Influence of Sodium Humate on the Growth Performance, Diarrhea Incidence, Blood Parameters, and Fecal Microflora of Pre-Weaned Dairy Calves
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Housing, and Management
2.2. Experimental Design and Sample Collection
2.3. Growth Performance, Fecal Score, and Diarrhea Incidence
2.4. Blood Parameters
2.5. Fecal Microflora Populations
2.6. Statistical Analysis
3. Results
3.1. Growth Performance and Diarrhea Incidence
3.2. Blood Parameters
3.3. Serum Immunoglobulin, Inflammatory Cytokine Levels, and Antioxidant Status
3.4. Fecal Microflora
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cho, Y.; Yoon, K. An overview of calf diarrhea—Infectious etiology, diagnosis, and intervention. J. Vet. Sci. 2014, 15, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Urie, N.J.; Lombard, J.E.; Shivley, C.B.; Kopral, C.A.; Adams, A.E.; Earleywine, T.J.; Olson, J.D.; Garry, F.B. Preweaned heifer management on US dairy operations: Part V. Factors associated with morbidity and mortality in preweaned dairy heifer calves. J. Dairy Sci. 2018, 101, 9229–9244. [Google Scholar] [CrossRef] [Green Version]
- Cho, Y.; Han, J.; Wang, C.; Cooper, V.; Schwartz, K.; Engelken, T.; Yoon, K.J. Case–control study of microbiological etiology associated with calf diarrhea. Vet. Microbiol. 2013, 166, 375–385. [Google Scholar] [CrossRef]
- Villot, C.; Ma, T.; Renaud, D.L.; Ghaffari, M.H.; Gibson, D.J.; Skidmore, A. Saccharomyces cerevisiae boulardii CNCM I-1079 affects health, growth, and fecal microbiota in milk-fed veal calves. J. Dairy Sci. 2019, 102, 7011–7025. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ozkan, A.; Sen, H.M.; Sehitoglu, I.; Alacam, H.; Guven, M.; Aras, A.B. Neuroprotective effect of humic acid on focal cerebral ischemia injury: An experimental study in rats. Inflammation 2015, 38, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.Y.; Zhang, A.J.; Chen, X.; Che, X.B.; Zhou, K.; Wang, Z.D. Sodium humate accelerates cutaneous wound healing by acti vating TGF-β/Smads signaling pathway in rats. Acta Pharm. Sin. B 2016, 6, 132–140. [Google Scholar] [CrossRef] [Green Version]
- Trckova, M.; Lorencova, A.; Babak, V.; Neca, J.; Ciganek, M. Effects of sodium humate and zinc oxide used in prophylaxis of post-weaning diarrhoea on the health, oxidative stress status and fatty acid profile in weaned piglets. Vet. Med. 2017, 62, 16–28. [Google Scholar] [CrossRef] [Green Version]
- Arif, M.; Alagawany, M.; El-Hack, M.E.A.; Saeed, M.; Elnesr, S.S. Humic acid as a feed additive in poultry diets: A review. Iran. J. Vet. Res. 2019, 20, 167–172. [Google Scholar]
- Kaevska, M.; Lorencova, A.; Videnska, P.; Sedlar, K.; Provaznik, I.; Trckova, M. Effect of sodium humate and zinc oxide used in prophylaxis of post-weaning diarrhoea on faecal microbiota composition in weaned piglets. Vet. Med. 2016, 61, 328–336. [Google Scholar] [CrossRef] [Green Version]
- Murbach, T.S.; Glávits, R.; Endres, J.R.; Clewell, A.E.; Hirka, G.; Vértesi, A.; Béres, E.; Szakonyiné, I.P. A toxicological evaluation of a fulvic and humic acids preparation. Toxicol. Rep. 2020, 7, 1242–1254. [Google Scholar] [CrossRef]
- Bai, H.X.; Chang, Q.F.; Shi, B.M.; Shan, A.S. Effects of fulvic acid on growth performance and meat quality in growing-finishing pigs. Livest. Sci. 2013, 158, 118–123. [Google Scholar] [CrossRef]
- Taklimi, S.M.S.M.; Ghahri, H.; Isakan, M.A. Influence of different levels of humic acid and esterified glucomannan on growth performance and intestinal morphology of broiler chickens. Agric. Sci. 2012, 3, 663–668. [Google Scholar] [CrossRef] [Green Version]
- Chudoba-Drozdowska, B.; Janeczek, W.; Kupczyński, R. Influence of brown coal, humic acids and their mixture fed to calves on health and formation of chosen blood indexes. Vet. Med. Czech. 2000, 45, 116–117. [Google Scholar]
- Renaud, D.L.; Kelton, D.F.; Weese, J.S.; Noble, C.; Duffield, T.F. Evaluation of a multispecies probiotic as a supportive treatment for diarrhea in dairy calves: A randomized clinical trial. J. Dairy Sci. 2019, 102, 4498–4505. [Google Scholar] [CrossRef]
- Chen, H.; Mao, X.; He, J.; Yu, B.; Huang, Z.; Yu, J.; Zheng, P.; Chen, D. Dietary fibre affects intestinal mucosal barrier function and regulates intestinal bacteria in weaning piglets. Br. J. Nutr. 2013, 110, 1837–1848. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Denman, S.E.; McSweeney, C.S. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef] [PubMed]
- Cleusix, V.; Lacroix, C.; Dasen, G.; Leo, M.; Le Blay, G. Comparative study of a new quantitative real-time PCR targeting the xylulose-5-phosphate/fructose-6-phosphate phosphoketolase bifidobacterial gene (xfp) in faecal samples with two fluorescence in situ hybridization methods. J. Appl. Microbiol. 2010, 108, 181–193. [Google Scholar] [CrossRef]
- Torrallardona, D.; Badiola, I.; Broz, J. Effects of benzoic acid on performance and ecology of gastrointestinal microbiota in weanling piglets. Livest. Sci. 2007, 108, 210–213. [Google Scholar] [CrossRef]
- Wang, W.; Chen, L.; Zhou, R.; Wang, X.; Song, L.; Huang, S. Increased proportions of bifidobacterium and the lactobacillus group and loss of Butyrate-Producing bacteria in inflammatory bowel disease. J. Clin. Microbiol. 2014, 52, 398–406. [Google Scholar] [CrossRef] [Green Version]
- Sapountzis, P.; Segura, A.; Desvaux, M.; Forano, E. An overview of the elusive passenger in the gastrointestinal tract of cattle: The shiga toxin producing escherichia coli. Microorganisms 2020, 8, 877. [Google Scholar] [CrossRef]
- Wang, Q.; Chen, Y.J.; Yoo, J.S.; Kim, H.J.; Cho, J.H.; Kim, I.H. Effects of supplemental humic substances on growth performance, blood characteristics and meat quality in finishing pigs. Livest. Sci. 2008, 117, 270–274. [Google Scholar] [CrossRef]
- Ozturk, E.; Ocak, N.; Turan, A.; Erener, G.; Altop, A.; Cankaya, S. Performance, carcass, gastrointestinal tract and meat quality traits, and selected blood parameters of broilers fed diets supplemented with humic substances. J. Sci. Food Agric. 2012, 92, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Zheng, B.; Ying, M.; Xie, J.; Chen, Y.; Wang, Y.; Ding, X. A Ganoderma atrum polysaccharide alleviated DSS-induced ulcerative colitis by protecting the apoptosis/autophagy-regulated physical barrier and the DC-related immune barrier. Food Funct. 2020, 11, 10690–10699. [Google Scholar] [CrossRef]
- Maguey-Gonzalez, J.A.; Michel, M.A.; Baxter, M.F.A.; Solis-Cruz, B.; Hernandez-Patlan, D.; Merino-Guzman, R. Effects of humic acids on recovery of Salmonella enterica serovar Enteritidis. Ann. Anim. Sci. 2018, 10, 30–37. [Google Scholar] [CrossRef] [Green Version]
- Wu, M.; Xiao, H.; Liu, G.; Chen, S.; Tan, B.; Ren, W. Glutamine promotes intestinal SIgA secretion through intestinal microbiota and IL-13. Mol. Nutr. Food Res. 2016, 60, 1637–1648. [Google Scholar] [CrossRef] [PubMed]
- Slanzon, G.S.; Toledo, A.F.; Silva, A.P.; Coelho, M.G.; Da Silva, M.D.; Cezar, A.M. Red propolis as an additive for preweaned dairy calves: Effect on growth performance, health, and selected blood parameters. J. Dairy Sci. 2019, 102, 8952–8962. [Google Scholar] [CrossRef]
- Maldonado, N.C.; Chiaraviglio, J.; Bru, E.; De Chazal, L.; Santos, V.; Nader-Macias, M. Effect of milk fermented with lactic acid bacteria on diarrheal incidence, growth performance and microbiological and blood profiles of newborn dairy calves. Probiotics Antimicrob. Proteins 2018, 10, 668–676. [Google Scholar] [CrossRef]
- Vucskits, A.V.; Hullár, I.; Bersényi, A.; Andrásofszky, E.; Kulcsár, M.; Szabó, J. Effect of fulvic and humic acids on performance, immune response and thyroid function in rats. J. Anim. Physiol. Anim. Nutr. 2010, 94, 721–728. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Ying, J.; Zou, P.; Zhou, Y.; Wang, B.; Yu, D. Effects of dietary supplementation of humic acid sodium and zinc oxide on growth performance, immune status and antioxidant capacity of weaned piglets. Animals 2020, 10, 2104. [Google Scholar] [CrossRef]
- Hwang, P.; Lin, H.; Lin, H.; Lo, S. Dietary supplementation with low-molecular-weight fucoidan enhances innate and adaptive immune responses and protects against mycoplasma pneumoniae antigen stimulation. Mar. Drugs 2019, 17, 175. [Google Scholar] [CrossRef] [Green Version]
- Tohid, T.; Hasan, G.; Alireza, T. Efficacy of mannanoligosaccharides and humate on immune response to avian influenza (H9) disease vaccination in broiler chickens. Vet. Res. Commun. 2010, 34, 709–717. [Google Scholar] [CrossRef]
- Xu, J.; Li, Y.; Yang, Z.; Li, C.; Liang, H.; Wu, Z.; Pu, W. Yeast probiotics shape the gut microbiome and improve the health of early-weaned piglets. Front. Microbiol. 2018, 9, 2011. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Xie, L.; Zhang, Z.; Zhang, W.; Tang, J.; He, X.; Zhou, J.; Peng, W. Tremella fuciformis polysaccharides inhibited colonic inflammation in dextran sulfate sodium-treated mice via foxp3+ t cells, gut microbiota, and bacterial metabolites. Front. Immunol. 2021, 12, 648162. [Google Scholar] [CrossRef] [PubMed]
- Alessandri, G.; Ossiprandi, M.C.; MacSharry, J.; van Sinderen, D.; Ventura, M. Bifidobacterial dialogue with its human host and consequent modulation of the immune system. Front. Immunol. 2019, 10, 2348. [Google Scholar] [CrossRef] [Green Version]
- Izumi, H.; Ehara, T.; Sugahara, H.; Matsubara, T.; Mitsuyama, E.; Nakazato, Y.; Tsuda, M.; Shimizu, T.; Odamaki, T.; Xiao, J.Z.; et al. The combination of Bifidobacterium breve and three prebiotic oligosaccharides modifies gut immune and endocrine functions in neonatal mice. J. Nutr. 2019, 149, 344–353. [Google Scholar] [CrossRef] [PubMed]
- Borish, L.C.; Steinke, J.W. Cytokines and chemokines. J. Allergy Clin. Immunol. 2003, 111, S460–S475. [Google Scholar] [CrossRef]
- Van Rensburg, C.E.J. The anti-inflammatory properties of humic substances: A mini review. Phytother. Res. 2015, 29, 791–795. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Cui, Y.; Su, Y.; Gao, Z.; Diao, X.; Li, J. Dietary fiber ameliorates lipopolysaccharide-induced intestinal barrier function damage in piglets by modulation of intestinal microbiome. mSystems 2021, 6, e01374-20. [Google Scholar] [CrossRef]
- Duarte, M.E.; Zhou, F.X.; Dutra, W.M.; Kim, S.W. Dietary supplementation of xylanase and protease on growth performance, digesta viscosity, nutrient digestibility, immune and oxidative stress status, and gut health of newly weaned pigs. Anim. Nutr. 2019, 5, 351–358. [Google Scholar] [CrossRef]
- Mao, Y. Modulation of the growth performance, meat composition, oxidative status, and immunity of broilers by dietary fulvic acids. Poult. Sci. 2019, 98, 4509–4513. [Google Scholar] [CrossRef]
- Vašková, J.; Veliká, B.; Pilátová, M.; Kron, I.; Vaško, L. Effects of humic acids in vitro. In Vitro Cell. Dev. Biol. Anim. 2011, 47, 376–382. [Google Scholar] [CrossRef]
- Kim, H.S.; Whon, T.W.; Sung, H.; Jeong, Y.; Jung, E.S.; Shin, N. Longitudinal evaluation of fecal microbiota transplantation for ameliorating calf diarrhea and improving growth performance. Nat. Commun. 2021, 12, 161. [Google Scholar] [CrossRef]
- Zou, T.; Yang, J.; Guo, X.; He, Q.; Wang, Z.; You, J. Dietary seaweed-derived polysaccharides improve growth performance of weaned pigs through maintaining intestinal barrier function and modulating gut microbial populations. J. Anim. Sci. Biotechnol. 2021, 12, 28. [Google Scholar] [CrossRef] [PubMed]
- Alipour, M.J.; Jalanka, J.; Pessa-Morikawa, T.; Kokkonen, T.; Satokari, R.; Hynönen, U. The composition of the perinatal intestinal microbiota in cattle. Sci. Rep. 2018, 8, 10437. [Google Scholar] [CrossRef]
- Domínguez-Negrete, A.; Gómez-Rosales, S.; Angeles, M.D.L.; López-Hernández, L.H.; Reis-de Souza, T.C.; López-García, Y. Effect of the addition of humic substances as growth promoter in broiler chickens under two feeding regimens. Animals 2019, 9, 1101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Macri, B.; Lanteri, G.; Capucchio, M.T.; Ieni, A.; Marino, F. Prophylaxis of post-weaning diarrhoea in piglets by zinc oxide and sodium humate. Vet. Med. 2016, 60, 288–291. [Google Scholar] [CrossRef] [Green Version]
- Qiao, J.; Sun, Z.; Liang, D.; Li, H. Lactobacillus salivarius alleviates inflammation via NF-κB signaling in ETEC K88-induced IPEC-J2 cells. J. Anim. Sci. Biotechnol. 2020, 11, 76. [Google Scholar] [CrossRef] [PubMed]
- Singh, S.; Bhatia, R.; Khare, P.; Sharma, S.; Rajarammohan, S.; Bishnoi, M.; Bhadada, S.; Sharma, S.S.; Kaur, J.; Kondepudi, K.K. Anti-inflammatory Bifidobacterium strains prevent dextran sodium sulfate induced colitis and associated gut microbial dysbiosis in mice. Sci. Rep. 2020, 29, 18597. [Google Scholar] [CrossRef]
Item 1 | Sequence (5′-3′) | Product Size, bp | References |
---|---|---|---|
TB | F: CGGCAACGAGCGCAACCC R: CCATTGTAGCACGTGTGTAGCC | 146 | Denman and McSweeney. (2006) [16] |
Bif | F: GATTCTGGCTCAGGATGAACGC R: CTGATAGGACGCGACCCCAT | 230 | Cleusix et al. (2010) [17] |
Bac | F: GCAACGAGCGCAACCCTTGA R: TCATCCCCACCTTCCTCCGGT | 92 | Torrallardona et al. (2007) [18] |
Lac | F: AGCAGTAGGGAATCTTCCA R: CACCGCTACACATGGAG | 341 | Wang et al. (2014) [19] |
E. coli | F: CATGCCGCGTGTATGAAGAA R: CGGGTAACGTCAATGAGCAAA | 96 | Sapountzis et al. (2020) [20] |
Item 1 | NaH Concentration | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
0 | 1 g | 3 g | 5 g | |||
BW, kg | ||||||
d 0 | 41.7 | 39.8 | 39.6 | 39.4 | 0.675 | 0.628 |
d 21 | 52.4 | 51.8 | 53.3 | 55.1 | 1.050 | 0.740 |
d 53 | 78.7 | 79.2 | 80.1 | 85.2 | 1.456 | 0.390 |
d 0 to 21 | ||||||
ADFI, g | 104.8 | 108.6 | 127.1 | 142.9 | 0.007 | 0.296 |
ADG, g | 509.5 b | 571.4 ab | 652.4 ab | 747.6 a | 0.035 | 0.045 |
d 21 to 53 | ||||||
ADFI, g | 1191.4 | 1197.9 | 1215.7 | 1274.3 | 0.019 | 0.438 |
ADG, g | 821.9 b | 856.3 ab | 837.5 ab | 940.6 a | 0.022 | 0.047 |
Fecal score | ||||||
d 1 to 20 | 2.3 a | 1.8 ab | 1.6 b | 1.5 c | 0.071 | 0.022 |
d 21 to 53 | 1.6 | 1.6 | 1.5 | 1.4 | 0.06 | 0.746 |
Diarrhea incidence, % | ||||||
d 1 to 20 | 35.7 | 29.3 | 20.6 | 18.6 | ||
d 21 to 53 | 16.3 | 14.9 | 11.1 | 10.3 |
Item 1 | NaH Concentration | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
0 | 1 g | 3 g | 5 g | |||
WBC, 109/L | 9.92 | 10.92 | 9.66 | 9.88 | 0.760 | 0.949 |
RBC, 1012/L | 9.44 | 9.21 | 9.89 | 9.76 | 0.143 | 0.340 |
HGB, g/L | 100.2 | 98.8 | 102 | 106.2 | 1.667 | 0.456 |
TP, g/L | 56.75 | 57.31 | 59.08 | 56.71 | 0.534 | 0.395 |
ALT, U/L | 12.88 | 11.67 | 14.82 | 14.86 | 1.534 | 0.892 |
ALP, U/L | 342.75 | 375.75 | 393.19 | 382.03 | 16.523 | 0.787 |
GLU, mmol/L | 6.8 | 6.91 | 7.63 | 7.65 | 0.193 | 0.112 |
BUN, mmol/L | 7.95 | 6.69 | 6.8 | 8.47 | 0.344 | 0.184 |
GH, ng/mL | 5.23 | 5.17 | 5.2 | 5.36 | 0.060 | 0.759 |
IGFs, U/L | 11.16 | 10.88 | 11.23 | 11.8 | 0.224 | 0.593 |
Item 1 | NaH Concentration | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
0 | 1 g | 3 g | 5 g | |||
IgA, µg/mL | 69.13 b | 71.64 ab | 79.41 ab | 80.54 a | 2.010 | 0.014 |
IgG, µg/mL | 985.02 c | 997.25 bc | 1114.96 b | 1128.50 a | 25.267 | 0.046 |
IgM, µg/mL | 69.13 | 70.39 | 70.73 | 70.67 | 0.380 | 0.460 |
IL-4, ng/L | 49.13 b | 52.47 ab | 61.55 a | 62.25 a | 2.155 | 0.038 |
IL-6, ng/L | 8.20 a | 7.43 a | 7.77 a | 6.38 b | 0.265 | 0.042 |
TNF-α, ng/L | 203.85 a | 185.85 ab | 188.56 ab | 164.68 b | 4.536 | 0.030 |
IL-10, ng/L | 19.43 | 20.07 | 20.59 | 21.20 | 0.332 | 0.299 |
DAO, pg/mL | 196.05 | 188.87 | 177.64 | 168.41 | 5.126 | 0.249 |
D-lac, µg/L | 219.27 a | 206.77 ab | 193.89 b | 189.83 b | 4.165 | 0.018 |
GSH, µmol/L | 64.70 | 67.72 | 65.90 | 72.77 | 1.627 | 0.344 |
GSH-Px, U/mL | 63.34 | 62.86 | 67.25 | 67.92 | 1.638 | 0.737 |
T-SOD, U/mL | 43.70 b | 43.94 b | 47.08 ab | 55.67 a | 2.016 | 0.049 |
T-AOC, U/mL | 5.97 b | 6.11 b | 6.18 ab | 6.35 a | 0.050 | 0.023 |
MDA, nmol/mL | 2.33 a | 2.26 ab | 2.21 ab | 2.10 b | 0.036 | 0.041 |
Item 1 log10 Cells/g Digesta | NaH Concentration | SEM 2 | p-Value | |||
---|---|---|---|---|---|---|
0 | 1 g | 3 g | 5 g | |||
TB | 11.91 | 11.8 | 11.89 | 11.9 | 0.071 | 0.945 |
Bif | 6.53 b | 6.98 ab | 7.16 ab | 7.63 a | 0.141 | 0.035 |
Bac | 7.37 | 7.3 | 7.59 | 7.67 | 0.130 | 0.751 |
Lac | 6.55 b | 6.71 ab | 7.22 ab | 7.58 a | 0.176 | 0.036 |
E. coli | 7.62 a | 7.05 ab | 6.53 b | 6.46 b | 0.135 | 0.004 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, D.; You, Z.; Du, Y.; Zheng, D.; Jia, H.; Liu, Y. Influence of Sodium Humate on the Growth Performance, Diarrhea Incidence, Blood Parameters, and Fecal Microflora of Pre-Weaned Dairy Calves. Animals 2022, 12, 123. https://doi.org/10.3390/ani12010123
Wang D, You Z, Du Y, Zheng D, Jia H, Liu Y. Influence of Sodium Humate on the Growth Performance, Diarrhea Incidence, Blood Parameters, and Fecal Microflora of Pre-Weaned Dairy Calves. Animals. 2022; 12(1):123. https://doi.org/10.3390/ani12010123
Chicago/Turabian StyleWang, Dong, Zhendong You, Yuanyi Du, Duo Zheng, Haotian Jia, and Yun Liu. 2022. "Influence of Sodium Humate on the Growth Performance, Diarrhea Incidence, Blood Parameters, and Fecal Microflora of Pre-Weaned Dairy Calves" Animals 12, no. 1: 123. https://doi.org/10.3390/ani12010123