Investigation of Three Newly Identified Equine Parvoviruses in Blood and Nasal Fluid Samples of Clinically Healthy Horses and Horses with Acute Onset of Respiratory Disease
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population and Sampling
2.2. DNA Purification and Quantitative PCR Analyses
2.3. Statistical Analyses
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Traub-Dargatz, J.L.; Salman, M.D.; Voss, J.L. Medical problems of adult horses, as ranked by equine practitioners. J. Am. Vet. Med. Assoc. 1991, 198, 1745–1747. [Google Scholar] [PubMed]
- Pusterla, N.; Kass, P.H.; Mapes, S.; Johnson, C.; Barnett, D.C.; Vaala, W.; Gutierrez, C.; McDaniel, R.; Whitehead, B.; Manning, J. Surveillance programme for important equine infectious respiratory pathogens in the USA. Vet. Rec. 2011, 169, 12. [Google Scholar] [CrossRef] [PubMed]
- Burrows, R.; Goodridge, D.; Denyer, M.; Hutchings, G.; Frank, C.J. Equine influenza infections in Great Britain. 1979. Vet. Rec. 1982, 110, 494–497. [Google Scholar] [CrossRef] [PubMed]
- Mumford, E.L.; Traub-Dargatz, J.L.; Salman, M.D.; Collins, J.K.; Getzy, D.; Carman, J. Monitoring and detection of acute viral respiratory tract disease in horses. J. Am. Vet. Med. Assoc. 1998, 213, 385–390. [Google Scholar]
- Mumford, E.L.; Traub-Dargatz, J.L.; Carman, J.; Callan, R.J.; Collins, J.K.; Goltz, K.L.; Romm, S.R.; Tarr, S.F.; Salman, M.D. Occurrence of infectious upper respiratory tract disease and response to vaccination in horses on six sentinel premises in northern Colorado. Equine Vet. J. 2003, 35, 72–77. [Google Scholar] [CrossRef]
- Chiu, C.Y. Viral pathogen discovery. Curr. Opin. Microbiol. 2013, 16, 468–478. [Google Scholar] [CrossRef] [Green Version]
- Chiu, C.Y.; Miller, S.A. Clinical metagenomics. Nat. Rev. Genet. 2019, 20, 341–355. [Google Scholar] [CrossRef]
- Breitwieser, F.P.; Lu, J.; Salzberg, S.L. A review of methods and databases for metagenomic classification and assembly. Brief Bioinform. 2019, 20, 1125–1136. [Google Scholar] [CrossRef]
- Li, L.; Giannitti, F.; Low, J.; Keyes, C.; Ullmann, L.S.; Deng, X.; Aleman, M.; Pesavento, P.A.; Pusterla, N.; Delwart, E. Exploring the virome of diseased horses. J. Gen. Virol. 2015, 96, 2721–2723. [Google Scholar] [CrossRef] [Green Version]
- Altan, E.; Li, Y.; Sabino-Santos, G., Jr.; Sawaswong, V.; Barnum, S.; Pusterla, N.; Deng, X.; Delwart, E. Viruses in horses with neurologic and respiratory diseases. Viruses 2019, 11, 942. [Google Scholar] [CrossRef] [Green Version]
- Pusterla, N.; Mapes, S.; Wademan, C.; White, A.; Hodzic, E. Investigation of the role of lesser characterised respiratory viruses associated with upper respiratory tract infections in horses. Vet. Rec. 2013, 172, 315. [Google Scholar] [CrossRef]
- Divers, T.J.; Tennant, B.C.; Kumar, A.; McDonough, S.; Cullen, J.; Bhuva, N.; Jain, K.; Chauhan, L.S.; Scheel, T.K.H.; Lipkin, W.I.; et al. New parvovirus associated with serum hepatitis in horses after inoculation of common biological product. Emerg. Infect. Dis. 2018, 24, 303–310. [Google Scholar] [CrossRef]
- Tomlinson, J.E.; Tennant, B.C.; Struzyna, A.; Mrad, D.; Browne, N.; Whelchel, D.; Johnson, P.J.; Jamieson, C.; Löhr, C.V.; Bildfell, R.; et al. Viral testing of 10 cases of Theiler’s disease and 37 in-contact horses in the absence of equine biologic product administration: A prospective study (2014–2018). J. Vet. Intern. Med. 2019, 33, 258–265. [Google Scholar] [CrossRef] [PubMed]
- Tomlinson, J.E.; Kapoor, A.; Kumar, A.; Tennant, B.C.; Laverack, M.A.; Beard, L.; Delph, K.; Davis, E.; Schott Ii, H.; Lascola, K.; et al. Viral testing of 18 consecutive cases of equine serum hepatitis: A prospective study (2014–2018). J. Vet. Intern. Med. 2019, 33, 251–257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tomlinson, J.E.; Jager, M.; Struzyna, A.; Laverack, M.; Fortier, L.A.; Dubovi, E.; Foil, L.D.; Burbelo, P.D.; Divers, T.J.; Van de Walle, G.R. Tropism, pathology, and transmission of equine parvovirus-hepatitis. Emerg. Microbes Infect. 2020, 9, 651–663. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramsauer, A.S.; Badenhorst, M.; Cavalleri, J.V. Equine parvovirus hepatitis. Equine Vet. J. 2021, 53, 886–894. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Tong, P.; Zhang, A.; Song, X.; Zhang, L.; Shaya, N.; Kuang, L. An emerging equine parvovirus circulates in thoroughbred horses in north Xinjiang, China, 2018. Transbound. Emerg. Dis. 2020, 67, 1052–1056. [Google Scholar] [CrossRef] [PubMed]
- Badenhorst, M.; de Heus, P.; Auer, A.; Tegtmeyer, B.; Stang, A.; Dimmel, K.; Tichy, A.; Kubacki, J.; Bachofen, C.; Steinmann, E.; et al. Active equine parvovirus-hepatitis infection is most frequently detected in Austrian horses of advanced age. Equine Vet. J. 2021. [Google Scholar] [CrossRef] [PubMed]
- Meister, T.L.; Tegtmeyer, B.; Brüggemann, Y.; Sieme, H.; Feige, K.; Todt, D.; Stang, A.; Cavalleri, J.V.; Steinmann, E. Characterization of equine parvovirus in thoroughbred breeding horses from Germany. Viruses 2019, 11, 965. [Google Scholar] [CrossRef] [Green Version]
- Lu, G.; Sun, L.; Ou, J.; Xu, H.; Wu, L.; Li, S. Identification and genetic characterization of a novel parvovirus associated with serum hepatitis in horses in China. Emerg. Microbes Infect. 2018, 7, 170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, G.; Wu, L.; Ou, J.; Li, S. Equine parvovirus-hepatitis in China: Characterization of its genetic diversity and evidence for natural recombination events between the Chinese and American strains. Front. Vet. Sci. 2020, 7, 121. [Google Scholar] [CrossRef] [PubMed]
- Altan, E.; Hui, A.; Li, Y.; Pesavento, P.; Asín, J.; Crossley, B.; Deng, X.; Uzal, F.A.; Delwart, E. New parvoviruses and picornavirus in tissues and feces of foals with interstitial pneumonia. Viruses 2021, 13, 1612. [Google Scholar] [CrossRef] [PubMed]
Equine Parvovirus | Target Gene (GenBank) | Oligonucleotides |
---|---|---|
EqPV-H | Capsid protein | EqPV-H-forward primer: AGAATGCAGATGCTTTCCGAC |
(MH500792) | EqPV-H-reverse primer: AAAGCAGATCCCGAATCCG | |
EqPV-H-probe: FAM-GAAGATTCATGAGCTAGTC-MGB | ||
EqPV-CSF | Capsid VP1 | EqPV-CSF-forward primer: AAGGCTTTGGACAAACGGG |
(KR902500) | EqPV-CSF-reverse primer: TTGTTAGCACATGCGTTCCC | |
EqPV-CSF-probe: FAM-AAGGGATATGGAAGGGA-MGB | ||
Eqcopivirus | NS1 | EqCopi-forward primer: TCGCCCAGATCGTTGAGAAC |
(MN181468) | EqCopi-reverse primer: AGCTGCTGTCTCCTGTTGTCC | |
EqCopi-probe: FAM-ACCCAATCACCGAAGC-MGB |
Pathogen | Sick Equids (667) | Clinically Healthy Horses (87) | ||
---|---|---|---|---|
Nasal Fluid | Blood | Nasal Fluid | Blood | |
EIV | 81 (12.1%) | Not tested | 0 | Not tested |
S. equi | 61 (9.1%) | Not tested | 0 | Not tested |
EHV-4 | 50 (7.5%) | Not tested | 0 | Not tested |
ERVs | 36 (5.4%) | Not tested | 0 | Not tested |
EHV-1 | 13 (1.9%) | 4 (0.6%) | 0 | 0 |
EqPV-H | 8 (1.2%) | 46 (6.9%) | 1 (1.1%) | 5 (5.7%) |
EqPV-CSF | 8 (1.2%) | 32 (4.8%) | 0 | 1 (1.1%) |
Eqcopivirus | 35 (5.2%) | 49 (7.3%) | 2 (2.3%) | 4 (4.6%) |
Pathogen | Demographic | Clinical Signs | |||
---|---|---|---|---|---|
Age Range in Years (Median) | Sex Distribution (Male/Female) | Rectal Temperature Range in °C (Median) | Nasal Discharge (%) | Coughing (%) | |
EHV-1 (9) | 1–12 (5) | 5/4 | 38.8–40.9 (39.8) | 6/9 (66.7) | 2/9 (22.2) |
EHV-4 (35) | 1–23 (4) | 20/15 | 38.6–40.9 (39.6) | 24/35 (68.6) | 12/35 (34.3) |
EIV (61) | 1–22 (8) | 28/33 | 38.6–41.1 (39.3) | 55/61 (90.2) | 55/61 (90.2) |
ERVs (17) | 1–25 (3) | 9/8 | 38.6–40.8 (39.4) | 13/17 (76.5) | 10/17 (58.8) |
S. equi (37) | 2–22 (7) | 23/14 | 38.7–41.0 (39.4) | 31/37 (83.8) | 16/37 (43.2) |
Eqcopivirus (31) | 1–30 (8.5) | 16/15 | 38.1–41.4 (39.4) | 20/31 (64.5) | 14/31 (45.2) |
EqPV-H (18) | 1–30 (10) | 11/7 | 38.0–40.6 (39.4) | 11/18 (61.1) | 8/18 (44.4) |
EqPV-CSF (13) | 1–26 (15) | 8/5 | 36.9–40.0 (39.3) | 8/13 (61.5) | 7/13 (53.8) |
Negative (376) | 1–34 (9) | 206/170 | 37.2–41.2 (39.4) | 262/376 (69.7) | 137/376 (36.4) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pusterla, N.; James, K.; Barnum, S.; Delwart, E. Investigation of Three Newly Identified Equine Parvoviruses in Blood and Nasal Fluid Samples of Clinically Healthy Horses and Horses with Acute Onset of Respiratory Disease. Animals 2021, 11, 3006. https://doi.org/10.3390/ani11103006
Pusterla N, James K, Barnum S, Delwart E. Investigation of Three Newly Identified Equine Parvoviruses in Blood and Nasal Fluid Samples of Clinically Healthy Horses and Horses with Acute Onset of Respiratory Disease. Animals. 2021; 11(10):3006. https://doi.org/10.3390/ani11103006
Chicago/Turabian StylePusterla, Nicola, Kaitlyn James, Samantha Barnum, and Eric Delwart. 2021. "Investigation of Three Newly Identified Equine Parvoviruses in Blood and Nasal Fluid Samples of Clinically Healthy Horses and Horses with Acute Onset of Respiratory Disease" Animals 11, no. 10: 3006. https://doi.org/10.3390/ani11103006