Adiponectin Improves In Vitro Development of Cloned Porcine Embryos by Reducing Endoplasmic Reticulum Stress and Apoptosis
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Approval and Chemicals
2.2. Retrieval of Oocyte and IVM
2.3. Parthenogenetic Activation
2.4. Cell Isolation, Nuclear Donor Cell Culture, and Arrangement
2.5. SCNT and Embryo Culture
2.6. Experimental Design and Adiponectin Treatment
2.7. Embryo Development and Total Blastocyst Cells Assessment
2.8. Immunofluorescence Staining of XBP1 in Embryos
2.9. Analysis of Gene Expression on ≥4 Cell Stage Embryo on Day-2 by Quantitative Real-Time PCR (qRT-PCR)
2.10. Statistical Analysis
3. Results
3.1. Effects of Adiponectin Supplementation on Embryo Development, TCN of Blastocyst, and Expression of XBP1 Derived from Parthenogenetic Activation
3.2. Effects of Adiponectin Supplementation during IVC on Embryo Development, TCN of Blastocyst, and Expression of XBP1 Derived from SCNT
3.3. Effects of 15 μg/mL Adiponectin Supplementation during IVC on Unfolded Protein Response-Related Genes Caspase-3, Nanog, and SOX2 in ≥4-Cell Day-2 Embryos
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cikos, S.; Burkus, J.; Bukovska, A.; Fabian, D.; Rehak, P.; Koppel, J. Expression of adiponectin receptors and effects of adiponectin isoforms in mouse preimplantation embryos. Hum. Reprod. 2010, 25, 2247–2255. [Google Scholar] [CrossRef] [PubMed]
- Kadowaki, T.; Yamauchi, T. Adiponectin and adiponectin receptors. Endocr. Rev. 2005, 26, 439–451. [Google Scholar] [CrossRef]
- Yamauchi, T.; Iwabu, M.; Okada-Iwabu, M.; Kadowaki, T. Adiponectin receptors: A review of their structure, function and how they work. Best Pract. Res. Clin. Endocrinol. Metab. 2014, 28, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Tsao, T.S.; Murrey, H.E.; Hug, C.; Lee, D.H.; Lodish, H.F. Oligomerization state-dependent activation of NF-kappa B signaling pathway by adipocyte complement-related protein of 30 kDa (Acrp30). J. Biol. Chem. 2002, 277, 29359–29362. [Google Scholar] [CrossRef]
- Ledoux, S.; Campos, D.B.; Lopes, F.L.; Dobias-Goff, M.; Palin, M.F.; Murphy, B.D. Adiponectin induces periovulatory changes in ovarian follicular cells. Endocrinology 2006, 147, 5178–5186. [Google Scholar] [CrossRef]
- Palin, M.F.; Bordignon, V.V.; Murphy, B.D. Adiponectin and the control of female reproductive functions. Vitam. Horm. 2012, 90, 239–287. [Google Scholar] [CrossRef]
- Kos, K.; Harte, A.L.; da Silva, N.F.; Tonchev, A.; Chaldakov, G.; James, S.; Snead, D.R.; Hoggart, B.; O’Hare, J.P.; McTernan, P.G.; et al. Adiponectin and resistin in human cerebrospinal fluid and expression of adiponectin receptors in the human hypothalamus. J. Clin. Endocrinol. Metab. 2007, 92, 1129–1136. [Google Scholar] [CrossRef]
- Psilopanagioti, A.; Papadaki, H.; Kranioti, E.F.; Alexandrides, T.K.; Varakis, J.N. Expression of adiponectin and adiponectin receptors in human pituitary gland and brain. Neuroendocrinology 2009, 89, 38–47. [Google Scholar] [CrossRef]
- Cheng, L.; Shi, H.; Jin, Y.; Li, X.; Pan, J.; Lai, Y.; Lin, Y.; Jin, Y.; Roy, G.; Zhao, A.; et al. Adiponectin Deficiency Leads to Female Subfertility and Ovarian Dysfunctions in Mice. Endocrinology 2016, 157, 4875–4887. [Google Scholar] [CrossRef]
- Schraw, T.; Wang, Z.V.; Halberg, N.; Hawkins, M.; Scherer, P.E. Plasma adiponectin complexes have distinct biochemical characteristics. Endocrinology 2008, 149, 2270–2282. [Google Scholar] [CrossRef] [PubMed]
- Barbe, A.; Bongrani, A.; Mellouk, N.; Estienne, A.; Kurowska, P.; Grandhaye, J.; Elfassy, Y.; Levy, R.; Rak, A.; Froment, P.; et al. Mechanisms of Adiponectin Action in Fertility: An Overview from Gametogenesis to Gestation in Humans and Animal Models in Normal and Pathological Conditions. Int. J. Mol. Sci. 2019, 20, 1526. [Google Scholar] [CrossRef] [PubMed]
- Chabrolle, C.; Tosca, L.; Dupont, J. Regulation of adiponectin and its receptors in rat ovary by human chorionic gonadotrophin treatment and potential involvement of adiponectin in granulosa cell steroidogenesis. Reproduction 2007, 133, 719–731. [Google Scholar] [CrossRef] [PubMed]
- Diot, M.; Reverchon, M.; Rame, C.; Froment, P.; Brillard, J.P.; Briere, S.; Leveque, G.; Guillaume, D.; Dupont, J. Expression of adiponectin, chemerin and visfatin in plasma and different tissues during a laying season in turkeys. Reprod. Biol. Endocrinol. 2015, 13, 81. [Google Scholar] [CrossRef]
- Maleszka, A.; Smolinska, N.; Nitkiewicz, A.; Kiezun, M.; Chojnowska, K.; Dobrzyn, K.; Szwaczek, H.; Kaminski, T. Adiponectin Expression in the Porcine Ovary during the Oestrous Cycle and Its Effect on Ovarian Steroidogenesis. Int. J. Endocrinol. 2014, 2014, 957076. [Google Scholar] [CrossRef]
- Singh, S.P.; Haussler, S.; Gross, J.J.; Schwarz, F.J.; Bruckmaier, R.M.; Sauerwein, H. Short communication: Circulating and milk adiponectin change differently during energy deficiency at different stages of lactation in dairy cows. J. Dairy Sci. 2014, 97, 1535–1542. [Google Scholar] [CrossRef] [PubMed]
- Lord, E.; Ledoux, S.; Murphy, B.D.; Beaudry, D.; Palin, M.F. Expression of adiponectin and its receptors in swine. J. Anim. Sci 2005, 83, 565–578. [Google Scholar] [CrossRef]
- Kim, S.; Marquard, K.; Stephens, S.; Louden, E.; Allsworth, J.; Moley, K. Adiponectin and adiponectin receptors in the mouse preimplantation embryo and uterus. Hum. Reprod. 2011, 26, 82–95. [Google Scholar] [CrossRef]
- Takemura, Y.; Osuga, Y.; Yamauchi, T.; Kobayashi, M.; Harada, M.; Hirata, T.; Morimoto, C.; Hirota, Y.; Yoshino, O.; Koga, K. Expression of adiponectin receptors and its possible implication in the human endometrium. Endocrinology 2006, 147, 3203–3210. [Google Scholar] [CrossRef]
- Schmidt, T.; Fischer, S.; Tsikolia, N.; Santos, A.N.; Rohrbach, S.; Ramin, N.; Thieme, R.; Fischer, B. Expression of adipokines in preimplantation rabbit and mice embryos. Histochem. Cell Biol. 2008, 129, 817–825. [Google Scholar] [CrossRef]
- Fischer, S.; Navarrete Santos, A.; Thieme, R.; Ramin, N.; Fischer, B. Adiponectin stimulates glucose uptake in rabbit blastocysts. Biol. Reprod. 2010, 83, 859–865. [Google Scholar] [CrossRef]
- Chappaz, E.; Albornoz, M.S.; Campos, D.; Che, L.; Palin, M.F.; Murphy, B.D.; Bordignon, V. Adiponectin enhances in vitro development of swine embryos. Domest. Anim. Endocrinol. 2008, 35, 198–207. [Google Scholar] [CrossRef]
- Gomes, E.T.; Costa, J.A.S.; Silva, D.M.F.; Al Shebli, W.; Azevedo, M.L.; Monteiro, P.L.J., Jr.; Araujo Silva, R.A.J.; Santos Filho, A.S.; Guerra, M.M.P.; Bartolomeu, C.C.; et al. Effects of adiponectin during in vitro maturation of goat oocytes: MEK 1/2 pathway and gene expression pattern. Reprod. Domest. Anim. 2018, 53, 1323–1329. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Gan, L.; Wu, T.; Feng, F.; Luo, D.; Gu, H.; Liu, S.; Sun, C. Adiponectin reduces ER stress-induced apoptosis through PPARalpha transcriptional regulation of ATF2 in mouse adipose. Cell Death Dis. 2016, 7, e2487. [Google Scholar] [CrossRef]
- Jeong, W.; Bae, H.; Lim, W.; Bazer, F.W.; Song, G. Adiponectin: A prosurvival and proproliferation signal that increases bovine mammary epithelial cell numbers and protects them from endoplasmic reticulum stress responses. J. Anim. Sci. 2017, 95, 5278–5289. [Google Scholar] [CrossRef]
- Bettigole, S.E.; Glimcher, L.H. Endoplasmic reticulum stress in immunity. Annu. Rev. Immunol. 2015, 33, 107–138. [Google Scholar] [CrossRef] [PubMed]
- Zheng, P.; Chen, Q.; Tian, X.; Qian, N.; Chai, P.; Liu, B.; Hu, J.; Blackstone, C.; Zhu, D.; Teng, J.; et al. DNA damage triggers tubular endoplasmic reticulum extension to promote apoptosis by facilitating ER-mitochondria signaling. Cell Res. 2018, 28, 833–854. [Google Scholar] [CrossRef]
- Lin, T.; Lee, J.E.; Kang, J.W.; Shin, H.Y.; Lee, J.B.; Jin, D.I. Endoplasmic Reticulum (ER) Stress and Unfolded Protein Response (UPR) in Mammalian Oocyte Maturation and Preimplantation Embryo Development. Int. J. Mol. Sci. 2019, 20, 409. [Google Scholar] [CrossRef]
- Latham, K.E. Endoplasmic reticulum stress signaling in mammalian oocytes and embryos: Life in balance. Int. Rev. Cell Mol. Biol. 2015, 316, 227–265. [Google Scholar] [CrossRef]
- Park, H.J.; Park, J.Y.; Kim, J.W.; Yang, S.G.; Jung, J.M.; Kim, M.J.; Kang, M.J.; Cho, Y.H.; Wee, G.; Yang, H.Y.; et al. Melatonin improves the meiotic maturation of porcine oocytes by reducing endoplasmic reticulum stress during in vitro maturation. J. Pineal. Res. 2018, 64. [Google Scholar] [CrossRef] [PubMed]
- Dicks, N.; Bohrer, R.C.; Gutierrez, K.; Michalak, M.; Agellon, L.B.; Bordignon, V. Relief of endoplasmic reticulum stress enhances DNA damage repair and improves development of pre-implantation embryos. PLoS ONE 2017, 12, e0187717. [Google Scholar] [CrossRef]
- Kikuchi, K.; Kashiwazaki, N.; Noguchi, J.; Shimada, A.; Takahashi, R.; Hirabayashi, M.; Shino, M.; Ueda, M.; Kaneko, H. Developmental competence, after transfer to recipients, of porcine oocytes matured, fertilized, and cultured in vitro. Biol. Reprod. 1999, 60, 336–340. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dang-Nguyen, T.Q.; Somfai, T.; Haraguchi, S.; Kikuchi, K.; Tajima, A.; Kanai, Y.; Nagai, T. In vitro production of porcine embryos: Current status, future perspectives and alternative applications. Anim. Sci. J. 2011, 82, 374–382. [Google Scholar] [CrossRef]
- Ridlo, M.R.; Kim, G.A.; Taweechaipaisankul, A.; Kim, E.H.; Lee, B.C. Zinc supplementation alleviates endoplasmic reticulum stress during porcine oocyte in vitro maturation by upregulating zinc transporters. J. Cell. Physiol. 2020. [Google Scholar] [CrossRef]
- Picco, S.J.; Anchordoquy, J.M.; de Matos, D.G.; Anchordoquy, J.P.; Seoane, A.; Mattioli, G.A.; Errecalde, A.L.; Furnus, C.C. Effect of increasing zinc sulphate concentration during in vitro maturation of bovine oocytes. Theriogenology 2010, 74, 1141–1148. [Google Scholar] [CrossRef] [PubMed]
- Taweechaipaisankul, A.; Kim, G.A.; Jin, J.X.; Lee, S.; Qasim, M.; Kim, E.H.; Lee, B.C. Enhancement of epigenetic reprogramming status of porcine cloned embryos with zebularine, a DNA methyltransferase inhibitor. Mol. Reprod. Dev. 2019, 86, 1013–1022. [Google Scholar] [CrossRef] [PubMed]
- Taweechaipaisankul, A.; Jin, J.X.; Lee, S.; Kim, G.A.; Suh, Y.H.; Ahn, M.S.; Park, S.J.; Lee, B.Y.; Lee, B.C. Improved early development of porcine cloned embryos by treatment with quisinostat, a potent histone deacetylase inhibitor. J. Reprod. Dev. 2019, 65, 103–112. [Google Scholar] [CrossRef]
- Kim, M.J.; Oh, H.J.; Choi, Y.B.; Lee, S.; Setyawan, E.M.N.; Lee, S.H.; Lee, S.H.; Hur, T.Y.; Lee, B.C. Suberoylanilide hydroxamic acid during in vitro culture improves development of dog-pig interspecies cloned embryos but not dog cloned embryos. J. Reprod. Dev. 2018, 64, 277–282. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.X.; Lee, S.; Taweechaipaisankul, A.; Kim, G.A.; Lee, B.C. The HDAC Inhibitor LAQ824 Enhances Epigenetic Reprogramming and In Vitro Development of Porcine SCNT Embryos. Cell Physiol. Biochem. 2017, 41, 1255–1266. [Google Scholar] [CrossRef]
- Jin, J.X.; Lee, S.; Khoirinaya, C.; Oh, A.; Kim, G.A.; Lee, B.C. Supplementation with spermine during in vitro maturation of porcine oocytes improves early embryonic development after parthenogenetic activation and somatic cell nuclear transfer. J. Anim. Sci. 2016, 94, 963–970. [Google Scholar] [CrossRef]
- Catley, L.; Weisberg, E.; Tai, Y.-T.; Atadja, P.; Remiszewski, S.; Hideshima, T.; Mitsiades, N.; Shringarpure, R.; LeBlanc, R.; Chauhan, D. NVP-LAQ824 is a potent novel histone deacetylase inhibitor with significant activity against multiple myeloma. Blood 2003, 102, 2615–2622. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Yuan, L.; Li, T.; Wang, A.; Li, Z.; Pang, D.; Wang, B.; Ouyang, H. Valproic acid improves porcine parthenogenetic embryo development through transient remodeling of histone modifiers. Cell. Physiol. Biochem. 2015, 37, 1463–1473. [Google Scholar] [CrossRef]
- Jin, J.X.; Lee, S.; Taweechaipaisankul, A.; Kim, G.A.; Lee, B.C. Melatonin regulates lipid metabolism in porcine oocytes. J. Pineal. Res. 2017, 62. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Jin, J.X.; Taweechaipaisankul, A.; Kim, G.A.; Lee, B.C. Stimulatory Effects of Melatonin on Porcine In Vitro Maturation Are Mediated by MT2 Receptor. Int. J. Mol. Sci. 2018, 19, 1581. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Jin, J.X.; Taweechaipaisankul, A.; Kim, G.A.; Ahn, C.; Lee, B.C. Sonic hedgehog signaling mediates resveratrol to improve maturation of pig oocytes in vitro and subsequent preimplantation embryo development. J. Cell. Physiol. 2018, 233, 5023–5033. [Google Scholar] [CrossRef] [PubMed]
- Taweechaipaisankul, A.; Jin, J.; Lee, S.; Kim, G.; Lee, B. The effects of canthaxanthin on porcine oocyte maturation and embryo development in vitro after parthenogenetic activation and somatic cell nuclear transfer. Reprod. Domest. Anim. 2016, 51, 870–876. [Google Scholar] [CrossRef]
- Jin, J.-X.; Lee, S.; Setyawan, E.M.N.; Taweechaipaisankul, A.; Kim, G.A.; Han, H.J.; Ahn, C.; Lee, B.C. A potential role of knockout serum replacement as a porcine follicular fluid substitute for in vitro maturation: Lipid metabolism approach. J. Cell. Physiol. 2018, 233, 6984–6995. [Google Scholar] [CrossRef]
- Kim, E.H.; Kim, G.A.; Taweechaipaisankul, A.; Ridlo, M.R.; Lee, S.H.; Ra, K.; Ahn, C.; Lee, B.C. Phytanic acid-derived peroxisomal lipid metabolism in porcine oocytes. Theriogenology 2020, 157, 276–285. [Google Scholar] [CrossRef]
- Vajta, G.; Zhang, Y.; Machaty, Z. Somatic cell nuclear transfer in pigs: Recent achievements and future possibilities. Reprod. Fertil. Dev. 2007, 19, 403–423. [Google Scholar] [CrossRef]
- Hwang, I.S.; Park, M.R.; Lee, H.S.; Kwak, T.U.; Son, H.Y.; Kang, J.K.; Lee, J.W.; Lee, K.; Park, E.W.; Hwang, S. Developmental and Degenerative Characterization of Porcine Parthenogenetic Fetuses during Early Pregnancy. Animals 2020, 10, 622. [Google Scholar] [CrossRef]
- Gil, M.A.; Cuello, C.; Parrilla, I.; Vazquez, J.M.; Roca, J.; Martinez, E.A. Advances in swine in vitro embryo production technologies. Reprod. Domest. Anim. 2010, 45 (Suppl. 2), 40–48. [Google Scholar] [CrossRef]
- Gu, T.; Shi, J.; Luo, L.; Li, Z.; Yang, J.; Cai, G.; Zheng, E.; Hong, L.; Wu, Z. Study on Hematological and Biochemical Characters of Cloned Duroc Pigs and Their Progeny. Animals 2019, 9, 912. [Google Scholar] [CrossRef]
- Lin, T.; Lee, J.E.; Oqani, R.K.; Kim, S.Y.; Cho, E.S.; Jeong, Y.D.; Baek, J.J.; Jin, D.I. Tauroursodeoxycholic acid improves pre-implantation development of porcine SCNT embryo by endoplasmic reticulum stress inhibition. Reprod. Biol. 2016, 16, 269–278. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.S.; Song, B.S.; Lee, K.S.; Kim, D.H.; Kim, S.U.; Choo, Y.K.; Chang, K.T.; Koo, D.B. Tauroursodeoxycholic acid enhances the pre-implantation embryo development by reducing apoptosis in pigs. Reprod. Domest. Anim. 2012, 47, 791–798. [Google Scholar] [CrossRef] [PubMed]
- Song, B.S.; Yoon, S.B.; Sim, B.W.; Kim, Y.H.; Cha, J.J.; Choi, S.A.; Jeong, K.J.; Kim, J.S.; Huh, J.W.; Lee, S.R.; et al. Valproic acid enhances early development of bovine somatic cell nuclear transfer embryos by alleviating endoplasmic reticulum stress. Reprod. Fertil. Dev. 2014, 26, 432–440. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.L.; Russell, D.L.; Norman, R.J.; Robker, R.L. Endoplasmic reticulum (ER) stress in cumulus-oocyte complexes impairs pentraxin-3 secretion, mitochondrial membrane potential (DeltaPsi m), and embryo development. Mol. Endocrinol. 2012, 26, 562–573. [Google Scholar] [CrossRef]
- Shimada, K.; Miyazaki, T.; Daida, H. Adiponectin and atherosclerotic disease. Clin. Chim. Acta 2004, 344, 1–12. [Google Scholar] [CrossRef]
- Hou, Y.; Wang, X.F.; Lang, Z.Q.; Jin, Y.C.; Fu, J.R.; Xv, X.M.; Sun, S.T.; Xin, X.; Zhang, L.S. Adiponectin is protective against endoplasmic reticulum stress-induced apoptosis of endothelial cells in sepsis. Braz. J. Med. Biol. Res. 2018, 51, e7747. [Google Scholar] [CrossRef]
- Walter, P.; Ron, D. The unfolded protein response: From stress pathway to homeostatic regulation. Science 2011, 334, 1081–1086. [Google Scholar] [CrossRef] [PubMed]
- Song, X.J.; Yang, C.Y.; Liu, B.; Wei, Q.; Korkor, M.T.; Liu, J.Y.; Yang, P. Atorvastatin inhibits myocardial cell apoptosis in a rat model with post-myocardial infarction heart failure by downregulating ER stress response. Int. J. Med. Sci. 2011, 8, 564–572. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Diao, Y.F.; Oqani, R.K.; Han, R.X.; Jin, D.I. Effect of endoplasmic reticulum stress on porcine oocyte maturation and parthenogenetic embryonic development in vitro. Biol. Reprod. 2012, 86, 128. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Diao, Y.F.; Kim, H.R.; Jin, D.I. Inhibition of endoplasmic reticulum stress improves mouse embryo development. PLoS ONE 2012, 7, e40433. [Google Scholar] [CrossRef]
- Uhm, S.J.; Gupta, M.K.; Chung, H.-J.; Kim, J.H.; Park, C.; Lee, H.T. Relationship between developmental ability and cell number of day 2 porcine embryos produced by parthenogenesis or somatic cell nuclear transfer. Asian-Australas. J. Anim. Sci. 2009, 22, 483–491. [Google Scholar] [CrossRef]
- Mateusen, B.; Van Soom, A.; Maes, D.G.; Donnay, I.; Duchateau, L.; Lequarre, A.-S. Porcine embryo development and fragmentation and their relation to apoptotic markers: A cinematographic and confocal laser scanning microscopic study. Reproduction 2005, 129, 443–452. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.H.; Abeydeera, L.R.; Han, Y.M.; Prather, R.S.; Day, B.N. Morphologic evaluation and actin filament distribution in porcine embryos produced in vitro and in vivo. Biol. Reprod. 1999, 60, 1020–1028. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.W.; Hwang, K.J.; Kwon, H.C.; Kim, H.S.; Choi, K.W.; Oh, K.S. Detection of reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Hum. Reprod. 1998, 13, 998–1002. [Google Scholar] [CrossRef] [PubMed]
- Woo, J.H.; Hwang, K.J.; Yang, H.W.; Lee, C.H.; Yang, J.I.; Kwan, H.C.; Oh, K.S. Effects of Low Oxygen Condition on the Development of Mouse Embryos Cultured In Viro. Korean J. Obstet. Gynecol. 2001, 41, 2962–2968. [Google Scholar]
- Koo, J.-M.; Won, C.-H.; Min, B.-M.; Roh, S.-H. Development of a chemically defined in vitro maturation system for porcine oocytes: Application for somatic cell nuclear transfer. Int. J. Oral Biol. 2005, 30, 131–134. [Google Scholar]
- Lee, H.; Lee, Y.; Park, B.; Elahi, F.; Lee, J.; Choi, J.H.; Lee, S.T.; Park, C.-K.; Hyun, S.-H.; Lee, E. Detrimental Effect of Bovine Serum Albumin in a Maturation Medium on Embryonic Development after Somatic Cell Nuclear Transfer in Pigs. J. Embryo Transf. 2014, 29, 361–368. [Google Scholar] [CrossRef]
- Yoshioka, K.; Suzuki, C.; Onishi, A. Defined system for in vitro production of porcine embryos using a single basic medium. J. Reprod. Dev. 2008, 54, 208–213. [Google Scholar] [CrossRef]
- Lee, H.Y.; Bae, H.K.; Jung, B.D.; Lee, S.; Park, C.K.; Yang, B.K.; Cheong, H.T. Analysis of Endoplasmic Reticulum (ER) Stress Induced during Somatic Cell Nuclear Transfer (SCNT) Process in Porcine SCNT Embryos. Dev. Reprod. 2018, 22, 73–83. [Google Scholar] [CrossRef]
- Kim, S.K.; Kim, Y.K.; Lee, A.S. Expression of the glucose-regulated proteins (GRP94 and GRP78) in differentiated and undifferentiated mouse embryonic cells and the use of the GRP78 promoter as an expression system in embryonic cells. Differentiation 1990, 42, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Guha, P.; Kaptan, E.; Gade, P.; Kalvakolanu, D.V.; Ahmed, H. Tunicamycin induced endoplasmic reticulum stress promotes apoptosis of prostate cancer cells by activating mTORC1. Oncotarget 2017, 8, 68191–68207. [Google Scholar] [CrossRef]
- Bohnert, K.R.; McMillan, J.D.; Kumar, A. Emerging roles of ER stress and unfolded protein response pathways in skeletal muscle health and disease. J. Cell. Physiol. 2018, 233, 67–78. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.H.; Aydemir, T.B.; Kim, J.; Cousins, R.J. Hepatic ZIP14-mediated zinc transport is required for adaptation to endoplasmic reticulum stress. Proc. Natl. Acad. Sci. USA 2017, 114, E5805–E5814. [Google Scholar] [CrossRef] [PubMed]
- Lv, Y.-T.; Zeng, J.-J.; Lu, J.-Y.; Zhang, X.-Y.; Xu, P.-P.; Su, Y. Porphyromonas gingivalis lipopolysaccharide (Pg-LPS) influences adipocytes injuries through triggering XBP1 and activating mitochondria-mediated apoptosis. Adipocyte 2021, 10, 28–37. [Google Scholar] [CrossRef]
- Jeon, M.J.; Leem, J.; Ko, M.S.; Jang, J.E.; Park, H.S.; Kim, H.S.; Kim, M.; Kim, E.H.; Yoo, H.J.; Lee, C.H.; et al. Mitochondrial dysfunction and activation of iNOS are responsible for the palmitate-induced decrease in adiponectin synthesis in 3T3L1 adipocytes. Exp. Mol. Med. 2012, 44, 562–570. [Google Scholar] [CrossRef]
- Bian, Y.F.; Hao, X.Y.; Gao, F.; Yang, H.Y.; Zang, N.; Xiao, C.S. Adiponectin attenuates hypoxia/reoxygenation-induced cardiomyocyte injury through inhibition of endoplasmic reticulum stress. J. Investig. Med. 2011, 59, 921–925. [Google Scholar] [CrossRef]



| Genes | Primer Sequences (5′–3′) | Product Size (Bp) | Accession No. |
|---|---|---|---|
| GAPDH | F: GTCGGTTGTGGATCTGACCT R: TTGACGAAGTGGTCGTTGAG | 207 | NM_001206359 |
| uXBP1 | F: CATGGATTCTGACGGTGTTG R: GTCTGGGGAAGGACATCTGA | 106 | NM_001142836.1 |
| sXBP1 | F: GGAGTTAAGACAGCGCTTGG R: GAGATGTTCTGGAGGGGTGA | 142 | NM_001271738.1 |
| ATF4 | F: AGTCCTTTTCTGCGAGTGGG R: CTGCTGCCTCTAATACGCCA | 80 | NM_001123078.1 |
| PTPN1/PTP1B | F: GGTGCTCACGACTCTTCCTC R: TTCTCTGCACGAGCTTCTGA | 158 | NM_001113435.1 |
| Caspase-3 | F: GCCATGGTGAAGAAGGAAAA R: GGCAGGCCTGAATTATGAAA | 132 | NM_214131.1 |
| Nanog | F: GGTTTATGGGCCTGAAGAAA R: GATCCATGGAGGAAGGAAGA | 98 | NM_001129971 |
| SOX2 | F: ATGCACAACTCGGAGATCAG R: TATAATCCGGGTGCTCCTTC | 130 | NM_001123197 |
| Adiponectin (μg/mL) | Number of Embryos Cultured | No. of Embryos Developed (Mean ± SD, %) | Total Blastocyst Cell Number (Mean ± SEM) | |
|---|---|---|---|---|
| ≥2 Cells | Blastocyst | |||
| 0 | 132 | 117 (88.6 ± 0.89) a | 34 (25.6 ± 3.1) a | 55.96 ± 5.5 a |
| 15 | 130 | 120 (92.3 ± 0.55) b | 53 (39.8 ± 3.1) b | 72.44 ± 7.0 b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ridlo, M.R.; Kim, E.H.; Taweechaipaisankul, A.; Lee, B.C.; Kim, G.A. Adiponectin Improves In Vitro Development of Cloned Porcine Embryos by Reducing Endoplasmic Reticulum Stress and Apoptosis. Animals 2021, 11, 473. https://doi.org/10.3390/ani11020473
Ridlo MR, Kim EH, Taweechaipaisankul A, Lee BC, Kim GA. Adiponectin Improves In Vitro Development of Cloned Porcine Embryos by Reducing Endoplasmic Reticulum Stress and Apoptosis. Animals. 2021; 11(2):473. https://doi.org/10.3390/ani11020473
Chicago/Turabian StyleRidlo, Muhammad Rosyid, Eui Hyun Kim, Anukul Taweechaipaisankul, Byeong Chun Lee, and Geon A. Kim. 2021. "Adiponectin Improves In Vitro Development of Cloned Porcine Embryos by Reducing Endoplasmic Reticulum Stress and Apoptosis" Animals 11, no. 2: 473. https://doi.org/10.3390/ani11020473
APA StyleRidlo, M. R., Kim, E. H., Taweechaipaisankul, A., Lee, B. C., & Kim, G. A. (2021). Adiponectin Improves In Vitro Development of Cloned Porcine Embryos by Reducing Endoplasmic Reticulum Stress and Apoptosis. Animals, 11(2), 473. https://doi.org/10.3390/ani11020473

