Next Article in Journal
Replacement of Maize Silage and Soyabean Meal with Mulberry Silage in the Diet of Hu Lambs on Growth, Gastrointestinal Tissue Morphology, Rumen Fermentation Parameters and Microbial Diversity
Previous Article in Journal
A Preliminary Study on the Effects of Taurine-Enriched Rotifers on the Growth and Survival of the Small Yellow Croaker Larimichthys polyactis Larvae
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Regulation of Tight Junctions by Sex Hormones in Goat Mammary Epithelial Cells

College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Animals 2022, 12(11), 1404; https://doi.org/10.3390/ani12111404
Submission received: 1 April 2022 / Revised: 24 May 2022 / Accepted: 27 May 2022 / Published: 30 May 2022
(This article belongs to the Section Small Ruminants)

Abstract

:

Simple Summary

How ovarian hormones affect goat lactation by regulating cell–cell junctions is still unclear. Through the in vivo and in vitro assays, we found that ovarian hormones could elevate cell–cell junction protein expression, which may affect the intercellular space and molecule transportation between the goat mammary epithelial cells. Our assessment suggests that ovarian hormones may affect goat milk production by regulating the cell–cell junction protein expression between mammary epithelial cells.

Abstract

The sex hormones of estrogen and progesterone (P4) play a vital role in mammary gland development and milk lactation in ruminants. The tight junction (TJ) between adjacent secretory epithelial cells is instrumental in establishing the mammary blood–milk barrier. However, whether estrogen and P4 exert their effect on mammary function via regulating TJ remain unclear. Here, to clarify the role of 17-β estradiol (E2) and P4 in the regulation of TJ in goat mammary gland, we first explored the relationships between the concentrations of E2, P4, and the protein expression of claudin-1, claudin-3, occludin, and ZO-1 during the mammary gland development in goat. Then, we further explored the mRNA and protein expression of claudin-1, claudin-3, occludin, and ZO-1 in the goat mammary epithelial cells (GMECs) in vitro under different concentrations of E2 and P4. The results demonstrated that the protein expression of claudin-1 decreased, but occludin and ZO-1 increased with the decline in E2 and P4 during the transition from pregnancy to lactation. In the in vitro studies, E2 exerted a positive effect on the mRNA expression of claudin-1, and accelerated the proteins’ expression of claudin-1 and ZO-1 in GMECs; P4 upregulated the mRNA expression of claudin-1, claudin-3, occludin, and ZO-1, and also improved the protein expression of claudin-1, claudin-3, and ZO-1 in the GMECs. The results demonstrated that E2 and P4 play an important role in regulating the expression of the mammary TJ components, which may ultimately affect the mammary gland development and milk lactation.

1. Introduction

Mammary development begins in early fetal life, occurs slightly during puberty, while complete mammogenesis takes place during pregnancy and become fully functional after parturition. All these steps of the mammary gland development are tightly coordinated both by systemic hormones and local factors. Secretory differentiation of the alveolar mammary epithelial cells (MECs) starts around mid-pregnancy and become competent to produce and secrete some milk components at late pregnancy, while only until parturition, the milk secretion can be triggered [1]. The tight junction (TJ) is an important intercellular junctional complex that plays a vital role in controlling the epithelial barrier [2,3]. In the mammary gland, the TJ acts as both a barrier and a fence: it could prevent the paracellular transport of ions and small molecules across the cell bed (barrier function) as well as separate the cell membrane into distinct domains of protein and lipids (fence function). The mammary epithelium is leaky before lactation, while during the first days of lactation, the bidirectional paracellular exchange of molecules between the interstitial space and alveolar lumen is inhibited due to the closure of the TJ triggered by the hormonal changes. From pregnancy to lactation, the molecules can enter milk from depending on the paracellular pathways into that of the transcellular pathways to adapt to the high secretory state after parturition, which may be due to the open or closure of the tight junction (TJ) [4]. In the transition goats, the circulating electrolytes such as Na, Cl, Mg, and K were assumed to change following the different distribution of fluids in late gestation, birthing, and early lactation [5], while the loss of the TJ integrity in the goat mammary gland during lactation was closely related to milk reduction and the disturbance of the epithelia barrier [6,7,8]. Cows producing unstable milk presented elevated tight junction permeability [9,10].
Ovarian hormones of 17β-estrogen (E2) and progesterone (P4) are instrumental for mammary epithelial cell proliferation, ductal morphogenesis, mammary epithelium side branching, and alveolar formation during puberty and pregnancy [11]. There is solid evidence that glucocorticoids, prolactin, and steroids are required for the formation and maintenance of mammary TJ. Studies into whether through ovariectomy or by exogenous administration reported that P4 played an important role in preventing mammary TJ formation [4]. In amniotic epithelium, the P4/progesterone receptor (PR) pathway maintains the TJ by increasing claudin-3 and claudin-4 expression in a dose-dependent manner during mid-pregnancy [12]. Unlike P4, a vitro study on human primary gut tissues demonstrated that estrogen treatment decreased zonula occluden 1 (ZO-1) mRNA and protein expression, which suggested that estrogen played a role in the gut tight junction expression and permeability [13]. In the female vagina, estrogen replacement could restore the decreased expression of ZO-1, occludin, and claudin-1 to the control level after ovariectomy [14]. These studies suggest the important role of estrogen and P4 on modulating the expression of TJ in different tissues. However, though TJ plays an important role in maintaining the milk components in ruminant animals, studies have rarely reported on the expression pattern of TJ proteins and how ovarian hormones regulate the TJ proteins, which may affect lactation. Since the TJ structure is composed of transmembrane proteins of claudins and occludin as well as scaffolding proteins of ZO, the TJ formation or structure may vary with the change in the expression of the TJ components. Thus, in the current study, we aimed to investigate the precise function of estrogen and P4 on the expression of mammary TJ components during transition, which may then affect the TJ opening or closure, and finally, milk lactation. The current research will be useful in clarifying the mechanism of how E2 and P4 affect lactation through regulating the tight junction.

2. Materials and Methods

2.1. Animals and Mammary Tissue Collection

A total of fifteen female hybrids of Boer goat and Macheng black goat at the age of eight-months old (puberty) were provided by the Hubei Academy of Agricultural Sciences, Wuhan, Hubei Province, China. These goats were all healthy and on their first birth to lambs. One week was allowed for their adaption to the housing environment. Goats were mated for pregnancy. Mammary tissue and blood were collected from the goats at the age of puberty (8-months old), pregnancy day 91 (Pd91), Pd137, lactation day 4 (Ld4), and Ld31. Usually, a skin incision is made in the avascular area on the mid-abdominal line between two mammary glands and then about 1 cm3 mammary tissue in size was collected, which was 2–3 cm deep under the skin on one mammary gland. Tissues in different groups were collected from the same side of the mammary gland using a surgical method under general anesthesia (intravenous injection of Sumianxin, 0.01 mL/kg, Veterinary Research Institute, Jilin, China) [15]. The collected tissues were rinsed in phosphate buffered saline (PBS) for cell culture or were stored in liquid nitrogen for protein extraction. Every effort was made to reduce the number of animals used and the pain they suffered. All animal experiments were approved by the Animal Care and Use Committee of Huazhong Agricultural University (ID number: HZAURA-2015-008).

2.2. Preparation of Goat Mammary Epithelial Cells

The goat mammary tissues were acquired from the 8-month-old hybrids derived from Boer goats and Macheng black goats. The tissues were washed with PBS solution several times. Then, they were treated with 75% absolute ethanol and PBS, respectively. The surface layer of the tissue was removed and cut into a 1 mm3 block; these tissues were washed in PBS for 3–5 times until they were clean. Finally, the tissue blocks were washed with a culture medium of DMEM/F12 (Gibco, Beijing, China), and placed in 60 mm culture dishes. Four hours later, the explants were tightly attached to the dishes and 4 mL of culture medium of DMEM/F12 supplemented with 12% fetal bovine serum (FBS) was added gently into the dishes. The explants were finally cultured in a 38.5 °C, 5% CO2 incubator. About ten days later, both mammary epithelial cells and fibroblasts appeared in the dishes. Mammary epithelial cells could be purified from the fibroblasts after TE (0.25% trypsin/0.05% EDTA) digestion according to the different sensitivity of the cells to TE (fibroblasts are more sensitive to TE and can be digested in 1–2 min, while GMECs can be digested in 5–8 min).

2.3. Hormones Treatment on GMECs

Different concentrations of E2 (Sigma, St. Louis, MO, USA) and P4 (Sigma) were given to goat mammary epithelial cells (GMECs). The treatment on GMECs with a concentration of 10−8 M E2 (Sigma, St. Louis, MO, USA) and 10−6 M P4 was designated as the E2 + P4 group. The treatment on GMECs with a concentration of 1/16 × 10−8 M E2 and 10−6 M P4 was designated as the 1/16E2 + P4 group. The treatment on GMECs with concentration of 4 × 10−8 M E2 and 10−6 M P4 was designated as the 4E2 + P4 group. The treatment on GMECs with a concentration of 10−8 M E2 and 1/16 × 10−6 M P4 was designated as the E2 + 1/16P4 group. The treatment on GMECs with a concentration of 10−8 M E2 and 4 × 10−6 M P4 was designated as the E2 + 4P4 group. The treatment on GMECs with an equal volume of PBS reagent was designated as the control group. Following hormone treatment, the GMECs were harvested for extracting the mRNA and protein 24 h later.

2.4. ELISA

Blood was collected from the jugular vein of goats at the age of puberty (8-months old), Pd91, Pd137, Ld4, and Ld31. To acquire the serum, the blood was incubated at room temperature for 1 h, and centrifuged at 4000 rpm for 20 min. The collected serum was stored at −80 °C until use. Serum E2 and P4 were assayed with commercial ELISA kits for detecting human E2 and P4 (Beijing North Institute of Biotechnology Co. Ltd., Beijing, China), respectively. The intra- and inter-assay coefficients of variation (CV) were ≤15% for E2 or P4. The detection limits for E2 and P4 were ≤40 pg/mL and 0.2 ng/mL, respectively.

2.5. QRT-PCR

The RNA was extracted from the goat mammary epithelial cells by using the AG RNAex Pro Reagent (Accurate Biology, Hunan, China). Then, the total RNA was reverse transcribed into cDNA by the Thermo First cDNA Synthesis Kit (Hlingene Corporation, Shanghai, China). Quantitative real-time PCR was performed using the RealTimeFAST SYBR mix (Hlingene Corporation) to detect the gene expression of claudin-1, claudin-3, occludin, and ZO-1. The mRNA expression of β-actin served as the internal control. The primer sequences for each gene are listed in Table 1. All PCR products were cloned into the PMD18-T vector (TaKaRa, Dalian, China) for sequencing (Wuhan GeneCreate Biological Engineering Co. Ltd., Wuhan, China). The relative mRNA expression of the TJ related targets was quantified using the 2△△Ct method, where △△Ct = △Ct1 (experimental group)-△Ct2 (control group), and △Ct = Cttargetgen − Ctβ-actin.

2.6. Western Blot Analysis

The mammary tissues (collected from puberty, Pd91, Pd137, Ld4, and Ld31) or GMECs were lysed in RIPA lysis buffer (2 µL/mg, Beyotime, Shanghai, China) containing 1% protease inhibitor phenylmethanesulfonyl fluoride (PMSF) protease inhibitor. Proteins of claudin-1, claudin-3, occludin, and ZO-1 were separated using 12% SDS-PAGE gel and were transferred to polyvinylidene fluoride (PVDF) membrane (Biosharp, Wuhan, China). The dot-membranes were blocked in 5% skimmed milk for 2 h, and then were incubated with the primary antibody at 4 °C overnight. After being washed in tris buffer solution added with Tween-20 (TBST) three times, the dot-membranes were incubated with HRP-conjugated secondary antibody at room temperature for 2 h and were finally visualized through ECL (Biosharp, Wuhan, China). The primary antibodies of the rabbit anti-occludin antibody (1:1000, Affinity Biosciences, Cincinnati, OH, USA), rabbit anti-claudin-1 antibody (1:1000, ABclonal technology, Wuhan, China), rabbit anti-claudin-3 antibody (1:1000, Affinity Biosciences), rabbit anti-ZO-1 antibody (1:1000, Bioss antibodies, Beijing, China), rabbit anti-β-actin antibody (1:1000, CST, Boston, MA, USA), and secondary antibody of the HRP-conjugated Donkey anti-Rabbit IgG (1:4000, ABclonal technology, Wuhan, China) were used to detect the protein expression of occludin, claudin-1, claudin-3, and ZO-1. The quantification of the integrated optical identity (IOD) was performed by Image-Pro plus 6.0 software (Media Cybernetics, Rockville, MD, USA). The relative scales were calculated on the basis of β-actin expression.

2.7. Immunofluorescence

When the GMECs grew to 50–60% on the slides, immunofluorescence was performed. Briefly, the GMECs were rinsed with PBS and fixed with 4% paraformaldehyde. After being permeated with 0.3% Triton X-100 and blocked with 3% BSA, the GMECs were incubated with primary rabbit anti-CK18 antibody (1:50, Abcam, Cambridge, UK) overnight at 4 °C. Then, the coverslips were washed with PBS and incubated with secondary IFKineTM Red Donkey Anti-Rabbit IgG (1:200, Abbkine, Wuhan, China) for 1 h in the dark. After being washed with PBS, the coverslips were incubated with DAPI (Beyotime, Shanghai, China) for 5 min at room temperature. Finally, the cells were washed with PBS and imaged using an EVOS fl auto imaging system (Thermo Fisher Scientific Inc, Bothell, WA, USA).

2.8. Statistics

Data were analyzed using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). The concentrations of E2 and P4, mRNA, and protein expression of claudin-1, claudin-3, occludin, and ZO-1 in different groups were determined with one-way ANOVA. All data were represented as means ± SD. A value of p < 0.05 was considered as statistically significant.

3. Results

3.1. Mammary TJ Related Targets Changed with the Alteration of E2 and P4

Female goats at the stage of puberty, Pd91, Pd137, Ld4, and Ld31 were detected with the concentrations of E2, and P4. The results from ELISA showed that the E2 concentration increased from Pd91 to Pd137 (p = 0.007), while it decreased gradually from Ld4 to Ld31 (p = 0.001) (Figure 1A). P4 concentrations decreased from Pd91 to Pd137 (p = 0.001) and were maintained at steady low levels on Ld4 and Ld31 (Figure 1A). The ratios of E2 to P4 were low on Pd91 and Pd137, respectively, while it increased sharply on Ld4 (p < 0.001) and decreased to a low value on Ld31 (p < 0.001) (Figure 1A). Furthermore, during the transition of pregnancy to lactation, both the E2 and P4 concentrations decreased sharply from Pd137 to Ld4 (p = 0.038, Figure 1A), while the ratios of E2 to P4 increased greatly on Ld4 in comparison with that on Pd137 (p < 0.001, Figure 1A).
To evaluate whether the levels of E2 and P4 are associated with mammary TJ protein expression, we further analyzed the protein expression of mammary TJ related targets through Western blotting (Figure 1B). Figure 1B shows that the protein expression of claudin-1 decreased from Pd137 to Ld31 (p = 0.036 and p = 0.001), while claudin-3 was the highest on Pd91 (p < 0.001) but then decreased to lower levels on Pd137, Ld4, or Ld31 (p < 0.001). Occludin decreased from Pd91 to Pd137 (p < 0.001), while it increased from Pd137 to Ld4 (p < 0.001), and then deceased on Ld31 (p < 0.001) (Figure 1B). ZO-1 was maintained at low levels on Pd91 and Pd137 but increased abruptly on Ld4 (p < 0.001), and then decreased slightly on Ld31 (p < 0.001). These results demonstrate that from Pd137 to Ld31, the change in claudin-1 was consistent with the change in the E2 and P4 concentrations, while occludin and ZO-1 varied with the change in the E2 to P4 ratios.

3.2. E2 and P4 Affected the mRNA Expression of TJ Related Targets in Goat Mammary Epithelial Cells

Mammary epithelial cells and fibroblasts were mixed together when culturing goat mammary tissues after ten days later (Figure 2A). The GMECs were purified after 3–5 passages using different digesting times, and were identified with the biochemical marker of CK-18 (Figure 2B,C).
To further explore the effects of E2 and P4 on the TJ related targets, different levels of E2 and P4 were given to GMECs to assess the mRNA expression of the TJ components. The qRT-PCR results demonstrated that the mRNA levels of claudin-1 decreased when the E2 concentrations increased from 1/16E2 to 4E2 (p < 0.001), while it increased when the P4 concentrations increased from 1/16P4 to 4P4 (p < 0.001) (Figure 3A). There was no change in the mRNA levels of claudin-3, regardless of the whether the E2 concentrations changed among the 1/16E2, E2, and 4E2, but increased when the P4 level was elevated from 1/16P4 to 4P4 (p < 0.001) (Figure 3B). Similarly, there was no change in the mRNA levels of occludin or ZO-1 when the E2 levels increased from 1/16E2 to 4E2, while it increased gradually when the P4 levels rose from 1/16P4 to 4P4 (p < 0.001 and p < 0.001, respectively) (Figure 3C,D). These results indicate that E2 and P4 play different roles in regulating the TJ mRNAs and that P4 dominates the upregulation of the TJ components in the mRNAs.

3.3. E2 and P4 Altered Protein Expression of TJ Related Targets in Goat Mammary Epithelial Cells

Then, to assess whether E2 and P4 also affected the TJ protein expression, the expression of claudin-1, claudin-3, occludin, and ZO-1 in the GMECs treated with different levels of E2 and P4 were identified with Western blotting analysis. As shown in Figure 4, the protein expression of claudin-1 was elevated when the E2 concentrations increased from 1/16E2 to 4E2 (p = 0.022). Similarly, when the P4 levels increased from 1/16P4 to 4P4, the protein expression of claudin-1 was greatly enhanced (p < 0.001). However, there was no change in the protein expression of claudin-3 when the E2 concentrations were 1/16E2, E2, and 4E2, but it was elevated significantly when the P4 levels increased from 1/16P4 to 4P4 (p < 0.001). Unexpectedly, occludin did not change whenever E2 or P4 was altered. Surprisingly, the protein expression of ZO-1 was improved whenever the E2 levels increased from 1/16E2 to 4E2 (p < 0.001) or the P4 levels increased from 1/16P4 to 4P4 (p < 0.001). These results suggest that E2 and P4 accelerated the protein expression of the TJ related targets, and that P4 played a dominant role in upregulating the TJ proteins.

4. Discussion

As a mammary blood–milk barrier and a selective gate, the tight junction separates the milk-containing compartments from the surrounding extracellular fluid and vasculature, while impairment of the mammary TJ integrity is reported to be associated with decreased milk secretion during an extended milking interval [6]. Reproductive hormones of E2 and P4 were reported in the regulation of TJ in the tissues of human gut, rat vagina, or mice amniotic by affecting the expression of ZO-1, occludin, or claudins [12,13,14]. In the current study, to investigate the role of estrogen and P4 in goat mammary permeability, we analyzed the expression of the TJ related targets of claudin-1, claudin-3, occludin, and ZO-1 in the goat mammary tissue as well as in the goat mammary epithelial cells. We found that the protein expression of claudin-1 decreased, while the occludin and ZO-1 increased in the goat mammary gland during the decline in the E2 and P4 concentrations from the transition of pregnancy to lactation in vivo. The mRNA and protein expression of claudin-1, claudin-3, and ZO-1 changed with the P4 alteration in GMECs in vitro. While the mRNA expression of claudin-3, occludin, and ZO-1 did not change with the alteration in E2, but the protein expression of claudin-1 and ZO-1 increased slightly with the E2 improvement in the GMECs in vitro (Figure 5). This may demonstrate that it was P4, which played a key role in regulating the TJ related targets of claudin-1, claudin-3, and ZO-1 in vitro, but other factors may involve in the regulation of TJ proteins in vivo. During mid- to late-pregnancy, due to the elongation of mammary ducts and the formation of the alveolar, there are great changes in the cellular sub-populations such as epithelial cell proliferation and differentiation under the control of estrogen and P4. These changes may lead to the reassembly of the TJ. While in mice, claudin-1 is clearly localized to the tight junctions in mammary ducts in non-pregnant and non-lactating animals; claudin-3 is localized both to the tight junction and basolateral membrane, and claudin-3 mRNA was present at the highest levels in mid-pregnancy, while it fell by about 10-fold at the onset of lactation [16]. Corresponding with these results, the current study on goats showed the decline in claudin-1 during pregnancy and lactation, while claudin-3 reached high levels in mid-pregnancy and fell to low levels in late pregnancy. Occludin has an important capacity in the assembly of the TJ and is associated with a number of diseases due to the disruption of occludin and the increase in paracellular permeability [17]. ZO-1 is a junctional component known to directly interact with occludin and is required for the TJ strand assembly [18,19]. Thus, during late pregnancy when the TJs assemble, the formation for the alveolar may lead to the decreased expression of occludin and ZO-1, while in early lactation (Ld4), the TJ of the mammary gland would have assembled and closed to increase milk production. Therefore, the protein expression of occludin and ZO-1 expression increased abruptly on Ld4.
Previous studies have reported that E2 ameliorates tight junction disruption via repressing the MMP transcription in microvessel endothelial bEnd.3 cells that suffered from oxygen and glucose deprivation/reperfusion injury [20], and E2 treatment restored the azoxymethane or dextran sodium sulfate induced mRNA inhibition of ZO-1, occludin, and claudin-4 in mice [21]. These results were consistent with the current study that E2 increased the protein expression of ZO-1 and claudin-1 in GMECs in vitro. However, in young ovariectomized female rats, E2 treatment increased the expression of occludin over the placebo, while in middle-aged rats, E2 decreased the protein expression of occludin in the brain [22]. However, in human primary gut tissues, estrogen decreases the ZO-1 expression [13]. In the current study, the protein levels of ZO-1 and claudin-1 increased, but occludin and claudin-3 did not change in the GMECs after imposing E2 treatment. These differences in E2 regulation may be due to the different tissues and concentrations of E2, or the time of hormone reaction. However, the mRNA levels of claudin-1 and ZO-1 did not change with the E2 alteration in the GMECs, but the protein levels of these two targets increased in vitro, which may suggest that post-transcriptional modification occurred in the E2 effect on claudin-1 and ZO-1 expression.
P4 contributes to the antenatal formation and the disappearance of TJs in uterine and mammary epithelial tissues. It is reported that progesterone receptor antagonist RU-486 administration increased the permeability of the amniotic membrane and adversely affected the localization and expression of claudin-3 and claudin-4 in the amniotic epithelium, while P4 administration induced increases in the claudin-3 and claudin-4 expression in a dose-dependent manner, but did not influence their localization in organ-cultured amniotic membranes [12]. These results coincided with our study that the mRNA and protein expression of claudin-3 was elevated with the increase in P4 concentration. Furthermore, P4 could block the thrombin-induced decrease in the TJ proteins of occludin, claudin-5, and ZO-1 in the mouse brain endothelial cells [23]. Physiologic concentrations of the P4 treatment increased the trans-epithelial electrical resistance (TEER) in the primary colon tissues and Caco-2 cells in vitro through upregulating the occludin expression [24]. In the current study, the P4 increase also elevated the mRNA and protein expression of claudin-1, claudin-3, and ZO-1 in the GMECs, which may indicate that P4 may also play a protective role in goat mammary permeability.
In the current study, the experiments of administrating E2 and P4 on the epithelial cells in vitro had many advantages such as relatively simple influencing factors and easy to control. However, since the internal environment of the body is regulated by a complex network of the nervous system, endocrine system, and immune system, it is difficult in the in vitro cell experiments to simulate the environment in vivo and may not fully reflect the situation of the hormones on the mammary gland TJ expression. Thus, a further experiment in vivo is required to verify the function of sex hormones on TJs. In dairy cows in late lactation, E2 injections decreased the milk yield but increased the lactose in plasma and urine, showing the effect of E2 on the integrity of the mammary tight junctions [25]. Nguyen verified the hypothesis by injecting [14C] sucrose into the lumen of mouse mammary gland where P4 withdrawal at the termination of pregnancy triggered mammary TJ closure [4]. These studies demonstrate that E2 and P4 play important roles in regulating the mammary TJ and milk secretion in vivo. The current study is the first to show the accurate effect of E2 and P4 on the mammary TJ expression through in vivo and in vitro studies, which would offer valuable information to explore the mechanisms of the reproductive hormones regulating goat mammary gland development and lactation.

Author Contributions

H.Z., Q.J. and Y.Z.: Data curation, Investigation, Formal analysis, Writing—original draft; J.C. and Y.D.: Visualization, Resources, Project administration; D.L., D.Y. and L.H.: Conceptualization, Methodology, Investigation Writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (grant number 31802264), and the Fundamental Research Funds for the Central Universities of China (grant number 2662020DKQD002).

Institutional Review Board Statement

The animal study protocol was approved by the Animal Care and Use Committee of Huazhong Agricultural University (protocol code HZAURA-2015-008 and date of approval: 25 August 2020).

Informed Consent Statement

Not applicable, all goats used in our study were bought from the Hubei Academy of Agricultural Sciences (Wuhan, Hubei Province, China) and kept in the Laboratory of the Animal Center of Huazhong Agricultural University. All animal experiments were approved by the Animal Care and Use Committee of Huazhong Agricultural University.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Neville, M.C.; Morton, J.; Umemura, S. Lactogenesis. The transition from pregnancy to lactation. Pediatr. Clin. N. Am. 2001, 48, 35–52. [Google Scholar] [CrossRef]
  2. Zihni, C.; Mills, C.; Matter, K.; Balda, M.S. Tight junctions: From simple barriers to multifunctional molecular gates. Nat. Rev. Mol. Cell Biol. 2016, 17, 564–580. [Google Scholar] [CrossRef]
  3. Otani, T.; Furuse, M. Tight Junction Structure and Function Revisited. Trends Cell Biol. 2020, 30, 805–817. [Google Scholar] [CrossRef]
  4. Nguyen, D.A.; Parlow, A.F.; Neville, M.C. Hormonal regulation of tight junction closure in the mouse mammary epithelium during the transition from pregnancy to lactation. J. Endocrinol. 2001, 170, 347–356. [Google Scholar] [CrossRef]
  5. Cappai, M.G.; Liesegang, A.; Dimauro, C.; Mossa, F.; Pinna, W. Circulating electrolytes in the bloodstream of transition Sarda goats make the difference in body fluid distribution between single vs. twin gestation. Res. Vet. Sci. 2019, 123, 84–90. [Google Scholar] [CrossRef]
  6. Stelwagen, K.; Davis, S.R.; Farr, V.C.; Prosser, C.G.; Sherlock, R.A. Mammary epithelial cell tight junction integrity and mammary blood flow during an extended milking interval in goats. J. Dairy Sci. 1994, 77, 426–432. [Google Scholar] [CrossRef]
  7. Stelwagen, K. Effect of milking frequency on mammary functioning and shape of the lactation curve. J. Dairy Sci. 2001, 84, E204–E211. [Google Scholar] [CrossRef]
  8. Stelwagen, K.; Farr, V.C.; Davis, S.R.; Prosser, C.G. EGTA-induced disruption of epithelial cell tight junctions in the lactating caprine mammary gland. Am. J. Physiol. 1995, 269, R848–R855. [Google Scholar] [CrossRef]
  9. Kessler, E.C.; Wall, S.K.; Hernandez, L.L.; Gross, J.J.; Bruckmaier, R.M. Short communication: Mammary gland tight junction permeability after parturition is greater in dairy cows with elevated circulating serotonin concentrations. J. Dairy Sci. 2019, 102, 1768–1774. [Google Scholar] [CrossRef] [Green Version]
  10. Stumpf, M.T.; Fischer, V.; Daltro, D.S.; Alfonzo, E.P.M.; Kolling, G.J.; da Silva, M.; Pereira, L.G.R.; McManus, C.M. Mammary gland cell’s tight junction permeability from dairy cows producing stable or unstable milk in the ethanol test. Int. J. Biometeorol. 2020, 64, 1981–1983. [Google Scholar] [CrossRef]
  11. Brisken, C.; Park, S.; Vass, T.; Lydon, J.P.; O’Malley, B.W.; Weinberg, R.A. A paracrine role for the epithelial progesterone receptor in mammary gland development. Proc. Natl. Acad. Sci. USA 1998, 95, 5076–5081. [Google Scholar] [CrossRef] [Green Version]
  12. Kobayashi, K.; Miwa, H.; Yasui, M. Progesterone maintains amniotic tight junctions during midpregnancy in mice. Mol. Cell Endocrinol. 2011, 337, 36–42. [Google Scholar] [CrossRef]
  13. Zhou, Z.; Zhang, L.; Ding, M.; Luo, Z.; Yuan, S.; Bansal, M.B.; Gilkeson, G.; Lang, R.; Jiang, W. Estrogen decreases tight junction protein ZO-1 expression in human primary gut tissues. Clin. Immunol. 2017, 183, 174–180. [Google Scholar] [CrossRef] [Green Version]
  14. Oh, K.J.; Lee, H.S.; Ahn, K.; Park, K. Estrogen Modulates Expression of Tight Junction Proteins in Rat Vagina. Biomed. Res. Int. 2016, 4394702. [Google Scholar] [CrossRef] [Green Version]
  15. Zhu, H.; Liu, J.; Cui, C.; Song, Y.; Ge, H.; Hu, L.; Li, Q.; Jin, Y.; Zhang, Y. Targeting Human α-Lactalbumin Gene Insertion into the Goat β-Lactoglobulin Locus by TALEN-Mediated Homologous Recombination. PLoS ONE 2016, 11, e0156636. [Google Scholar] [CrossRef]
  16. Baumgartner, H.K.; Rudolph, M.C.; Ramanathan, P.; Burns, V.; Webb, P.; Bitler, B.G.; Stein, T.; Kobayashi, K.; Neville, M.C. Developmental Expression of Claudins in the Mammary Gland. J. Mammary Gland Biol. Neoplasia 2017, 22, 141–157. [Google Scholar] [CrossRef] [Green Version]
  17. Feldman, G.J.; Mullin, J.M.; Ryan, M.P. Occludin: Structure, function and regulation. Adv. Drug Deliv. Rev. 2005, 57, 883–917. [Google Scholar] [CrossRef]
  18. Furuse, M.; Itoh, M.; Hirase, T.; Nagafuchi, A.; Yonemura, S.; Tsukita, S. Direct association of occludin with ZO-1 and its possible involvement in the localization of occludin at tight junctions. J. Cell Biol. 1994, 127, 1617–1626. [Google Scholar] [CrossRef] [Green Version]
  19. Umeda, K.; Ikenouchi, J.; Katahira-Tayama, S.; Furuse, K.; Sasaki, H.; Nakayama, M.; Matsui, T.; Tsukita, S.; Furuse, M. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell 2006, 126, 741–754. [Google Scholar] [CrossRef] [Green Version]
  20. Na, W.; Lee, J.Y.; Kim, W.S.; Yune, T.Y.; Ju, B.G. 17β-Estradiol Ameliorates Tight Junction Disruption via Repression of MMP Transcription. Mol. Endocrinol. 2015, 29, 1347–1361. [Google Scholar] [CrossRef] [Green Version]
  21. Song, C.H.; Kim, N.; Sohn, S.H.; Lee, S.M.; Nam, R.H.; Na, H.Y.; Lee, D.H.; Surh, Y.J. Effects of 17β-Estradiol on Colonic Permeability and Inflammation in an Azoxymethane/Dextran Sulfate Sodium-Induced Colitis Mouse Model. Gut Liver 2018, 12, 682–693. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Sandoval, K.E.; Witt, K.A. Age and 17β-estradiol effects on blood-brain barrier tight junction and estrogen receptor proteins in ovariectomized rats. Microvasc. Res. 2011, 81, 198–205. [Google Scholar] [CrossRef] [PubMed]
  23. Hun Lee, J.; Won, S.; Stein, D.G. Progesterone attenuates thrombin-induced endothelial barrier disruption in the brain endothelial cell line bEnd.3: The role of tight junction proteins and the endothelial protein C receptor. Brain Res. 2015, 10, 73–80. [Google Scholar] [CrossRef]
  24. Zhou, Z.; Bian, C.; Luo, Z.; Guille, C.; Ogunrinde, E.; Wu, J.; Zhao, M.; Fitting, S.; Kamen, D.L.; Oates, J.C.; et al. Progesterone decreases gut permeability through upregulating occludin expression in primary human gut tissues and Caco-2 cells. Sci. Rep. 2019, 9, 019–44448. [Google Scholar] [CrossRef] [Green Version]
  25. Agenäs, S.; Lundström, I.; Holtenius, K. The effect of 17β-estradiol on lactose in plasma and urine in dairy cows in late lactation. J. Dairy Res. 2019, 86, 188–192. [Google Scholar] [CrossRef]
Figure 1. The serum E2 and P4 levels and the protein expression of the TJ proteins of goats at the stages of 8 m, Pd91, Pd137, Ld4, and Ld31. (A) Serum E2 and P4 levels and the ratios of E2 to P4. (B) The protein expression of claudin-1, claudin-3, occludin, and ZO-1 in goat mammary glands. Data are presented as the means ± SD, different letters indicate the hormones are different (p < 0.05).
Figure 1. The serum E2 and P4 levels and the protein expression of the TJ proteins of goats at the stages of 8 m, Pd91, Pd137, Ld4, and Ld31. (A) Serum E2 and P4 levels and the ratios of E2 to P4. (B) The protein expression of claudin-1, claudin-3, occludin, and ZO-1 in goat mammary glands. Data are presented as the means ± SD, different letters indicate the hormones are different (p < 0.05).
Animals 12 01404 g001
Figure 2. The isolation of goat mammary epithelial cells. (A) MECs and fibroblasts were emigrated from the cultured mammary tissue. (B) Purified MECs. (C) The immunofluorescence identification of MECs through the biochemical marker of CK-18.
Figure 2. The isolation of goat mammary epithelial cells. (A) MECs and fibroblasts were emigrated from the cultured mammary tissue. (B) Purified MECs. (C) The immunofluorescence identification of MECs through the biochemical marker of CK-18.
Animals 12 01404 g002
Figure 3. The effect of the E2 and P4 treatment on the mRNA expression of claudin-1, claudin-3, occludin, and ZO-1. (A) Claudin-1 mRNA expression. (B) Claudin-3 mRNA expression. (C) Occludin mRNA expression. (D) ZO-1 mRNA expression. These experiments were repeated at least three times. Data are represented as means ± SD; the values with different letters differed significantly (p < 0.05).
Figure 3. The effect of the E2 and P4 treatment on the mRNA expression of claudin-1, claudin-3, occludin, and ZO-1. (A) Claudin-1 mRNA expression. (B) Claudin-3 mRNA expression. (C) Occludin mRNA expression. (D) ZO-1 mRNA expression. These experiments were repeated at least three times. Data are represented as means ± SD; the values with different letters differed significantly (p < 0.05).
Animals 12 01404 g003
Figure 4. The effect of the E2 and P4 treatment on the protein expression of claudin-1, claudin-3, occludin, and ZO-1. Western blot analysis and densitometry quantification of claudin-1, claudin-3, occludin, and ZO-1 expression normalized to the total β-actin in the GMECs. These experiments were repeated at least three times. Data are represented as the means ± SD; values with different letters differed significantly (p < 0.05).
Figure 4. The effect of the E2 and P4 treatment on the protein expression of claudin-1, claudin-3, occludin, and ZO-1. Western blot analysis and densitometry quantification of claudin-1, claudin-3, occludin, and ZO-1 expression normalized to the total β-actin in the GMECs. These experiments were repeated at least three times. Data are represented as the means ± SD; values with different letters differed significantly (p < 0.05).
Animals 12 01404 g004
Figure 5. The diagram illustrating the function of E2 and P4 on the tight junction proteins showed that the targets were increased; therefore the tight junction proteins did not change.
Figure 5. The diagram illustrating the function of E2 and P4 on the tight junction proteins showed that the targets were increased; therefore the tight junction proteins did not change.
Animals 12 01404 g005
Table 1. The primer information for the qRT-PCR.
Table 1. The primer information for the qRT-PCR.
GeneAccession NumberPrimers Product Size (bp)
ForwardReverse
occludinXM_018065677.1CATTTTTGCCTGTGTTGCCTAATCCCTTTGCCGCTCTTGG186
claudin-1XM_005675123.3CCCAGTCAATGCCAGGTATGTCTTTCCCACTGGAAGGTGC168
claudin-3XM_018041071.1TGGCTGTGCACTATCGTGTGCGAGTCGTACACCTTGCACT156
ZO-1XM_018066118.1AGCAGACGCAGAAAACCATCATCTCCACGCCACTGTCAAACT225
β-actinNM_001009784.3GGATGATGATATTGCTGCGCTCTCTCCATGTCGTCCCAGTTGGT248
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhu, H.; Jia, Q.; Zhang, Y.; Liu, D.; Yang, D.; Han, L.; Chen, J.; Ding, Y. Regulation of Tight Junctions by Sex Hormones in Goat Mammary Epithelial Cells. Animals 2022, 12, 1404. https://doi.org/10.3390/ani12111404

AMA Style

Zhu H, Jia Q, Zhang Y, Liu D, Yang D, Han L, Chen J, Ding Y. Regulation of Tight Junctions by Sex Hormones in Goat Mammary Epithelial Cells. Animals. 2022; 12(11):1404. https://doi.org/10.3390/ani12111404

Chicago/Turabian Style

Zhu, Hongmei, Qianqian Jia, Yanyan Zhang, Dongming Liu, Diqi Yang, Li Han, Jianguo Chen, and Yi Ding. 2022. "Regulation of Tight Junctions by Sex Hormones in Goat Mammary Epithelial Cells" Animals 12, no. 11: 1404. https://doi.org/10.3390/ani12111404

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop