Next Article in Journal
The Use of Abdominal Ultrasound to Improve the Cryptorchidectomy of Pigs
Next Article in Special Issue
Development of an Immunochromatographic Test Based on Rhoptry Protein 14 for Serological Detection of Toxoplasma gondii Infection in Swine
Previous Article in Journal
Freedom to Move: Free Lactation Pens Improve Sow Welfare
Previous Article in Special Issue
Epidemiology, Diagnosis, and Prevention of Sparganosis in Asia
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 14
10.3390/ani12141764
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization of Entamoeba spp. in Pigs with Diarrhea in Southern China

by
Pei Wang
1,2,
Sen Li
1,2,
Yang Zou
2,
Ru-Yi Han
1,
Ping Wang
1,
De-Ping Song
1,
Cheng-Bin Wang
1 and
Xiao-Qing Chen
1,2,*
1
College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang 330045, China
2
State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, China
*
Author to whom correspondence should be addressed.
Animals 2022, 12(14), 1764; https://doi.org/10.3390/ani12141764
Submission received: 12 June 2022 / Revised: 4 July 2022 / Accepted: 7 July 2022 / Published: 9 July 2022
(This article belongs to the Collection Advances in Parasite Epidemiology and Population Genetics)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

China is an important country in the world for pig breeding and pork consumption, yet only two provinces have reported Entamoeba spp. infections. In this study, fecal samples of pigs with diarrhea were collected from three provinces in southern China, and Entamoeba spp. infection was detected by nested PCR. The results showed that the total infection rate was 58.4%. Entamoeba polecki and Entamoeba suis were detected. The ST1 and ST3 subtypes of Entamoeba polecki were detected, and a relatively serious mixed infection was found, with the most common form of mixed infection being Entamoeba polecki ST1 + Entamoeba polecki ST3. These findings provide baseline data for preventing and controlling Entamoeba spp. infection in southwestern China.

Abstract

Entamoeba spp. is a common zoonotic intestinal protozoan that can parasitize most vertebrates, including humans and pigs, causing severe intestinal diseases and posing a serious threat to public health. However, the available data on Entamoeba spp. infection in pigs are relatively limited in China. To characterize the infection of Entamoeba spp. within pigs in southern China, 1254 fecal samples of diarrheic pigs were collected from 37 intensive pig farms in Hunan, Jiangxi and Fujian provinces and the infection of Entamoeba spp. was investigated based on the small subunit rRNA (SSU rRNA) gene. The overall infection rate of Entamoeba spp. was 58.4% (732/1254), including 38.4% (118/307) in suckling piglets, 51.2% (153/299) in weaned piglets, 57.9% (55/95) in fattening pigs and 73.4% (406/553) in sows, respectively. Moreover, age and the sampling cities in Jiangxi and Fujian provinces were found to be the key factors influencing the infection of Entamoeba spp. (p < 0.05). Two subtypes (ST1 and ST3) with a zoonotic potential of Entamoeba polecki and Entamoeba suis were detected in all age groups of pigs and all sampling areas, with the predominant species and predominant subtype being E. polecki (91.3%, 668/732) and E. polecki ST1 (573/668), respectively, and E. polecki ST1 + E. polecki ST3 (78.6%, 239/304) being the most frequently detected form of mixed infection. Severe Entamoeba spp. infection and zoonotic subtypes were found in this study, exposing a large public health problem in the study area, and strategies need to be implemented to eliminate the risk in the future.

1. Introduction

Entamoeba spp. can be divided into parasitic species that infect humans and animals, and free-living species that live in water and mud with the occasional invasion of animals, depending on the living environment [1,2]. Except for Entamoeba gingivalis, which does not form cysts, most Entamoeba spp. species have cyst or trophozoite stages during their whole life cycle [3,4]. Like other intestinal protozoa, the fecal–oral route is an important route of transmission for Entamoeba spp. [5]. Up to now, seven (E. bangladeshi, E. histolytica, E. dispar, E. coli, E. moshkovskii, E. hartmanni, and E. polecki) and three (E. polecki, E. suis and E. histolytica) species of Entamoeba spp. have been identified in humans and pigs, respectively [6,7,8]. Most of them are considered harmless, but some species can cause serious intestinal diseases [9,10]. Sometimes, E. histolytica causes more serious diseases, and relatively more research has been conducted concerning E. histolytica worldwide, and hygiene conditions are closely related to the disease [6,11]. E. histolytica can invade not only the liver and colon tissue of the host, causing colon ulcers and liver abscesses, but also the lungs, skin, genitourinary tract, brain and spleen, causing other severe diseases [6,12]. This may explain why amebiasis is one of the three deadliest diseases in the world, infecting approximately 50 million people worldwide and causing more than 50,000 deaths each year, for which countries have to pay high public health care costs every year [12,13,14,15]. Even worse, E. histolytica has great transmissibility, requiring only one normally infective oocyst to cause amoebiasis in the host [3,13]. Although E. histolytica has not been observed in naturally raised pigs to date, some studies have found that pigs can be infected with E. histolytica with human intervention, and thus pigs are considered to be a potential reservoir of pathogens [3,7,14,16,17]. The high population density in China and the presence of intensive domestic pig farms undoubtedly increases the risk of human contact with pigs and thus infection with pathogens. Humans are likely to be infected with Entamoeba spp. through pigs. However, although Entamoeba spp. infections have been reported in several studies in China, the main focus has been on investigating infections in humans and non-human primates [18]. Some researchers have found that although monkeys were at greater risk of an Entamoeba spp. infection, the species of Entamoeba parasitized in different species of monkeys were different [19]. Patients with AIDS and homosexuals were found to be at higher risk of infection [20]. Therefore, investigation of Entamoeba spp. infection in pigs is necessary for improving public health safety and studying the genetic structure.
E. suis and E. polecki were the two Entamoeba spp. species most frequently detected in pigs [16,17,21,22,23,24]. Although E. suis has previously been considered host-specific with parasitism only in pigs, later studies detected E. suis in gorillas, so further studies are needed to determine whether E. suis is a strictly host-specific Entamoeba spp. species [2,25]. E. suis invades the lamina propria of the host, with hemorrhagic colitis being the typical pathological feature [3,22]. E. polecki has been detected in a variety of hosts, including humans and pigs, with zoonotic potential [2,14,25]. Moreover, there is also a degree of genetic variation in E. polecki, which can be classified into four subtypes (ST1–ST4) based on the small subunit ribosomal RNA (SSU rRNA) genes [14,25]. These four subtypes have all been observed in humans, while only ST1 and ST3 have been observed in pigs and ST2 has only been detected in non-human primates [2,14,25,26]. Not until 2016, when ST2 was detected in wild Celebes crested macaques, it was realized that ST2 was not parasitic only in humans [25,27]. Though swine single infection with E. polecki was not pathogenic, mixed infection with certain pathogenic bacteria will aggravate the disease [8,9,28,29,30].
Entamoeba spp. infection in pigs has been published in thirteen countries, but the microscopic examination was the method used in most reports [14,22,25,28,29,30]. However, significant genetic diversity may exist in some morphologically undifferentiated Entamoeba species and some morphological differences do not reflect species-level differences [3,8,31]. Based on the SSU rRNA gene of Entamoeba spp., several pairs of relatively mature primers are now available for the species/subtypes identification of Entamoeba spp. [3,4,7,14,26,32]. Although these primers have only been developed in recent years, molecular characterization reports of Entamoeba spp. infections in pigs were very limited. For China, a critical pig breeding country, there were only two reports of Endamoeba spp. infections in pigs based on molecular means [14,25]. This study aims to investigate the infection of Entamoeba spp. in diarrheic pigs in southern China that will supplement the data on Entamoeba spp. infection in pigs, which will deepen the study of the genetic diversity of Entamoeba spp. and may develop more effective preventive control measures.

2. Materials and Methods

2.1. Ethics Statement

This experiment was conducted in strict accordance with the experimental animal regulations of Jiangxi Agricultural University. Sampling was carried out only after obtaining the consent of the farm owner, and the whole sampling process did not cause damage to animals.

2.2. Specimen Collection

Fresh fecal specimens were collected from 1254 pigs with diarrhea in the Jiangxi, Hunan and Fujian provinces during 2015–2019, with 553 from sows, 307 from suckling pigs, 229 from weaned pigs and 95 from fattening pigs (Figure 1 and Table 1). These 1254 samples were collected from 37 large intensive pig farms under scientific control, 23 of which were located in Jiangxi provinces, 6 in Hunan provinces, and the remaining 8 in Fujian provinces. The number of samples collected from farm to farm was variable, ranging from 1 to 141. Only pigs excreting thin feces or showing watery diarrhea were sampled, with anal swabs being the only sampling method used in this study. Each sample was clearly labeled with information on age, collection location and sampling time before being rapidly frozen and finally stored at −80°C until DNA extraction.

2.3. DNA Extraction

To remove the impurities, each specimen (approximately 300 mg) was washed three times with distilled water by centrifugation at 13,000 g for five minutes. According to the manufacturer’s instructions, genomic DNA was extracted from the remaining sediments by the commercial E.Z.N.A.® Fecal DNA Kit (D4015-02, Omega Bio-Tek Inc., Norcross, GA, USA) and stored at −20 °C until used for molecular analysis.

2.4. PCR Amplification

To screen the species/subtypes of Entamoeba spp., seven primer pairs were used for nested PCR, which was designed based on the small subunit ribosomal RNA (SSU rRNA) genes of Entamoeba spp. To detect the infection of E. histolytica, the first round of PCR was performed with primers E-1 and E-2, and the second round of PCR was performed with primers EH-1 and EH-2 with a target gene fragment of 439 bp. For E. suis, the final amplified target gene size was 320 bp by first-round PCR using primers 764-RD3 and second-round PCR using primers 764–765. Eploec F6 and Eploec R6 were used for the first round of PCR reaction to amplify a 430 bp gene of E. polecki. Then the second round of PCR for subtype-specific characterization of E. polecki used primers Epolecki 1-Epolecki 2 (ST1, 201 bp) and EpST3F1-EpST3R2 (ST3, 190 bp) using the primary PCR products as a template was carried out, respectively [14,25]. Details of all primers in this study were listed in Table 2.
All PCR reaction systems in this study were 25 µL. For E. histolytica, the reaction system contained 0.2 mM dNTP, 1 mM 10 × Taq buffer (Mg2+ free), 1.5 mM MgCl2, 0.4 mM each primer, 2 µL of genomic DNA and, finally, 25 µL was made up with reagent water. The difference between E. suis and E. histolytica was 2 mM MgCl2, 0.5 mM of each primer and 1 µL of genomic DNA, while E. polecki was only 1 µL of genomic DNA compared to E. histolytica. The annealing temperatures of all PCR reactions involved in this experiment were listed in Table 2. The initial denaturation time of all PCR reactions (except E. suis) was 94 °C for 5 min, the second step was 94 °C for 30 s, followed by 45 s of annealing, then 72 °C extensions for 1 min, which were to be repeated 35 times from the second step to the extension and the end extension for 7 min. For E. suis, the annealing time was extended to 1 min. The secondary PCR products were examined by electrophoresis in 1% (w/v) agarose gels containing ethidium bromide.

2.5. Sequence and Phylogenetic Analyses

All PCR products that could amplify the target band size were sent to Hunan Tsingke Biotechnology Co., Ltd. (Changsha High-Tech Development District, Changsha China), for bi-directional sequencing. All sequenced sequences were calibrated with Chromas V.2.6.4 before splicing, and finally, the spliced sequences were aligned with the sequences in NCBI http://www.ncbi.lm.nih.gov/GenBank (accessed on 15 May 2021). Based on the results of alignment, it was determined whether the samples were infected with Entamoeba spp. and the species/subtypes of Entamoeba spp. Representative sequences of E. polecki ST1, E. polecki ST3 and E. suis obtained in this study have been deposited in the GenBank database under accession numbers MZ203209-MZ203510 (E. polecki ST1), MZ203512-MZ203514 (E. polecki ST3) and MZ203516-MZ203518 (E. suis), respectively. Phylogenetic analysis was performed based on the SSU rRNA gene of Entamoeba spp. using the auxiliary software MEG7 http://www.megasoftware.net/ (accessed on 16 March 2022) by the neighbor-joining method (NJ), with mode set to p-distance and bootstrap, and the bootstrap parameter set to 1000. AF149905 and AF149908 were set as the out-groups. For the bootstrap parameter, values of less than 50 will not appear on the branch.

2.6. Statistical Analysis

In this study, the chi-square (χ2) test of SPSS version 25.0 (IBM SPSS Inc., Chicago, IL, USA) was used to analyze the correlation between Entamoeba spp. infection and independent factors (region and age), and the difference of infection was considered to be significantly correlated with this factor when the p-value was less than 0.05. The infection risk of Entamoeba spp. was also assessed in diarrheic pigs from different regions and ages, with odds ratios (ORs), and 95% confidence intervals (Cls) were used to ensure the accuracy of the results.

3. Results

3.1. Prevalence of Entamoeba spp. in Diarrheic Pigs

The epidemiological investigation of 1254 diarrheic pigs’ fecal samples for Entamoeba spp. revealed that 732 samples were positive for Entamoeba spp. with an overall infection rate of 58.4% (732/1254, 95%Cl 55.64–64.10). The infection rates in Hunan, Jiangxi and Fujian provinces were 59.0% (67/135, 95%Cl 41.20–58.06), 59.5% (616/1036, 95%Cl 56.47–62.45) and 49.6% (49/83, 95%Cl 48.46–69.62), respectively, whereas the infection rates of Entamoeba spp. varied widely among pigs of different ages, with the highest rate being in sows at 73.4% (406/553, 95%Cl 69.74–77.10), followed by fattening, weaned and suckling piglets at 57.9% (55/95, 95%Cl 47.97–63.82), 51.2% (153/299, 95%Cl 45.50–56.84) and 38.4% (118/307, 95%Cl 33.00–43.88), respectively. The differences in infection in different age groups were statistically significant (p < 0.001). Notably, the infection risk of Entamoeba spp. in sows was 4.42 times (95%Cl 3.29–5.96) higher than in suckling piglets (Table 3).
Entamoeba spp. was detected in all sampling cities, with the highest infection observed (75.4%, 178/236, 95%Cl 69.93–80.92) in Yichun City, Jiangxi Province, and the lowest (37.5%, 9/27, 95%Cl 18.13–56.87) found in Zhuzhou City, Hunan Province. The differences in infection between the seven sampling cities in Jiangxi Province and the two sampling cities in Fujian Province were statistically significant (p < 0.05). The infection risk of Entamoeba spp. in diarrheic pigs in Henyang City was 3.51 times (95%Cl 55.87–79.72) higher than that in Zhuzhou City, while the infection risk in Yichun City and Fuzhou City was as high as 4.7 (95%Cl 69.93–80.92) and 4.15 (95%Cl 63.81–82.25) times higher compared to Xinyu City (Table 3).

3.2. Species/Subtypes and Mixed Infection of Entamoeba spp. in Diarrheic Pigs

In this study, two species (E. suis, 17.6%, 129/732; E. polecki, 82.4%, 603/732) of Entamoeba spp. were observed, and two subtypes (ST1, 85.8%, 573/668; ST3, 35.4%, 357/668) of E. polecki were identified. Statistical analysis revealed that E. polecki was the predominant species in diarrheic pigs and ST1 was the predominant subtype. The proportion of single infections (58.5%, 428/732, E. polecki ST1, E. polecki ST3 and E. suis) was higher than mixed infections (41.5%, 304/732, E. polecki ST1 + E. polecki ST3, E. polecki ST1 + E. suis, E. polecki ST3 + E. suis, E. polecki ST1 + E. polecki ST3 + E. suis), with ST1 (63.7%, 297/438) being the most frequently identified form of single infection, while E. polecki ST1 + E. polecki ST3 (78.6%, 239/304) was the most frequently identified form of mixed infection. Two subtypes of E. polecki and E. suis were observed in Hunan, Jiangxi and Hunan provinces, and all three single infection forms and more than two mixed forms of infections were present in all study regions. Similarly, E. polecki ST1, E. polecki ST3 and E. suis were detected in all age groups of pigs and three forms of single infections and four mixed forms of infections were detected in all different age pigs herds except fattening pigs. E. polecki ST1, E. polecki ST3 and E. suis were also detected in all 11 sampling cities but only one form of single infection (E. polecki ST3) was detected in Zhuzhou and Nanping City, while three forms of single infection and more than two mixed infection forms were present in all the remaining cities, including four mixed infection forms in Ji’an, Jiujiang, Nanchang and Yichun City (Table 2 and Table 3).

3.3. Phylogenetic Analysis of Entamoeba spp. Isolates in Diarrheic Pigs

Phylogenetic analysis suggested that the sequences of the two subtypes (ST1 and ST3) of E. polecki and the sequences of E. suis obtained from diarrheic pigs in this study clustered into a branch with other E. polecki subtypes (ST1 and ST3) and E. suis sequences obtained from other animals (including pigs) or humans, respectively, with higher bootstrap values. In particular, attention should be drawn to the fact that the ST1 sequences (MZ203509-MZ203510) isolated in this study were genetically close to the ST1 sequence (FR686383) isolated from humans, indicating that E. polecki ST1 has zoonotic potential, while the sequences of E. suis isolated in this study were genetically distant from the sequence of E. suis previously isolated from pigs, despite being clustered together (Figure 2).

4. Discussion

Although Entamoeba spp. is a critical zoonotic parasite, relevant reports of Entamoeba spp. infection in pigs based on molecular methods wase very limited, which greatly restricted the understanding of its genetic characteristics and pathogenicity. Therefore, the infection of Entamoeba spp. in diarrheic pigs was detected based on molecular means to evaluate the zoonotic potential and further study the genetic structure of Entamoeba spp. in pigs.
Based on the SSU rRNA gene of Entamoeba spp., the overall infection rate of Entamoeba spp. in diarrheic pigs was 58.4% in Hunan, Jiangxi and Fujian provinces. Compared the infections of Entamoeba spp. with other studies in healthy pigs, it was higher than in Korea (3.7%) [32], India (50%) [33], Greece (8.3%) [34], Ireland (8% for E. suis and 17% for E. polecki) [29], Cambodia (31.6%) [35], Germany (52%) [36] and the UK (0%) [37]. It also was higher than that in Vietnam (91.7%) [37], Anhui Province (45.8%) [14] and Fujian Province (55.4%) [25], but lower than that in Tibet (37.9%) [38] and Indonesia (81.1% for E. suis and 35.7% for E. polecki) [39]. Large differences in the infection of Entamoeba spp. within different countries/regions can be found, which may be due to many factors such as different detection methods, different detection kits, geographical factors, personal handling, etc. Furthermore, the sampling time was also an essential factor that cannot be ignored [34,40]. The severe infection of Entamoeba spp. was likely attributed to the lack of knowledge of farmers about Entamoeba spp. and failure to use drugs for prevention. Although the pathogenicity of most Entamoeba spp. was limited, a widespread outbreak of mixed infections with other pathogens would cause serious economic losses and public health problems [9]. Given that the infection differences of Entamoeba spp. in the Fujian Province obtained in this study and previously reported were not significant, it may indicate that the effect of diarrhea on Entamoeba spp. infection in pigs was relatively limited [25]. No fecal samples from healthy pigs were collected in the same area and at the same time, so there was no way to test healthy pigs and diarrheic pigs for Entamoeba spp. infection, making it impossible to directly compare the correlation between diarrhea and the infection, which was the biggest weakness of this study. However, for other hosts, a correlation between diarrhea and infection of Entamoeba spp. has been found [41]. This batch of samples was tested simultaneously for other diarrheal pathogens, such as Blastocystis sp., Cryptosporidium spp., PEDV and PECoV, but unfortunately, the main factors causing diarrhea in pigs were not identified [42,43,44,45]. There were too many factors that could cause diarrhea in pigs, and thus other pathogens are planned to be tested in the future.
In this study, the highest infection rate of Entamoeba spp. was observed in sows with 73.4% (406/553, 95%Cl 69.74–77.10), which was 4.42 (95%Cl 3.29–5.96) times higher than the risk of Entamoeba spp. infection in suckling piglets. However, in previous reports of healthy pigs for Entamoeba spp. infection, the infection rate was highest in weaned piglets and relatively low in sows, which was somewhat different from our results [14,25]. Factors such as breeding management, sample size, sampling time and testing method might be significant reasons for the differences in infection. Moreover, there were some differences in feeding management patterns in different regions, and the density of pigs could have a greater impact on the infection of intestinal protozoa. Whether diarrhea had a great effect on the infection of Entamoeba spp. in different age groups of pigs, leading to a relatively high infection rate in sows and fattening pigs, requires more evidence from the future. For older pigs, less attention is usually paid to them because the animals have a better immune system, while the young usually receive a more comfortable living environments and more careful care, which may also be one of the reasons for the greater difference in infection in different age groups. Notably, the infection in healthy pigs was also found to be lowest in suckling piglets, consistent with the results of this study [14,25]. This may be strongly influenced by maternal antibodies.
Two E. polecki subtypes (ST1 + ST3) and E. suis were observed in pigs from Hunan, Jiangxi and Fujian provinces and all age groups of pigs. The high colonization suggests that pigs may be suitable hosts for the two species of Entamoeba spp. The highest infection was observed for E. polecki and lower for E. suis, and the highest infection was observed for E. polecki ST1 among the two subtypes of E. polecki, both of which were in full agreement with previous reports. However, the colonization of different genotypes/species of Entamoeba spp. at different ages revealed that the results of the present study did not correspond exactly to the previous results [14,25]. The two subtypes of E. polecki and E. suis in this study were mainly colonized in sows, while previous reports found that these two subtypes were mainly colonized in weaned piglets, with only E. suis mainly colonizes sows [25]. Geographical factors, sampling time, sample size, sample type and sanitary conditions were all critical reasons for the differences in infection [46]. According to the data, the investigations of Entamoeba spp. infections in pigs were very limited, which poses a great challenge to revealing the actual epidemiological distribution of Entamoeba spp. In the present study, the mixed infection of Entamoeba spp. was severe, with the main form of mixed infection being E. polecki ST1 + E. polecki ST3, in agreement with the results of previous studies [25]. The current study found that four mixed forms of infection were observed in all age groups except fattening pigs, whereas, in comparison to previous reports, the four mixed forms of infection were only observed in sows; whether diarrhea was the culprit for this outcome needs further research [25]. However, one of the reasons for the severity of mixed infections must be the poor understanding of the pathogen and the lack of precautions and treatment.
Phylogenetic analysis showed that the sequences of E. polecki ST1, E. polecki ST3 and E. suis obtained in this study all clustered with other sequences of E. polecki ST1, E. polecki ST3 and E. suis sequences, respectively. Notably, the E. polecki ST1 sequence (MZ203509 and MZ203510) obtained in this study and other E. polecki ST1 sequences (AF149913, MH011333 and MK357717) isolated from pigs and E. polecki ST1 sequence (FR686383) isolated from humans, have a close genetic relationship, suggesting that E. polecki ST1 has zoonotic potential and that humans may be infected with E. polecki ST1 through pigs. This may indicate that geographic isolation has less effect on the genetic variation of E. polecki ST1 and the genetic variation of E. polecki ST1 in different hosts was equally small, but the validity of the speculation needs to be determined by more detailed sequence analysis. The same result was found in E. polecki ST3 sequences. Although human infection with E. polecki ST3 has been reported previously, we failed to find the E. polecki ST3 sequences and could not further evaluate its zoonotic potential. For E. suis, the sequences obtained in this study were found to be clustered into a single branch, whereas the E. suis sequences previously isolated from pigs were sister groups to each other, which is similar to the previously reported results and may indicate that E. suis isolated in this study may be genetically distant from the previous sequences of E. suis [47].

5. Conclusions

In this study, the infection of Entamoeba spp. in diarrheic pigs in three southern provinces of China was investigated based on the SSU rRNA gene, and a high infection rate was found (58.4%, 732/1254). In addition to the observation of two zoonotic potential subtypes (ST1 and ST3) of E. polecki and E. suis, severe mixed infections were found. This warns that adequate attention should be paid to Entamoeba spp., and appropriate prevention and treatment measures should be developed in a timely manner to reduce economic losses and improve public health. In this study, the species/subtype distribution of Entamoeba spp. and the level of infection in pigs with diarrhea were brought to light, the effects of geographic factors and age on infection differences were analyzed and the zoonotic potential of E. polecki was assessed, which provides a reference for further studies on the genetic structure of Entamoeba spp.

Author Contributions

X.-Q.C. conceived and designed the study; P.W. (Pei Wang) performed the experiments, analyzed the data and drafted the manuscript; S.L., R.-Y.H. and P.W. (Ping Wang) participated in the implementation of the study; X.-Q.C., D.-P.S., C.-B.W. and Y.Z. critically revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Grant No. SKLVEB2020KFKT006), the Science and Technology Program Funding of Educational Commission of Jiangxi Province, China (Grant No. GJJ210416).

Institutional Review Board Statement

The study protocol was reviewed and approved by the Animal Ethics Committee of Jiangxi Agricultural University (protocol code: JXAU-LL-2013-03; date of approval: 11 December 2013).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare that they have no competing interest.

References

  1. Neal, R.A. Experimental studies on Entamoeba concerning speciation. Adv. Parasitol. 1966, 4, 1–51. [Google Scholar] [PubMed]
  2. Stensvold, C.R.; Lebbad, M.; Victory, E.L.; Verweij, J.J.; Tannich, E.; Alfellani, M.; Legarraga, P.; Clark, C.G. Increased sampling reveals novel lineages of Entamoeba: Consequences of genetic diversity and host specificity for taxonomy and molecular detection. Protist 2011, 162, 525–541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Clark, C.G.; Kaffashian, F.; Tawari, B.; Windsor, J.J.; Twigg-Flesner, A.; Davies-Morel, M.; Blessmann, J.; Ebert, F.; Peschel, B.; Van, A.L.; et al. New insights into the phylogeny of Entamoeba species provided by analysis of four new small-subunit rRNA genes. Int. J. Syst. Evol. Microbiol. 2006, 56, 2235–2239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Hirashima, Y.; Manchanayake, T.; Yano, T.; Kitahara, S.; Koreeda, T.; Kamimura, S.; Sasai, K.; Matsubayashi, M.; Shibahara, T. Development of molecular diagnostic protocols for detecting three types of Entamoeba from diarrheal and asymptomatic pigs and environmental moist soils. Parasitol. Res. 2017, 116, 2001–2007. [Google Scholar] [CrossRef]
  5. Li, J.; Dong, H.; Wang, R.; Yu, F.; Wu, Y.; Chang, Y.; Wang, C.; Qi, M.; Zhang, L. An investigation of parasitic infections and review of molecular characterization of the intestinal protozoa in nonhuman primates in China from 2009 to 2015. Int. J. Parasitol. Parasites. Wildl. 2017, 6, 8–15. [Google Scholar] [CrossRef] [PubMed]
  6. Dos Santos Zanetti, A.; Malheiros, A.F.; de Matos, T.A.; Dos Santos, C.; Battaglini, P.F.; Moreira, L.M.; Lemos, L.; Castrillon, S.; da Costa Boamorte Cortela, D.; Ignotti, E.; et al. Diversity, geographical distribution, and prevalence of Entamoeba spp. in Brazil: A systematic review and meta-analysis. Parasite 2021, 28, 17. [Google Scholar] [CrossRef] [PubMed]
  7. Ngui, R.; Angal, L.; Fakhrurrazi, S.A.; Lian, Y.L.; Ling, L.Y.; Ibrahim, J.; Mahmud, R. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia. Parasites Vectors 2012, 5, 187. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Matsubayashi, M.; Murakoshi, N.; Komatsu, T.; Tokoro, M.; Haritani, M.; Shibahara, T. Genetic identification of Entamoeba polecki subtype 3 from pigs in Japan and characterization of its pathogenic role in ulcerative colitis. Infect. Genet. Evol. 2015, 36, 8–14. [Google Scholar] [CrossRef] [PubMed]
  9. Matsubayashi, M.; Kanamori, K.; Sadahiro, M.; Tokoro, M.; Abe, N.; Haritani, M.; Shibahara, T. First molecular identification of Entamoeba polecki in a piglet in Japan and implications for aggravation of ileitis by coinfection with Lawsonia intracellularis. Parasitol. Res. 2015, 114, 3069–3073. [Google Scholar] [CrossRef] [PubMed]
  10. Elsheikha, H.M.; Regan, C.S.; Clark, C.G. Novel Entamoeba findings in nonhuman primates. Trends Parasitol. 2018, 34, 283–294. [Google Scholar] [CrossRef]
  11. López, M.C.; León, C.M.; Fonseca, J.; Reyes, P.; Moncada, L.; Olivera, M.J.; Ramírez, J.D. Molecular epidemiology of Entamoeba: First description of Entamoeba moshkovskii in a rural area from central Colombia. PLoS ONE 2015, 10, e0140302. [Google Scholar] [CrossRef] [Green Version]
  12. Nath, J.; Ghosh, S.K.; Singha, B.; Paul, J. Molecular epidemiology of amoebiasis: A cross-sectional study among north east Indian population. PLoS Negl. Trop. Dis. 2015, 9, e0004225. [Google Scholar] [CrossRef]
  13. Salit, I.E.; Khairnar, K.; Gough, K.; Pillai, D.R. A possible cluster of sexually transmitted Entamoeba histolytica: Genetic analysis of a highly virulent strain. Clin. Infect. Dis. 2009, 49, 346–353. [Google Scholar] [CrossRef] [Green Version]
  14. Li, W.C.; Geng, J.Z.; Chen, C.; Qian, L.; Zhang, T.; Liu, J.L.; Gu, Y.F. First report on the occurrence of intestinal Entamoeba spp. in pigs in China. Acta Trop. 2018, 185, 385–390. [Google Scholar] [CrossRef] [PubMed]
  15. Stanley, S.L. Amoebiasis. Lancet 2003, 361, 1025–1034. [Google Scholar] [CrossRef]
  16. Matsubayashi, M.; Sasagawa, Y.; Aita, T.; Tokoro, M.; Haritani, M.; Shibahara, T. First report of mixed Entamoeba polecki (ST1) and E. suis infection in piglets shedding abnormal feces by histopathological and molecular surveys. Acta Parasitol. 2016, 61, 665–670. [Google Scholar] [CrossRef] [PubMed]
  17. Cui, Z.; Li, J.; Chen, Y.; Zhang, L. Molecular epidemiology, evolution, and phylogeny of Entamoeba spp. Infect. Genet. Evol. 2019, 75, 104018. [Google Scholar] [CrossRef]
  18. Pu, L.H.; Li, Z.; Wu, J.; Zhang, Y.L.; Chen, J.Q.; Yang, J.F.; Zou, F.C. Prevalence, molecular epidemiology and zoonotic risk of Entamoeba spp. from experimental macaques in Yunnan Province, southwestern China. Parasitol. Res. 2020, 119, 2733–2740. [Google Scholar] [CrossRef]
  19. Zhang, Q.; Liu, K.; Wang, C.; Luo, J.; Lu, J.; He, H. Molecular Characterization of Entamoeba spp. in Wild Taihangshan Macaques (Macaca mulatta tcheliensis) in China. Acta Parasitol. 2019, 64, 228–231. [Google Scholar] [CrossRef]
  20. Kaya, F.; İnkaya, A.Ç.; Aksoy, S.; Abbasoğlu, O.; Ertenli, A.İ.; Büyükaşık, Y.; Büyükaşık, Y.; Arıkan Akdağlı, S.; Akyön, Y.; Ergüven, S. Investigation of intestinal protozoon prevalence in immunocompromised patients at a university hospital. Turkiye Parazitol. Derg. 2021, 45, 39–44. [Google Scholar] [CrossRef] [PubMed]
  21. He, G.Z.; Feng, Y.; Deng, S.X. Evaluation of the intestinal microbial diversity in miniature pig after orally infected with Entamoeba histolytica. Parasitol. Res. 2012, 111, 939–941. [Google Scholar] [CrossRef]
  22. Matsubayashi, M.; Suzuta, F.; Terayama, Y.; Shimojo, K.; Yui, T.; Haritani, M.; Shibahara, T. Ultrastructural characteristics and molecular identification of Entamoeba suis isolated from pigs with hemorrhagic colitis: Implications for pathogenicity. Parasitol. Res. 2014, 113, 3023–3028. [Google Scholar] [CrossRef] [PubMed]
  23. NOBLE, G.A.; NOBLE, E.R. Entamoebae in farm mammals. J. Parasitol. 1952, 38, 571–595. [Google Scholar] [CrossRef]
  24. Desowitz, R.S.; Barnish, G. Entamoeba polecki and other intestinal protozoa in Papua New Guinea Highland children. Ann. Trop. Med. Parasitol. 1986, 80, 399–402. [Google Scholar] [CrossRef] [PubMed]
  25. Ji, T.; Cao, H.X.; Wu, R.; Cui, L.L.; Su, G.M.; Niu, C.; Zhang, N.; Wang, S.K.; Zhou, D.H. Prevalence and genetic identification of three Entamoeba species in pigs in southeastern China. Biomed. Res. Int. 2019, 2019, 2824017. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Verweij, J.J.; Polderman, A.M.; Clark, C.G. Genetic variation among human isolates of uninucleated cyst-producing Entamoeba species. J. Clin. Microbiol. 2001, 39, 1644–1646. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Tuda, J.; Feng, M.; Imada, M.; Kobayashi, S.; Cheng, X.; Tachibana, H. Identification of Entamoeba polecki with unique 18S rRNA gene sequences from celebes crested macaques and pigs in Tangkoko Nature Reserve, North Sulawesi, Indonesia. J. Eukaryot. Microbiol. 2016, 63, 572–577. [Google Scholar] [CrossRef] [PubMed]
  28. Cuvertoret-Sanz, M.; Weissenbacher-Lang, C.; Lunardi, M.; Brunthaler, R.; Coma, M.; Weissenböck, H.; Segalés, J. Coinfection with Entamoeba polecki and Brachyspira hyodysenteriae in a pig with severe diarrhea. J. Vet. Diagn. Investig. 2019, 31, 298–302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  29. Solaymani-Mohammadi, S.; Rezaian, M.; Hooshyar, H.; Mowlavi, G.R.; Babaei, Z.; Anwar, M.A. Intestinal protozoa in wild boars (Sus scrofa) in western Iran. J. Wildl. Dis. 2004, 40, 801–803. [Google Scholar] [CrossRef] [Green Version]
  30. Ito, H.; Hosokawa, K.; Kawamura, M.; Ito, N.; Abeto, Y.; Matsubayashi, M.; Sasai, K.; Shibahara, T. Swine multifocal ulcerative colitis and crypt abscesses associated with Entamoeba polecki subtype 3 and Salmonella Typhimurium. J. Vet. Med. Sci. 2020, 82, 463–466. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Clark, C.G.; Diamond, L.S. Intraspecific variation and phylogenetic relationships in the genus Entamoeba as revealed by riboprinting. J. Eukaryot. Microbiol. 1997, 44, 142–154. [Google Scholar] [CrossRef]
  32. Ismail, H.A.; Jeon, H.K.; Yu, Y.M.; Do, C.; Lee, Y.H. Intestinal parasite infections in pigs and beef cattle in rural areas of Chungcheongnam-do, Korea. Korean J. Parasitol. 2010, 48, 347–349. [Google Scholar] [CrossRef] [PubMed]
  33. Das, N.; Ray, H.N. A hyperparasite of Entamoeba suis from the Indian domestic pig sus scrofa. J. Protozool. 1968, 15, 383–385. [Google Scholar] [CrossRef] [PubMed]
  34. Symeonidou, I.; Tassis, P.; Gelasakis, A.Ι.; Tzika, E.D.; Papadopoulos, E. Prevalence and risk factors of intestinal parasite infections in Greek swine Farrow-To-Finish Farms. Pathogens 2020, 9, 556. [Google Scholar] [CrossRef] [PubMed]
  35. Schär, F.; Inpankaew, T.; Traub, R.J.; Khieu, V.; Dalsgaard, A.; Chimnoi, W.; Chhoun, C.; Sok, D.; Marti, H.; Muth, S.; et al. The prevalence and diversity of intestinal parasitic infections in humans and domestic animals in a rural Cambodian village. Parasitol. Int. 2014, 63, 597–603. [Google Scholar] [CrossRef] [PubMed]
  36. Damriyasa, I.M.; Bauer, C. Prevalence and age-dependent occurrence of intestinal protozoan infections in suckling piglets. Berl. Munch Tierarztl Wochenschr. 2006, 119, 287–290. [Google Scholar]
  37. Jacob, A.S.; Busby, E.J.; Levy, A.D.; Komm, N.; Clark, C.G. Expanding the Entamoeba universe: New nosts yield novel ribosomal lineages. J. Eukaryot. Microbiol. 2016, 63, 69–78. [Google Scholar] [CrossRef] [PubMed]
  38. Zhou, C.X.; Li, D.F.; Zheng, S.J.; Wang, L.; Chen, Y.C.; Wang, L.Y.; Wu, Y.Y.; Chang, Y.K.; Tao, J.P.; Zhang, L.X. Investigation of intestinal parasite infection in Tibet pigs under different breeding modes in Nyingchi, Tibet. Xumu Yu Shouyi 2018, 50, 88–91. (In Chinese) [Google Scholar]
  39. Wardhana, A.H.; Sawitri, D.H.; Ekawasti, F.; Martindah, E.; Apritadewi, D.; Shibahara, T.; Kusumoto, M.; Tokoro, M.; Sasai, K.; Matsubayashi, M. Occurrence and genetic identifications of porcine Entamoeba, E. suis and E. polecki, at Tangerang in West Java, Indonesia. Parasitol. Res. 2020, 119, 2983–2990. [Google Scholar] [CrossRef]
  40. Ren, M.; Yang, F.; Gou, J.M.; Wang, P.X.; Zou, M.; Zhong, X.H.; Lin, Q. First detection and molecular identification of Entamoeba in Yaks from China. Acta Parasitol. 2021, 66, 264–270. [Google Scholar] [CrossRef]
  41. Shimokawa, C.; Kabir, M.; Taniuchi, M.; Mondal, D.; Kobayashi, S.; Ali, I.K.; Sobuz, S.U.; Senba, M.; Houpt, E.; Haque, R.; et al. Entamoeba moshkovskii is associated with diarrhea in infants and causes diarrhea and colitis in mice. J. Infect. Dis. 2012, 206, 744–751. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Wang, P.; Li, S.; Zou, Y.; Hong, Z.W.; Wang, P.; Zhu, X.Q.; Song, D.P.; Chen, X.Q. Prevalence and subtype distribution of Blastocystis sp. in diarrheic pigs in southern China. Pathogens 2021, 10, 1189. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, P.; Li, S.; Zou, Y.; Du, Z.C.; Song, D.P.; Wang, P.; Chen, X.Q. The infection and molecular characterization of Cryptosporidium spp. in diarrheic pigs in southern China. Microb. Pathog. 2022, 165, 105459. [Google Scholar] [CrossRef]
  44. Zhang, F.; Luo, S.; Gu, J.; Li, Z.; Li, K.; Yuan, W.; Ye, Y.; Li, H.; Ding, Z.; Song, D.; et al. Prevalence and phylogenetic analysis of porcine diarrhea associated viruses in southern China from 2012 to 2018. BMC Vet. Res. 2019, 15, 470. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Song, D.; Zhou, X.; Peng, Q.; Chen, Y.; Zhang, F.; Huang, T.; Zhang, T.; Li, A.; Huang, D.; Wu, Q.; et al. Newly emerged porcine deltacoronavirus associated with diarrhoea in swine in China: Identification, prevalence and full-length genome sequence analysis. Transbound Emerg. Dis. 2015, 62, 575–580. [Google Scholar] [CrossRef] [PubMed]
  46. Candela, E.; Goizueta, C.; Periago, M.V.; Muñoz-Antoli, C. Prevalence of intestinal parasites and molecular characterization of Giardia intestinalis, Blastocystis spp. and Entamoeba histolytica in the village of Fortín Mbororé (Puerto Iguazú, Misiones, Argentina). Parasites Vectors 2021, 14, 510. [Google Scholar] [CrossRef]
  47. Al-Habsi, K.; Yang, R.; Ryan, U.; Jacobson, C.; Miller, D.W. Morphological and molecular characterization of an uninucleated cyst-producing Entamoeba spp. in captured Rangeland goats in Western Australia. Vet. Parasitol. 2017, 235, 41–46. [Google Scholar] [CrossRef] [Green Version]
Animals 12 01764 g001 550
Figure 1. The map of the sample collection in this study, where the red area represents the sampling location.
Figure 1. The map of the sample collection in this study, where the red area represents the sampling location.
Animals 12 01764 g001
Animals 12 01764 g002 550
Figure 2. Phylogenetic analysis of Entamoeba spp. using maximum likelihood (ML) method based on the SSU rRNA gene. The numbers on the branches represent percent bootstrapping values from 1000 replicates, with values of more than 50% shown in the tree. Marked with solid black triangles are species/subtypes identified in this study.
Figure 2. Phylogenetic analysis of Entamoeba spp. using maximum likelihood (ML) method based on the SSU rRNA gene. The numbers on the branches represent percent bootstrapping values from 1000 replicates, with values of more than 50% shown in the tree. Marked with solid black triangles are species/subtypes identified in this study.
Animals 12 01764 g002
Table
Table 1. Factors associated with prevalence and genetic characterizations of Entamoeba spp.
Table 1. Factors associated with prevalence and genetic characterizations of Entamoeba spp.
FactorCategoryNo. TestedNo. Positive (%) [95%CI]OR (95%Cl)p-ValueSpecies/Subtype (No.)
RegionFujian13567 (49.63) [41.20–58.06]Reference>0.05ST1 (27), ST3 (17), E. suis (2), ST1 + ST3 (19), ST1 + E. suis (19)
Jiangxi1036616 (59.46) [56.47–62.45]1.49 (1.04–2.13) ST1 (227), ST3 (66), E. suis (57), ST1 + ST3 (205),
ST1 + E. suis (28), ST3 + E. suis (10), ST1 + ST3 + E. suis (23)
Hunan8349 (59.04) [48.46–69.62]1.46 (0.84–2.54) ST1 (25), ST3 (2), E. suis (5), ST1 + ST3 (19), ST1 + E. suis (2)
AgeSuckling piglets (<21 d)307118 (38.44) [33.00–43.88]Reference<0.001ST1 (40), ST3 (14), E. suis (20), ST1 + ST3 (36), ST1 + E. suis (5),
ST3 + E. suis (1), ST1 + ST3 + E. suis (2)
Weaned piglets (21–70 d)299153 (51.17) [45.50–56.84]1.68 (1.22–2.32) ST1 (61), ST3 (27), E. suis (12), ST1 + ST3 (39), ST1 + E. suis (7),
ST3 + E. suis (3), ST1 + ST3 + E. suis (4)
Fattening pigs (71–180 d)9555 (57.89) [47.97–63.82]2.20 (1.38–3.52) ST1 (18), ST3 (5), ST1 + ST3 (31), ST1 + E. suis (1)
Sows (>180 d)553406 (73.42) [69.74–77.10]4.42 (3.29–5.96) ST1 (160), ST3 (85), E. suis (32), ST1 + ST3 (133),
ST1 + E. suis (19), ST3 + E. suis (6), ST1 + ST3 + E. suis (17)
Total 1254732 (58.37) [55.64–64.10] ST1 (279), ST3 (85), E. suis (64), ST1 + ST3 (239), ST1 + E. suis (32),
ST3 + E. suis (10), ST1 + ST3 + E. suis (23)
Note: ST1 = E. polecki ST1; ST3 = E. polecki ST3.
Table
Table 2. Details of all primers in this study.
Table 2. Details of all primers in this study.
SpeciesSequence of Primers (5′-3′)Size (bp)Annealing Temp (°C)Reference
E. histolyticaE-1: TAAGATGCAGAGCGAAA 56[7]
E-2: GTACAAAGGGCGGGACGTA
EH-1: AAGCATTGTTTCTAGATCTGAG43948
EH-2: AAGAGGTCTAACCGAAATTAG
E. suis764: ATCAAATCAATTAGGCATAACTA 56[3]
RD3: ATCCTTCCGCAGGTTCACCTAC
764: ATCAAATCAATTAGGCATAACTA32052
765: AATTAAAACCTTACGGCTTTAAA
E. poleckiEpolec F6: AAATTACCCACTTTTAATTTAGAGAGG43055[8]
Epolec R6: TTTATCCAAAATCGATCATGAATTTT
Epolecki 1: TCGATATTTATATTGATTCAAATG20155[25]
Epolecki 2: CCTTTCTCCTTTTTTTATATTAG
EpST3 F1: GTCTATTCGATCAATTCAATTA19045[4]
EpST3 R2: TATATTAGTCTTTTTAAAAACTATA
Table
Table 3. Distribution of Entamoeba spp. in different sampling cities.
Table 3. Distribution of Entamoeba spp. in different sampling cities.
ProvinceCityNo. TestedNo. Positive (%)
[95%CI] OR (95%Cl)		OR (95%Cl)p-ValueSpecies/Subtype (No.)
FujianSanming12461 (49.19) [40.39–57.99]Reference>0.05ST1 (23), ST3 (17), E. suis (1), ST1 + ST3 (18), ST1 + E. suis (2)
Nanping116 (54.55) [25.12–83.97]1.24 (0.36–4.27) ST1 (4), E. suis (1), ST1 + ST3 (1)
JiangxiXinyu7630 (39.47) [28.48–50.46]Reference<0.001ST1 (18), ST3 (4), E. suis (4), ST1 + ST3 (2), ST1 + E. suis (2)
Ji’an18592 (49.73) [42.52–56.93]1.52 (0.88–2.61) ST1 (36), ST3 (9), E. suis (5), ST1 + ST3 (25), ST1 + E. suis (7),
ST3 + E. suis (3), ST1 + ST3 + E. suis (7)
Jiujiang239119 (49.79) [43.45–56.13]1.52 (0.90–2.57) ST1 (35), ST3 (20), E. suis (11), ST1 + ST3 (40), ST1 + E. suis (8),
ST3 + E. suis (1), ST1 + ST3 + E. suis (4)
Ganzhou3823 (60.53) [44.99–76.07]2.35 (1.06–5.22) ST1 (8), ST3 (4), E. suis (3), ST1 + ST3 (7), ST3 + E. suis (1)
Nanchang173109 (63.01) [55.81–70.20]2.61 (1.50–4.54) ST1 (34), ST3 (8), E. suis (13), ST1 + ST3 (40), ST1 + E. suis (6),
ST3 + E. suis (3), ST1 + ST3 + E. suis (5)
Fuzhou8965 (73.03) [63.81–82.25]4.15 (2.15–8.01) ST1 (20), ST3 (7), E. suis (3), ST1 + ST3 (33), ST1 + E. suis (1),
ST3 + E. suis (1)
Yichun236178 (75.42) [69.93–80.92]4.71 (2.72–8.13) ST1 (76), ST3 (14), E. suis (18), ST1 + ST3 (58), ST1 + E. suis (4),
ST3 + E. suis (1), ST1 + ST3 + E. suis (7)
HunanZhuzhou249 (37.5) [18.13–56.87]Reference<0.05ST1 (3), E. suis (4), ST1 + ST3 (2)
Hengyang5940 (67.80) [55.87–79.72]3.51 (1.30–9.45) ST1 (22), ST3 (2), E. suis (1), ST1 + ST3 (13), ST1 + E. suis (2)
Total 1254732 (58.37) [55.64–64.10] ST1 (279), ST3 (85), E. suis (64), ST1 + ST3 (239), ST1 + E. suis (32),
ST3 + E. suis (10), ST1 + ST3 + E. suis (23)
Note: ST1 = E. polecki ST1; ST3 = E. polecki ST3.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, P.; Li, S.; Zou, Y.; Han, R.-Y.; Wang, P.; Song, D.-P.; Wang, C.-B.; Chen, X.-Q. Molecular Characterization of Entamoeba spp. in Pigs with Diarrhea in Southern China. Animals 2022, 12, 1764. https://doi.org/10.3390/ani12141764

AMA Style

Wang P, Li S, Zou Y, Han R-Y, Wang P, Song D-P, Wang C-B, Chen X-Q. Molecular Characterization of Entamoeba spp. in Pigs with Diarrhea in Southern China. Animals. 2022; 12(14):1764. https://doi.org/10.3390/ani12141764

Chicago/Turabian Style

Wang, Pei, Sen Li, Yang Zou, Ru-Yi Han, Ping Wang, De-Ping Song, Cheng-Bin Wang, and Xiao-Qing Chen. 2022. "Molecular Characterization of Entamoeba spp. in Pigs with Diarrhea in Southern China" Animals 12, no. 14: 1764. https://doi.org/10.3390/ani12141764

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop