Birth Weight and Nutrient Restriction Affect Jejunal Enzyme Activity and Gene Markers for Nutrient Transport and Intestinal Function in Piglets
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Housing, and Experimental Design
2.2. Enzyme Activity Assay
2.3. Real-Time Polymerase Chain Reaction (q-PCR)
2.4. Statistical Analysis
3. Results
3.1. Enzyme Activity
3.2. RT-qPCR of Target Genes
4. Discussion
4.1. Birth Weight and Nutrition Effect on Enzyme Activity
4.2. Birth Weight and Nutrition Effect on Target Gene mRNA Transcript Abundance
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Quesnel, H.; Brossard, L.; Valancogne, A.; Quiniou, N. Influence of some sow characteristics on within-litter variation of piglet birth weight. Animal 2008, 2, 1842–1849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kapell, D.N.R.G.; Ashworth, C.J.; Knap, P.W.; Roehe, R. Genetic parameters for piglet survival, litter size and birth weight or its variation within litter in sire and dam lines using bayesian analysis. Livest. Sci. 2011, 135, 215–224. [Google Scholar] [CrossRef]
- Campbell, R.G.; Dunkin, A.C. The effect of birth weight on the estimated milk intake, growth and body composition of sow-reared piglets. Anim. Sci. 1982, 35, 193–197. [Google Scholar] [CrossRef]
- Cabrera, R.A.; Lin, X.; Campbell, J.M.; Moeser, A.J.; Odle, J. Influence of birth order, birth weight, colostrum and serum immunoglobulin g on neonatal piglet survival. J. Anim. Sci. Biotechnol. 2012, 3, 42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tao, S.; Bai, Y.; Li, T.; Li, N.; Wang, J. Original low birth weight deteriorates the hindgut epithelial barrier function in pigs at the growing stage. FASEB J. 2019, 33, 9897–9912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Michiels, J.; Vos, M.D.; Missotten, J.; Ovyn, A.; Smet, S.D.; Ginneken, C.V. Maturation of digestive function is retarded and plasma antioxidant capacity lowered in fully weaned low birth weight piglets. Br. J. Nutr. 2013, 109, 65–75. [Google Scholar] [CrossRef] [Green Version]
- Milligan, B.; Fraser, D.; Kramer, D. The effect of littermate weight on survival, weight gain, and suckling behavior of low-birth-weight piglets in cross-fostered litters. Ontog. Collect. 2001, 9, 161–168. [Google Scholar]
- Souza, L.P.; Fries, H.C.C.; Heim, G.; Faccin, J.E.; Hernig, L.F.; Marimon, B.T.; Bernardi, M.L.; Bortolozzo, F.P.; Wentz, I. Behaviour and growth performance of low-birth-weight piglets cross-fostered in multiparous sows with piglets of higher birth weights. Arq. Bras. Med. Vet. E Zootec. 2014, 66, 510–518. [Google Scholar] [CrossRef]
- Spreeuwenberg, M.A.M.; Verdonk, J.M.A.J.; Gaskins, H.R.; Verstegen, M.W.A. Small intestine epithelial barrier function is compromised in pigs with low feed intake at weaning. J. Nutr. 2001, 131, 1520–1527. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Farhadi, A.; Banan, A.; Fields, J.; Keshavarzian, A. Intestinal barrier: An interface between health and disease. J. Gastroenterol. Hepatol. 2003, 18, 479–497. [Google Scholar] [CrossRef]
- Stewart, A.S.; Pratt-Phillips, S.; Gonzalez, L.M. Alterations in intestinal permeability: The role of the “Leaky Gut” in health and disease. J. Equine Vet. Sci. 2017, 52, 10–22. [Google Scholar] [CrossRef]
- Rodrigues, L.A.; Wellington, M.O.; Sands, J.M.; Weber, L.P.; Olver, T.D.; Ferguson, D.P.; Columbus, D.A. Characterization of a swine model of birth weight and neonatal nutrient restriction. Curr. Dev. Nutr. 2020, 4, nzaa116. [Google Scholar] [CrossRef]
- Beaulieu, A.D.; Aalhus, J.L.; Williams, N.H.; Patience, J.F. Impact of piglet birth weight, birth order, and litter size on subsequent growth performance, carcass quality, muscle composition, and eating quality of pork. J. Anim. Sci. 2010, 88, 2767–2778. [Google Scholar] [CrossRef]
- Berkeveld, M.; Langendijk, P.; van Beers-Schreurs, H.M.G.; Koets, A.P.; Taverne, M.a.M.; Verheijden, J.H.M. Postweaning growth check in pigs is markedly reduced by intermittent suckling and extended lactation. J. Anim. Sci. 2007, 85, 258–266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuller, W.I.; Soede, N.M.; van Beers-Schreurs, H.M.G.; Langendijk, P.; Taverne, M.A.M.; Kemp, B.; Verheijden, J.H.M. Effects of intermittent suckling and creep feed intake on pig performance from birth to slaughter. J. Anim. Sci. 2007, 85, 1295–1301. [Google Scholar] [CrossRef]
- Engström, L. Studies on bovine-liver alkaline phosphatase, purification, phosphate incorporation. Biochim. Biophys. Acta BBA-Spec. Sect. Enzymol. Subj. 1964, 92, 71–78. [Google Scholar] [CrossRef]
- Hübscher, G.; West, G.R. Specific assays of some phosphatases in subcellular fractions of small intestinal mucosa. Nature 1965, 205, 799–800. [Google Scholar] [CrossRef] [PubMed]
- Dahlqvist, A. Method for assay of intestinal disaccharidases. Anal. Biochem. 1964, 7, 18–25. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bilski, J.; Mazur-Bialy, A.; Wojcik, D.; Zahradnik-Bilska, J.; Brzozowski, B.; Magierowski, M.; Mach, T.; Magierowska, K.; Brzozowski, T. The role of intestinal alkaline phosphatase in inflammatory disorders of gastrointestinal tract. Mediat. Inflamm. 2017, 2017, e9074601. [Google Scholar] [CrossRef] [PubMed]
- Maga, E.A.; Weimer, B.C.; Murray, J.D. Dissecting the role of milk components on gut microbiota composition. Gut Microbes 2013, 4, 136–139. [Google Scholar] [CrossRef] [Green Version]
- Lallès, J.-P. Intestinal alkaline phosphatase: Novel functions and protective effects. Nutr. Rev. 2014, 72, 82–94. [Google Scholar] [CrossRef]
- Huygelen, V.; De Vos, M.; Willemen, S.; Fransen, E.; Casteleyn, C.; Van Cruchten, S.; Van Ginneken, C. Age-related differences in mucosal barrier function and morphology of the small intestine in low and normal birth weight piglets1. J. Anim. Sci. 2014, 92, 3398–3406. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.-H.; Hamaker, B.R. Maltase has most versatile α-Hydrolytic activity among the mucosal α-Glucosidases of the small intestine. J. Pediatr. Gastroenterol. Nutr. 2018, 66, S7. [Google Scholar] [CrossRef] [PubMed]
- Gericke, B.; Amiri, M.; Naim, H.Y. The multiple roles of sucrase-isomaltase in the intestinal physiology. Mol. Cell. Pediatr. 2016, 3, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kramer, M.S.; Kakuma, R. The optimal duration of exclusive breastfeeding: A systematic review. Adv. Exp. Med. Biol. 2004, 554, 63–77. [Google Scholar]
- Kidder, D.E.; Manners, M.J. The level and distribution of carbohydrases in the small intestine mucosa of pigs from 3 weeks of age to maturity. Br. J. Nutr. 1980, 43, 141–153. [Google Scholar] [CrossRef] [Green Version]
- Ayuso, M.; Irwin, R.; Walsh, C.; Cruchten, S.V.; Ginneken, C.V. Low birth weight female piglets show altered intestinal development, gene expression, and epigenetic changes at key developmental loci. FASEB J. 2021, 35, e21522. [Google Scholar] [CrossRef] [PubMed]
- Chiba, H.; Osanai, M.; Murata, M.; Kojima, T.; Sawada, N. Transmembrane proteins of tight junctions. Biochim. Biophys. Acta BBA-Biomembr. 2008, 1778, 588–600. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grześkowiak, Ł.; Martínez-Vallespín, B.; Dadi, T.H.; Radloff, J.; Amasheh, S.; Heinsen, F.-A.; Franke, A.; Reinert, K.; Vahjen, W.; Zentek, J.; et al. Formula feeding predisposes neonatal piglets to clostridium difficile gut infection. J. Infect. Dis. 2018, 217, 1442–1452. [Google Scholar] [CrossRef] [PubMed]
- Grześkowiak, Ł.; Pieper, R.; Kröger, S.; Martínez-Vallespín, B.; Hauser, A.E.; Niesner, R.; Vahjen, W.; Zentek, J. Porcine colostrum protects the IPEC-J2 cells and piglet colon epithelium against clostridioides (Syn. Clostridium) difficile toxin-induced effects. Microorganisms 2020, 8, 142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fan, M.Z.; Matthews, J.C.; Etienne, N.M.P.; Stoll, B.; Lackeyram, D.; Burrin, D.G. Expression of apical membrane L-glutamate transporters in neonatal porcine epithelial cells along the small intestinal crypt-villus axis. Am. J. Physiol.-Gastrointest. Liver Physiol. 2004, 287, G385–G398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanai, Y.; Hediger, M.A. The glutamate and neutral amino acid transporter family: Physiological and pharmacological implications. Eur. J. Pharmacol. 2003, 479, 237–247. [Google Scholar] [CrossRef]
- Yang, H.; Fu, D.; Shao, H.; Kong, X.; Wang, W.; Yang, X.; Nyachoti, C.M.; Yin, Y. Impacts of birth weight on plasma, liver and skeletal muscle neutral amino acid profiles and intestinal amino acid transporters in suckling Huanjiang mini-piglets. PLoS ONE 2012, 7, e50921. [Google Scholar] [CrossRef] [PubMed]
- Fu, D.; Yang, H.; Kong, X.; Blachier, F.; Wang, W.; Yin, Y. Molecular cloning and expression profiling of excitatory amino acid carrier 1 in suckling huanjiang mini-piglets with large or small body weight at birth. Mol. Biol. Rep. 2013, 40, 3341–3350. [Google Scholar] [CrossRef]
- Ball, R.O.; Atkinson, J.L.; Bayley, H.S. Proline as an essential amino acid for the young pig. Br. J. Nutr. 1986, 55, 659–668. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.; Dai, Z.; Wu, Z.; Lin, G.; Jia, S.; Hu, S.; Dahanayaka, S.; Wu, G. Glycine is a nutritionally essential amino acid for maximal growth of milk-fed young pigs. Amino Acids 2014, 46, 2037–2045. [Google Scholar] [CrossRef] [PubMed]
- Newstead, S. Recent advances in understanding proton coupled peptide transport via the POT family. Curr. Opin. Struct. Biol. 2017, 45, 17–24. [Google Scholar] [CrossRef] [Green Version]
- D’Inca, R.; Guen, C.G.-L.; Che, L.; Sangild, P.T.; Huërou-Luron, I.L. Intrauterine growth restriction delays feeding-induced gut adaptation in term newborn pigs. Neonatology 2011, 99, 208–216. [Google Scholar] [CrossRef] [PubMed]
- Thongsong, B.; Suthongsa, S.; Wiyaporn, M. Postnatals ontogeny of small intestinal histomorphology, crypt cell proliferation and peptide transporter 1 gene expression in piglets. Thai J. Vet. Med. 2016, 46, 391–399. [Google Scholar]
- Thongsong, B.; Wiyaporn, M.; Kalandakanond-Thongsong, S. Blood glucose, amino acid profiles and nutrient transporter gene expressions in the small intestine of low and normal birthweight piglets during the early suckling period. Vet. J. 2019, 247, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Poulsen, S.B.; Fenton, R.A.; Rieg, T. Sodium-Glucose cotransport. Curr. Opin. Nephrol. Hypertens. 2015, 24, 463–469. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sangild, P.T.; Petersen, Y.M.; Schmidt, M.; Elnif, J.; Petersen, T.K.; Buddington, R.K.; Greisen, G.; Michaelsen, K.F.; Burrin, D.G. Preterm birth affects the intestinal response to parenteral and enteral nutrition in newborn pigs. J. Nutr. 2002, 132, 2673–2681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Sequence (5′-3′) | Accession Number | Product Size (bp) |
---|---|---|---|
Enzyme genes | |||
ALP | F: CCACTCCGCGCCACC | XM_021097682.1 | 76 |
R: AAGAGCTCGTGGGTGAAGG | |||
SI | F: TGATAGGCCAGTGAGAGTGC | XM_021069748.1 | 99 |
R: AGAGTTGAGTAAGGCTGCCA | |||
Nutrient transporter genes | |||
SGLT1 | F: GGCTGGACGAAGTATGGTGT | NM_001164021.1 | 153 |
R: ACAACCACCCAAATCAGAGC | |||
EAAC1 | F: GTTCCTGATTGCCGGGAAGA | NM_001164649.1 | 165 |
R: ATGGCGAATCGGAAAGGGTT | |||
ASCT2 | F: GCCAGCAAGATTGTGGAGAT | XM_003355984.4 | 206 |
R: GAGCTGGATGAGGTTCCAAA | |||
B0AT1 | F: AAGGCCCAGTACATGCTCAC | XM_0033559855.4 | 102 |
R: CATAAATGCCCCTCCACCGT | |||
PepT1 | F: CATCGCCATACCCTTCTG | NM_214347.1 | 143 |
R: TTCCCATCCATCGTGACATT | |||
Barrier function genes | |||
ZO-1 | F: GATCCTGACCCGGTGTCTGA | XM_021098896.1 | 200 |
R: TTGGTGGGTTTGGTGGGTT | |||
CLDN3 | F: CTACGACCGCAAGGACTACG | NM_001160075.1 | 123 |
R: TAGCATCTGGGTGGACTGGT | |||
Internal reference gene | |||
CycA | F: GCGTCTCCTTCGAGCTGTT | NM_214353.1 | 160 |
R: CCATTATGGCGTGTGAAGTC |
LBW | NBW | p-Value | ||||||
---|---|---|---|---|---|---|---|---|
Genes | RN | NN | RN | NN | SEM | BWC | DT | BWC × DT |
Claudin-3 | 0.578 | 1.000 | 0.471 | 0.546 | 0.17 | 0.086 | 0.126 | 0.279 |
ZO1 | 0.836 | 1.001 | 0.734 | 0.997 | 0.26 | 0.835 | 0.405 | 0.847 |
ALP | 4.505 a | 1.000 b | 0.564 b | 2.384 a,b | 1.22 | 0.283 | 0.477 | 0.031 |
SI | 4.154 | 1.000 | 1.038 | 1.564 | 1.08 | 0.226 | 0.214 | 0.086 |
EAAC1 | 1.968 | 0.998 | 3.198 | 3.877 | 0.99 | 0.043 | 0.881 | 0.402 |
B0AT1 | 1.228 | 1.001 | 1.867 | 2.696 | 0.41 | 0.007 | 0.464 | 0.203 |
PEPT1 | 1.545 | 1.000 | 2.519 | 2.593 | 0.39 | 0.002 | 0.533 | 0.414 |
SGLT1 | 1.627 a,b | 1.000 b | 1.598 a,b | 2.127 a | 0.27 | 0.048 | 0.853 | 0.038 |
ASCT2 | 0.531 | 1.000 | 0.154 | 0.459 | 0.36 | 0.189 | 0.267 | 0.812 |
LBW | NBW | p-Value | ||||||
---|---|---|---|---|---|---|---|---|
Genes | RN | NN | RN | NN | SEM | BWC | DT | BWC × DT |
Claudin 3 | 0.952 | 1.510 | 0.250 | 2.171 | 0.37 | 0.955 | 0.002 | 0.075 |
ZO1 | 0.596 | 2.098 | 0.420 | 3.293 | 0.52 | 0.338 | <0.001 | 0.200 |
ALP | 0.688 b | 7.321 b | 0.656 b | 20.934 a | 3.11 | 0.041 | <0.001 | 0.041 |
SI | 2.594 b | 4.977 b | 1.097 b | 15.718 a | 2.28 | 0.052 | <0.001 | 0.012 |
EAAC1 | 0.574 | 1.371 | 1.593 | 1.931 | 0.53 | 0.148 | 0.294 | 0.669 |
B0AT1 | 1.264 | 2.776 | 0.685 | 4.455 | 0.69 | 0.435 | <0.001 | 0.116 |
PEPT1 | 1.114 | 1.235 | 1.820 | 1.150 | 0.49 | 0.532 | 0.581 | 0.427 |
SGLT1 | 0.679 | 0.552 | 0.595 | 0.971 | 0.20 | 0.413 | 0.539 | 0.222 |
ASCT2 | 0.556 | 1.520 | 0.130 | 3.018 | 0.61 | 0.388 | 0.004 | 0.127 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wellington, M.O.; Rodrigues, L.A.; Li, Q.; Dong, B.; Panisson, J.C.; Yang, C.; Columbus, D.A. Birth Weight and Nutrient Restriction Affect Jejunal Enzyme Activity and Gene Markers for Nutrient Transport and Intestinal Function in Piglets. Animals 2021, 11, 2672. https://doi.org/10.3390/ani11092672
Wellington MO, Rodrigues LA, Li Q, Dong B, Panisson JC, Yang C, Columbus DA. Birth Weight and Nutrient Restriction Affect Jejunal Enzyme Activity and Gene Markers for Nutrient Transport and Intestinal Function in Piglets. Animals. 2021; 11(9):2672. https://doi.org/10.3390/ani11092672
Chicago/Turabian StyleWellington, Michael O., Lucas A. Rodrigues, Qiao Li, Bingqi Dong, Josiane C. Panisson, Chengbo Yang, and Daniel A. Columbus. 2021. "Birth Weight and Nutrient Restriction Affect Jejunal Enzyme Activity and Gene Markers for Nutrient Transport and Intestinal Function in Piglets" Animals 11, no. 9: 2672. https://doi.org/10.3390/ani11092672