y.; Konishi, M.; Terasawa, K.; Ohta, M.; Itoh, N.; Fujimoto, M. Functions of MAPR (membrane-associated progesterone receptor) family members as heme/steroid-binding proteins. Curr. Protein. Pept. Sci. 2012, 13, 687–696. [Google Scholar] [CrossRef] [Green Version]
- Tentolouris, N.; Liatis, S.; Katsilambros, N. Sympathetic system activity in obesity and metabolic syndrome. Ann. N. Y. Acad. Sci. 2006, 1083, 129–152. [Google Scholar] [CrossRef]
- Ohta, H.; Konishi, M.; Kobayashi, Y.; Kashio, A.; Mochiyama, T.; Matsumura, S.; Inoue, K.; Fushiki, T.; Nakao, K.; Kimura, I.; et al. Deletion of the Neurotrophic Factor neudesin Prevents Diet-induced Obesity by Increased Sympathetic Activity. Sci. Rep. 2015, 5, 10049. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kimura, I.; Yoshioka, M.; Konishi, M.; Miyake, A.; Itoh, N. Neudesin, a novel secreted protein with a unique primary structure and neurotrophic activity. Neurosci. Res. 2005, 79, 287–294. [Google Scholar] [CrossRef] [PubMed]
- Kimura, I.; Konishi, M.; Miyake, A.; Fujimoto, M.; Itoh, N. Neudesin, a secreted factor, promotes neural cell proliferation and neuronal differentiation in mouse neural precursor cells. J. Neurosci. Res. 2006, 83, 1415–1424. [Google Scholar] [CrossRef] [PubMed]
- Kimura, I.; Nakayama, Y.; Yamauchi, H.; Konishi, M.; Miyake, A.; Mori, M.; Ohta, M.; Itoh, N.; Fujimoto, M. Neurotrophic activity of neudesin, a novel extracellular heme-binding protein, is dependent on the binding of heme to its cytochrome b5-like heme/steroid-binding domain. J. Biol. Chem. 2008, 283, 4323–4331. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Byerly, M.S.; Swanson, R.D.; Semsarzadeh, N.N.; McCulloh, P.S.; Kwon, K.; Aja, S.; Moran, T.H.; Wong, G.W.; Blackshaw, S. Identification of hypothalamic neuron-derived neurotrophic factor as a novel factor modulating appetite. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 304, R1085–R1095. [Google Scholar] [CrossRef] [Green Version]
- Novais, A.; Ferreira, A.C.; Marques, F.; Pêgo, J.M.; Cerqueira, J.J.; David-Pereira, A.; Campos, F.L.; Dalla, C.; Kokras, N.; Sousa, N.; et al. Neudesin is involved in anxiety behavior: Structural and neurochemical correlates. Front. Behav. Neurosci. 2013, 7, 119. [Google Scholar] [CrossRef] [Green Version]
- Stefanska, B.; Cheishvili, D.; Suderman, M.; Arakelian, A.; Huang, J.; Hallett, M.; Han, Z.G.; Al-Mahtab, M.; Akbar, S.M.; Khan, W.A.; et al. Genome-wide study of hypomethylated and induced genes in patients with liver cancer unravels novel anticancer targets. Clin. Cancer Res. 2014, 20, 3118–3132. [Google Scholar] [CrossRef] [Green Version]
- Rosen, E.D.; Spiegelman, B.M. What we talk about when we talk about fat. Cell 2014, 156, 20–44. [Google Scholar] [CrossRef] [Green Version]
- Pandurangan, M.; Jeong, D.; Amna, T.; Van Ba, H.; Hwang, I. Co-culture of C2C12 and 3T3-L1 preadipocyte cells alters the gene expression of calpains, caspases and heat shock proteins. Vitr. Cell. Dev. Biol. Anim. 2012, 48, 577–582. [Google Scholar] [CrossRef]
- Dodson, M.V.; Vierck, J.L.; Hossner, K.L.; Byrne, K.; McNamara, J.P. The development and utility of a defined muscle and fat co-culture system. Tissue Cell 1997, 29, 517–524. [Google Scholar] [CrossRef]
- Pandurangan, M.; Hwang, I. Application of cell co-culture system to study fat and muscle cells. Appl. Microbiol. Biotechnol. 2014, 98, 7359–7364. [Google Scholar] [CrossRef] [PubMed]
- Kokta, T.A.; Dodson, M.V.; Gertler, A.; Hill, R.A. Intercellular signaling between adipose tissue and muscle tissue. Domest. Anim. Endocrinol. 2004, 27, 303–331. [Google Scholar] [CrossRef] [PubMed]
- Martinez, K.; Kennedy, A.; West, T.; Milatovic, D.; Aschner, M.; McIntosh, M. trans-10, cis-12-Conjugated linoleic acid instigates inflammation in human adipocytes compared with preadipocytes. J. Biol. Chem. 2010, 285, 17701–17712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choi, S.H.; Chung, K.Y.; Johnson, B.J.; Go, G.W.; Kim, K.H.; Choi, C.W.; Smith, S.B. Co-culture of bovine muscle satellite cells with preadipocytes increases PPARγ and C/EBPβ gene expression in differentiated myoblasts and increases GPR43 gene expression in adipocytes. J. Nutr. Biochem. 2013, 24, 539–543. [Google Scholar] [CrossRef] [PubMed]
- Seo, K.; Suzuki, T.; Kobayashi, K.; Nishimura, T. Adipocytes suppress differentiation of muscle cells in a co-culture system. Anim. Sci. J. 2019, 90, 423–434. [Google Scholar] [CrossRef]
- Su, X.; Wang, Y.; Li, A.; Zan, L.; Wang, H. Neudesin Neurotrophic Factor Promotes Bovine Preadipocyte Differentiation and Inhibits Myoblast Myogenesis. Animals 2019, 9, 1109. [Google Scholar] [CrossRef] [Green Version]
- Meissburger, B.; Perdikari, A.; Moest, H.; Müller, S.; Geiger, M.; Wolfrum, C. Regulation of adipogenesis by paracrine factors from adipose stromal-vascular fraction - a link to fat depot-specific differences. Biochim. Biophys. Acta 2016, 1861, 1121–1131. [Google Scholar] [CrossRef] [Green Version]
- Li, P.; Wang, Y.; Zhang, L.; Ning, Y.; Zan, L. The Expression Pattern of PLIN2 in Differentiated Adipocytes from Qinchuan Cattle Analysis of Its Protein Structure and Interaction with CGI-58. Int. J. Mol. Sci. 2018, 19, 1336. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.N.; Yang, W.C.; Li, P.W.; Wang, H.B.; Zhang, Y.Y.; Zan, L.S. Myocyte enhancer factor 2A promotes proliferation and its inhibition attenuates myogenic differentiation via myozenin 2 in bovine skeletal muscle myoblast. PLoS ONE 2018, 13, e0196255. [Google Scholar] [CrossRef]
- Mizoguchi, Y.; Hirano, T.; Itoh, T.; Aso, H.; Takasuga, A.; Sugimoto, Y.; Watanabe, T. Differentially expressed genes during bovine intramuscular adipocyte differentiation profiled by serial analysis of gene expression. Anim. Genet. 2010, 41, 436–441. [Google Scholar] [CrossRef]
- Mizoguchi, Y.; Moriya, M.; Taniguchi, D.; Hasegawa, A. Effect of retinoic acid on gene expression profiles of bovine intramuscular preadipocytes during adipogenesis. Anim. Sci. J. 2014, 85, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Rønning, S.B.; Pedersen, M.E.; Andersen, P.V.; Hollung, K. The combination of glycosaminoglycans and fibrous proteins improves cell proliferation and early differentiation of bovine primary skeletal muscle cells. Differentiation 2013, 86, 13–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cruz, G.D.; Strathe, A.B.; Rossow, H.A.; Fadel, J.G. Characterizing bovine adipocyte distribution and its relationship with carcass and meat characteristics using a finite mixture model. J. Anim. Sci. 2012, 90, 2995–3002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hausman, G.J.; Poulos, S.P. A method to establish co-cultures of myotubes and preadipocytes from collagenase digested neonatal pig semitendinosus muscles. J. Anim. Sci. 2005, 83, 1010–1016. [Google Scholar] [CrossRef]
Gene Name | Accession Numbers | Primer Sequence (5′–3′) | Fragments Size (bp) |
---|---|---|---|
β-actin | NM_173979 | Forward: TCTAGGCGGACTGTTAGC | 82 |
Reverse: CCATGCCAATCTCATCTCG | |||
GAPDH | NM_001034034 | Forward: AGTTCAACGGCACAGTCAAGG | 124 |
Reverse: ACCACATACTCAGCACCAGCA | |||
PPARγ | NM_181024 | Forward: TGAAGAGCCTTCCAACTCCC | 117 |
Reverse: GTCCTCCGGAAGAAACCCTTG | |||
CEBPα | NM_176784 | Forward: ATCTGCGAACACGAGACG | 73 |
Reverse: CCAGGAACTCGTCGTTGAA | |||
SCD1 | NM_173959 | Forward: TCCGACCTAAGAGCCGAGAA | 200 |
Reverse: TGGGCAGCACTATTCACCAG | |||
FASN | NM_001012669 | Forward: GGCAAACGGAAAAACGGTGA | 183 |
Reverse: CTTGGTATTCCGGGTCCGAG | |||
FABP4 | NM_174314 | Forward: TGAGATTTCCTTCAAATTGGG | 101 |
Reverse: CTTGTACCAGAGCACCTTCATC | |||
MYOD1 | NM_001040478 | Forward: AACCCCAACCCGATTTACC | 196 |
Reverse: CACAACAGTTCCTTCGCCTCT | |||
MYOG | NM_001111325 | Forward: GGCGTGTAAGGTGTGTAAG | 85 |
Reverse: CTTCTTGAGTCTGCGCTTCT | |||
MYH3 | NM_001101835.1 | Forward: AAATGAGGGATGACCGCCTG | 205 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, A.; Su, X.; Wang, Y.; Cheng, G.; Zan, L.; Wang, H. Effect of Neudesin Neurotrophic Factor on Differentiation of Bovine Preadipocytes and Myoblasts in a Co-Culture System. Animals 2021, 11, 34. https://doi.org/10.3390/ani11010034
Li A, Su X, Wang Y, Cheng G, Zan L, Wang H. Effect of Neudesin Neurotrophic Factor on Differentiation of Bovine Preadipocytes and Myoblasts in a Co-Culture System. Animals. 2021; 11(1):34. https://doi.org/10.3390/ani11010034
Chicago/Turabian StyleLi, Anqi, Xiaotong Su, Yaning Wang, Gong Cheng, Linsen Zan, and Hongbao Wang. 2021. "Effect of Neudesin Neurotrophic Factor on Differentiation of Bovine Preadipocytes and Myoblasts in a Co-Culture System" Animals 11, no. 1: 34. https://doi.org/10.3390/ani11010034