Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Test Materials and Reagents
2.2. Cell Culture
2.3. Construction of the Overexpression Vector and Design of Interference Fragments
2.4. Transfection
2.5. M. hyopneumoniae Infection of PAM 3D4/21 Cells
2.6. Real-Time Fluorescence Quantitative PCR
2.7. Western Blot
2.8. Enzyme-Linked Immunosorbent Assay ELISA
2.9. Statistical Analysis
3. Results
3.1. M. hyopneumoniae Infection Promoted the Expression of IL-6 and IL-8 in PAM 3D4/21 Cells
3.2. M. hyopneumoniae Infection Increased the Expression of CYP3A29 and PXR in PAM 3D4/21 Cells
3.3. PXR Regulates the Expression of CYP3A29 during M. hyopneumoniae Infection of PAM 3D4/21 Cells
3.3.1. Identification and Validation of the pcDNA3.1-PXR Recombinant Plasmid and Efficiency of PXR Overexpression and Interference
3.3.2. PXR can Promote CYP3A29 Expression during M. hyopneumoniae Infection
3.4. PXR can Promote the Expression of IL-6 and IL-8 during M. hyopneumoniae Infection
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pieters, M.G.; Maes, D. Diseases of Swine. In Mycoplasmosis, 11th ed.; Zimmerman, J., Karriker, L., Eds.; Wiley: Hoboken, NJ, USA, 2019; Volume 56, pp. 863–883. [Google Scholar]
- Silva, G.S.; Yeske, P.; Morrison, R.B.; Linhares, D.C.L. Benefit-cost analysis to estimate the payback time and the economic value of two Mycoplasma hyopneumoniae elimination methods in breeding herds. Prev. Vet. Med. 2019, 168, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Holst, S.; Yeske, P.; Pieters, M. Elimination of Mycoplasma hyopneumoniae from breed-to-wean farms: A review of current protocols with emphasis on herd closure and medication. J. Swine Health Prod. 2015, 23, 321–330. [Google Scholar]
- Maes, D.; Sibila, M.; Kuhnert, P.; Vergara-Alert, J.; Haesebrouck, F.; Pieters, M. Update onMycoplasma hyopneumoniaeinfections in pigs: Knowledge gaps for improved disease control. Transbound. Emerg. Dis. 2017, 65, 110–124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nissen, P.H.; Winterø, A.K.; Fredholm, M. Mapping of porcine genes belonging to two different cytochrome P450 subfamilies. Anim. Genet. 1998, 29, 7–11. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Zhou, X.; Li, X.; Jin, X.; Wang, X.; Pan, X.; Bi, D. Relationship between CYP3A29 and pregnane X receptor in landrace pigs: Pig CYP3A29 has a similar mechanism of regulation to human CYP3A4. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2018, 214, 9–16. [Google Scholar] [CrossRef]
- Kim, S.; Östör, A.J.K.; Nisar, M.K. Interleukin-6 and cytochrome-P450, reason for concern? Rheumatol. Int. 2012, 32, 2601–2604. [Google Scholar] [CrossRef] [PubMed]
- Jover, R.; Bort, R.; Gómez-Lechón, M.J.; Castell, J.V. Down-regulation of human CYP3A4 by the inflammatory signal interleukin 6: Molecular mechanism and transcription factors involved. FASEB J. 2002, 16, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Zhao, W.; Fu, Y.; Tu, F.; Li, B.; Wang, X.; Zhao, F.; Ren, S. Difference in susceptibility to mycoplasma pneumonia among various pig breeds and its molecular genetic basis. Agric. Sci. China 2015, 48, 2839–2847. [Google Scholar] [CrossRef]
- Tsai, N.-C.; Ray, A. Stochastic optimal control under randomly varying distributed delays. Int. J. Control. 1997, 68, 1179–1202. [Google Scholar] [CrossRef]
- Kast, H.R.; Goodwin, B.; Tarr, P.T.; Jones, S.A.; Anisfeld, A.M.; Stoltz, C.M.; Tontonoz, P.; Kliewer, S.; Willson, T.M.; Edwards, P.A. Regulation of Multidrug Resistance-associated Protein 2 (ABCC2) by the Nuclear Receptors Pregnane X Receptor, Farnesoid X-activated Receptor, and Constitutive Androstane Receptor. J. Biol. Chem. 2002, 277, 2908–2915. [Google Scholar] [CrossRef] [Green Version]
- Li, L.; Stanton, J.D.; Tolson, A.H.; Luo, Y.; Wang, H. Bioactive Terpenoids and Flavonoids from Ginkgo Biloba Extract Induce the Expression of Hepatic Drug-Metabolizing Enzymes Through Pregnane X Receptor, Constitutive Androstane Receptor, and Aryl hydrocarbon Receptor-Mediated Pathways. Pharm. Res. 2008, 26, 872–882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rathod, V.; Jain, S.; Nandekar, P.P.; Sangamwar, A.T. Human pregnane X receptor: A novel target for anticancer drug development. Drug Discov. Today 2014, 19, 63–70. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Jin, X.; Zhou, X.; Wang, X.; Shi, D.; Xiao, Y.; Bi, D. Pregnane X receptor is required for IFN-α-mediated CYP3A29 expression in pigs. Biochem. Biophys. Res. Commun. 2014, 445, 469–474. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Hu, X.; Jin, X.; Zhou, X.; Wang, X.; Shi, D.; Bi, D. IFN-γregulates cytochrome 3A29 through pregnane X receptor in pigs. Xenobiotica 2014, 45, 373–379. [Google Scholar] [CrossRef] [PubMed]
- Damte, D.; Lee, S.-J.; Hwang, M.-H.; Gebru, E.; Choi, M.-J.; Lee, J.-S.; Cheng, H.; Park, S.-C. Inflammatory responses toMycoplasma hyopneumoniaein murine alveolar macrophage cell lines. N. Z. Vet. J. 2011, 59, 185–190. [Google Scholar] [CrossRef]
- Bai, F.; Ni, B.; Liu, M.; Feng, Z.; Xiong, Q.; Xiao, S.; Shao, G. Mycoplasma hyopneumoniae-derived lipid-associated membrane proteins induce apoptosis in porcine alveolar macrophage via increasing nitric oxide production, oxidative stress, and caspase-3 activation. Vet. Immunol. Immunopathol. 2013, 155, 155–161. [Google Scholar] [CrossRef]
- Lu, Z.; Xie, D.; Chen, Y.; Tian, E.; Muhammad, I.; Chen, X.; Miao, Y.; Hu, W.; Wu, Z.; Ni, H.; et al. TLR2 mediates autophagy through ERK signaling pathway in Mycoplasma gallisepticum -infected RAW264.7 cells. Mol. Immunol. 2017, 87, 161–170. [Google Scholar] [CrossRef]
- Wu, S.; Lu, Y.-C.; McMurtrey, J.E.; Weesies, G.; Devine, T.E.; Foster, G.R. Soil Conservation Benefits of Large Biomass Soybean (LBS) for Increasing Crop Residue Cover. J. Sustain. Agric. 2004, 24, 107–128. [Google Scholar] [CrossRef]
- Zhang, Z.; Wei, Y.; Liu, B.; Wu, Y.; Wang, H.; Xie, X.; Feng, Z.; Shao, G.; Xiong, Q. Hsp90/Sec22b promotes unconventional secretion of mature-IL-1β through an autophagosomal carrier in porcine alveolar macrophages during Mycoplasma hyopneumoniae infection. Mol. Immunol. 2018, 101, 130–139. [Google Scholar] [CrossRef]
- Caron, J.; Ouardani, M.; Dea, S. Diagnosis and Differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis Infections in Pigs by PCR Amplification of the p36 and p46 Genes. J. Clin. Microbiol. 2000, 38, 1390–1396. [Google Scholar] [CrossRef] [Green Version]
- Almeida, H.M.; Mechler-Dreibi, M.L.; Sonálio, K.; Ferraz, M.E.S.; Storino, G.Y.; Barbosa, F.O.; Maes, D.; Montassier, H.J.; De Oliveira, L.G.; Rezende, F.B. Cytokine expression and Mycoplasma hyopneumoniae burden in the development of lung lesions in experimentally inoculated pigs. Vet. Microbiol. 2020, 244, 108647. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Zhao, W.; Xu, J.; Tu, F.; Wang, X.; Li, B.; Fu, Y.; Ren, S. CYP1A1 mediates the suppression of major inflammatory cytokines in pulmonary alveolar macrophage (PAM) cell lines caused by Mycoplasma hyponeumoniae. Dev. Comp. Immunol. 2016, 65, 132–138. [Google Scholar] [CrossRef] [PubMed]
- Markov, G.V.; Laudet, V. Origin and evolution of the ligand-binding ability of nuclear receptors. Mol. Cell. Endocrinol. 2011, 334, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.-M.; Ong, S.S.; Chai, S.C.; Chen, T. Role of CAR and PXR in xenobiotic sensing and metabolism. Expert Opin. Drug Metab. Toxicol. 2012, 8, 803–817. [Google Scholar] [CrossRef] [Green Version]
- Zhou, X.; Li, X.; Wang, X.; Jin, X.; Shi, D.; Wang, J.; Bi, D. Cecropin B Represses CYP3A29 Expression through Activation of the TLR2/4-NF-κB/PXR Signaling Pathway. Sci. Rep. 2016, 6, 27876. [Google Scholar] [CrossRef]
- Li, X.-N.; Zuo, Y.-Z.; Qin, L.; Liu, W.; Li, Y.-H.; Li, J.-L. Atrazine-xenobiotic nuclear receptor interactions induce cardiac inflammation and endoplasmic reticulum stress in quail (Coturnix coturnix coturnix). Chemosphere 2018, 206, 549–559. [Google Scholar] [CrossRef]
- Xie, L.; He, Y.; Zhou, X.; Li, X.; Jin, X.; Wang, X.; Shi, D. Porcine interleukin-6 enhances the expression of CYP2C33 through a constitutive androstane receptor/retinoid X receptor-mediated pathway. Xenobiotica 2018, 49, 257–264. [Google Scholar] [CrossRef]
- Dickmann, L.J.; Patel, S.K.; Wienkers, L.C.; Slatter, J.G. Effects of interleukin 1? (IL-1?) and IL-1?/interleukin 6 (IL-6) combinations on drug metabolizing enzymes in human hepatocyte culture. Curr. Drug Metab. 2012, 13, 930–937. [Google Scholar] [CrossRef]
- Kojima, M.; Degawa, M. Sex differences in constitutive mRNA levels of CYP2B22, CYP2C33, CYP2C49, CYP3A22, CYP3A29 and CYP3A46 in the pig liver: Comparison between Meishan and Landrace pigs. Drug Metab. Pharmacokinet. 2016, 31, 185–192. [Google Scholar] [CrossRef]
- Wu, J.; Chen, R.; Zhang, C.; Li, K.; Xu, W.; Wang, L.; Chen, Q.; Mu, P.; Jiang, J.; Wen, J.; et al. Bioactivation and Regioselectivity of Pig Cytochrome P450 3A29 towards Aflatoxin B1. Toxins 2016, 8, 267. [Google Scholar] [CrossRef] [Green Version]
- Zamaratskaia, G.; Thøgersen, R.; Čandek-Potokar, M.; Rasmussen, M.K. Co-treatment with indole-3-carbinol and resveratrol modify porcine CYP1A and CYP3A activities and expression. Xenobiotica 2017, 48, 232–240. [Google Scholar] [CrossRef] [PubMed]
- Küblbeck, J.; Zancanella, V.; Prantner, V.; Molnár, F.; Squires, E.J.; Dacasto, M.; Honkakoski, P.; Giantin, M. Characterization of ligand-dependent activation of bovine and pig constitutive androstane (CAR) and pregnane X receptors (PXR) with interspecies comparisons. Xenobiotica 2016, 46, 200–210. [Google Scholar] [CrossRef] [PubMed]
- Gray, M.; Pollock, C.B.; Schook, L.B.; Squires, E.J. Characterization of porcine pregnane X receptor, farnesoid X receptor and their splice variants. Exp. Biol. Med. 2010, 235, 718–736. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Wang, L.; Zhao, W.; Ren, S.; Tu, F.; Fu, Y.; Li, B.; Wang, X.; Fang, X.-M. Transcriptome sequencing analysis of porcine MDM response to FSL-1 stimulation. Microb. Pathog. 2020, 138, 103830. [Google Scholar] [CrossRef]
- Zhou, C.; Tabb, M.M.; Nelson, E.L.; Grün, F.; Verma, S.; Sadatrafiei, A.; Lin, M.; Mallick, S.; Forman, B.M.; Thummel, K.E.; et al. Mutual repression between steroid and xenobiotic receptor and NF- B signaling pathways links xenobiotic metabolism and inflammation. J. Clin. Investig. 2006, 116, 2280–2289. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Monaco, C.; Andreakos, E.; Kiriakidis, S.; Mauri, C.; Bicknell, C.; Foxwell, B.; Cheshire, N.; Paleolog, E.; Feldmann, M. Canonical pathway of nuclear factor B activation selectively regulates proinflammatory and prothrombotic responses in human atherosclerosis. Proc. Natl. Acad. Sci. USA 2004, 101, 5634–5639. [Google Scholar] [CrossRef] [Green Version]
- Smith, E.M.; Gregg, M.; Hashemi, F.; Schott, L.; Hughes, T.K. Corticotropin Releasing Factor (CRF) Activation of NF-κB-Directed Transcription in Leukocytes. Cell. Mol. Neurobiol. 2006, 26, 1019–1034. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′→3′) | Length/bp | Annealing Temperature/°C |
---|---|---|---|
IL-6 | CGAGGCCGTGCAGATTAGTA | 245 | 60 |
ACGGCATCAATCTCAGGTGC | |||
IL-8 | GCAGAGCTCACAAGCTCCTA | 171 | 60 |
CTGGCATCGAAGTTCTGCAC | |||
CYP3A29 | AAAGTCGCCTCACAGATCAACA | 173 | 60 |
GGAGAGAGCACTGCTAGTGGTCT | |||
HPRT1 | CCCAGCGTCGTGATTAGTGA | 191 | 60 |
TTGAGCACACAGAGGGCTAC | |||
PXR | AGATCTTTTCCCTGCTGCCC | 234 | 60 |
CTGAGGGGTCTTCCAAGCTG | |||
P36 | TTACAGCGGGAAGACC | 427 | 60 |
CGGCGAGAAACTGGATA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, X.; Xing, F.; Wang, L.; Zhao, W.; Fu, Y.; Tu, F.; Li, B.; Fang, X.; Ren, S. Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection. Animals 2021, 11, 349. https://doi.org/10.3390/ani11020349
Yang X, Xing F, Wang L, Zhao W, Fu Y, Tu F, Li B, Fang X, Ren S. Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection. Animals. 2021; 11(2):349. https://doi.org/10.3390/ani11020349
Chicago/Turabian StyleYang, Xiaoyang, Fei Xing, Li Wang, Weimin Zhao, Yanfeng Fu, Feng Tu, Bixia Li, Xiaomin Fang, and Shouwen Ren. 2021. "Effect of Pregnane X Receptor on CYP3A29 Expression in Porcine Alveolar Macrophages during Mycoplasma hyopneumoniae Infection" Animals 11, no. 2: 349. https://doi.org/10.3390/ani11020349