Molecular Identification of Sarcocystis Species in Sheep from Lithuania
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Microscopic Examination of Sarcocysts
2.3. Molecular and Phylogenetic Analysis of Sarcocysts
2.4. Peptic Digestion
2.5. Molecular Analysis of Digested Samples
3. Results
3.1. Morphology of Sarcocysts as Observed under a Light Microscope
3.2. Molecular and Phylogenetic Analysis of Isolated Sarcocysts
3.3. Identification of Sarcocystis spp. in Sheep from Lithuania by nPCR
3.4. Distribution of Sarcocystis spp. in the Examined Sheep Samples from Lithuania
4. Discussion
4.1. Prevalence of Sarcocystis spp. in Sheep
4.2. Canids Serve as Definitive Hosts of Sarcocystis spp. in Sheep from Lithuania
4.3. Genetic Characterisation of Sarcocystis spp. in Sheep
4.4. Distribution of Sarcocystis Species in Different Muscles of Sheep
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2016. [Google Scholar]
- Januškevičius, V.; Januškevičienė, G.; Prakas, P.; Butkauskas, D.; Petkevičius, S. Prevalence and Intensity of Sarcocystis spp. Infection in Animals Slaughtered for Food in Lithuania. Vet. Med. Czech 2019, 64, 149–157. [Google Scholar] [CrossRef]
- Sudan, V.; Kumar, R.; Shanker, D.; Paliwal, S. First Report of Molecular Characterization and Phylogenetic Analysis of Sarcocystis tenella from India. Parasitol. Res. 2019, 118, 1429–1434. [Google Scholar] [CrossRef]
- Hu, J.J.; Huang, S.; Wen, T.; Esch, G.W.; Liang, Y.; Li, H.L. Sarcocystis spp. in Domestic Sheep in Kunming City, China: Prevalence, Morphology, and Molecular Characteristics. Parasite 2017, 24, 30. [Google Scholar] [CrossRef]
- Wang, G.; Wei, T.; Wang, X.; Li, W.; Zhang, P.; Dong, M.; Xiao, H. The Morphology and Life Cycle of Sarcocystis microps n. sp. in Sheep of Qinghai in China. China Vet. Technol. 1988, 6, 9–11. [Google Scholar]
- Saito, M.; Shibata, Y.; Kubo, M.; Itagaki, H. Sarcocystis mihoensis n. sp. from Sheep in Japan. J. Vet. Med. Sci. 1997, 59, 103–106. [Google Scholar] [CrossRef]
- Gjerde, B.; de la Fuente, C.; Alunda, J.M.; Luzón, M. Molecular Characterisation of Five Sarcocystis Species in Domestic Sheep (Ovis aries) from Spain. Parasitol. Res. 2020, 119, 215–231. [Google Scholar] [CrossRef]
- Giannetto, S.; Poglayen, G.; Brianti, E.; Gaglio, G.; Scala, A. Sarcocystis gracilis-like Sarcocysts in a Sheep. Vet. Rec. 2005, 156, 322–323. [Google Scholar] [CrossRef]
- Dong, H.; Su, R.; Wang, Y.; Tong, Z.; Zhang, L.; Yang, Y.; Hu, J. Sarcocystis Species in Wild and Domestic Sheep (Ovis ammon and Ovis aries) from China. BMC Vet. Res. 2018, 14, 377. [Google Scholar] [CrossRef]
- Dessì, G.; Tamponi, C.; Pasini, C.; Porcu, F.; Meloni, L.; Cavallo, L.; Sini, M.F.; Knoll, S.; Scala, A.; Varcasia, A. A Survey on Apicomplexa Protozoa in Sheep Slaughtered for Human Consumption. Parasitol. Res. 2022, 121, 1437–1445. [Google Scholar] [CrossRef]
- Martínez-Navalón, B.; Anastasio-Giner, B.; Cano-Fructuoso, M.; Sanchez-Martínez, P.; Llopis-Morant, A.; Perez-Castarlenas, B.; Goyena, E.; de Larrea, E.B. Sarcocystis Infection: A Major Cause of Carcass Condemnation in Adult Sheep in Spain. Span. J. Agric. Res. 2021, 10, 388. [Google Scholar] [CrossRef]
- Bittencourt, M.V.; Meneses, I.D.; Ribeiro-Andrade, M.; de Jesus, R.F.; de Araújo, F.R.; Gondim, L.F. Sarcocystis spp. in Sheep and Goats: Frequency of Infection and Species Identification by Morphological, Ultrastructural, and Molecular Tests in Bahia, Brazil. Parasitol. Res. 2016, 115, 1683–1689. [Google Scholar] [CrossRef]
- Amairia, S.; Amdouni, Y.; Rouatbi, M.; Rjeibi, R.M.; Awadi, S.; Gharbi, M. First Detection and Molecular Identification of Sarcocystis spp. in Small Ruminants in North-West Tunisia. Meat. Sci. 2017, 122, 55–59. [Google Scholar] [CrossRef]
- El-Morsey, A.; Abdo, W.; Sultan, K.; Elhawary, N.M.; AbouZaid, A.A. Ultrastructural and Molecular Identification of the Sarcocysts of Sarcocystis tenella and Sarcocystis arieticanis Infecting Domestic Sheep (Ovis aries) from Egypt. Acta Parasit. 2019, 64, 501–513. [Google Scholar] [CrossRef]
- Metwally, D.M.; Al-Damigh, M.A.; Al-Turaiki, I.M.; El-Khadragy, M.F. Molecular Characterization of Sarcocystis Species Isolated from Sheep and Goats in Riyadh, Saudi Arabia. Animals 2019, 9, 256. [Google Scholar] [CrossRef]
- Salehi, M.; Spotin, A.; Rostamian, M.; Adami, M. Prevalence and Molecular Assessment of Sarcocystis Infection in Livestock in Northeast Iran. Comp. Immunol. Microbiol. Infect. Dis. 2022, 80, 101738. [Google Scholar] [CrossRef]
- Farhang-Pajuh, F.; Yakhchali, M.; Mardani, K. Molecular Determination of Abundance of Infection with Sarcocystis Species in Slaughtered Sheep of Urmia, Iran. Vet. Res. Forum 2014, 5, 181–186. [Google Scholar]
- Hamidinejat, H.; Moetamedi, H.; Alborzi, A.; Hatami, A. Molecular Detection of Sarcocystis Species in Slaughtered Sheep by PCR-RFLP from South-western of Iran. J. Parasit. Dis. 2014, 38, 233–237. [Google Scholar] [CrossRef][Green Version]
- Rubiola, S.; Civera, T.; Panebianco, F.; Vercellino, D.; Chiesa, F. Molecular Detection of Cattle Sarcocystis spp. in North-West Italy Highlights their Association with Bovine Eosinophilic Myositis. Parasites Vectors 2021, 14, 223. [Google Scholar] [CrossRef]
- Prakas, P.; Strazdaitė-Žielienė, Ž.; Januškevičius, V.; Chiesa, F.; Baranauskaitė, A.; Rudaitytė-Lukošienė, E.; Servienė, E.; Petkevičius, S.; Butkauskas, D. Molecular Identification of Four Sarcocystis species in Cattle from Lithuania, Including S. hominis, and Development of a Rapid Molecular Detection Method. Parasites Vectors 2020, 13, 610. [Google Scholar] [CrossRef]
- Calero-Bernal, R.; Verma, S.K.; Oliveira, S.; Yang, Y.; Rosenthal, B.M.; Dubey, J.P. In the United States, Negligible Rates of Zoonotic Sarcocystosis Occur in Feral Swine that, by Contrast, Frequently Harbour Infections with Sarcocystis miescheriana, a Related Parasite Contracted from Canids. Parasitology 2015, 142, 549–556. [Google Scholar] [CrossRef]
- Sudan, V.; Shanker, D.; Paliwal, S.; Kumar, R.; Singh, A. Phylogenetics of Sarcocystis fusiformis Isolates Based on 18S rRNA and cox 1 Genes. Microb. Pathog. 2021, 159, 105144. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Gjerde, B. Phylogenetic Relationships among Sarcocystis Species in Cervids, Cattle and Sheep Inferred from the Mitochondrial Cytochrome C Oxidase Subunit I Gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef]
- Prakas, P.; Rehbein, S.; Rudaitytė-Lukošienė, E.; Butkauskas, D. Molecular Identification of Sarcocystis species in Diaphragm Muscle Tissue of European mouflon (Ovis gmelini musimon) from Austria. Parasitol. Res. 2021, 120, 2695–2702. [Google Scholar] [CrossRef]
- Dubey, J.P. Refinement of Pepsin Digestion Method for Isolation of Toxoplasma gondii from Infected Tissues. Vet. Parasitol. 1998, 74, 75–77. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3-new Capabilities and Interfaces. Nucleic. Acids. Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Kolenda, R.; Schierack, P.; Zieba, F.; Zwijacz-Kozica, T.; Bednarski, M. First Molecular Characterization of Sarcocystis tenella in Tatra Chamois (Rupicapra rupicapra tatrica) in Poland. Parasitol. Res. 2015, 114, 3885–3892. [Google Scholar] [CrossRef]
- Delgado-de Las Cuevas, G.E.; Prakas, P.; Rudaitytė-Lukošienė, E.; García-Gil, M.L.; Martínez-González, M.; Butkauskas, D.; Mowery, J.D.; Dubey, J.P.; Habela, M.A.; Calero-Bernal, R. First Description of Sarcocystis Species Infecting Barbary sheep (Ammotragus lervia). Parasitol. Res. 2021, 120, 2881–2886. [Google Scholar] [CrossRef]
- Minuzzi, C.E.; Cezar, A.S.; Bräunig, P.; Portella, L.P.; Rodrigues, F.S.; Sangioni, L.A.; Vogel, F.S.F. Occurrence of Sarcocystis gigantea Macrocysts and High Frequency of S. tenella Microcysts in Sheep from Southern Brazil. Vet. Parasitol. Reg. Stud. Rep. 2019, 15, 100256. [Google Scholar] [CrossRef]
- Rassouli, M.; Ahmadpanahi, J.; Alvandi, A. Prevalence of Sarcocystis spp. and Hammondia spp. Microcysts in Esophagus Tissue of Sheep and Cattle, Emphasized on their Morphological Differences. Parasitol. Res. 2014, 113, 3801–3805. [Google Scholar] [CrossRef]
- Mirzaei, M.; Rezaei, H. The Role of Sheep in the Epidemiology of Sarcocystis spp. in Tabriz Area Northwest of Iran. J. Parasit. Dis. 2016, 40, 285–288. [Google Scholar] [CrossRef][Green Version]
- Zangana, I.K.; Hussein, S.N. Prevalence of Sarcocystis Species (Sarcocystis ovicanis and Sarcocystis capricanis) in Tongue Muscle of Sheep and Goats in Duhok Province, Kurdistan Region, North Iraq. ARO 2017, 5, 36–40. [Google Scholar] [CrossRef]
- Abdullah, S.H. Investigation of Sarcocystis spp. in Slaughtered Cattle and Sheep by Peptic Digestion and Histological Examination in Sulaimani Province, Iraq. Vet. World 2021, 14, 468–474. [Google Scholar] [CrossRef]
- Latif, B.; Kannan Kutty, M.; Muslim, A.; Hussaini, J.; Omar, E.; Heo, C.C.; Rossle, N.F.; Abdullah, S.; Kamarudin, M.A.; Zulkarnain, M.A. Light Microscopy and Molecular Identification of Sarcocystis spp. in Meat Producing Animals in Selangor, Malaysia. Trop. Biomed. 2015, 32, 444–452. [Google Scholar]
- Daryani, A.; Alaei, R.; Dehghan, M.H.; Arab, R.; Sharif, M.; Ziaei, H. Survey of Sarcocystis Infection in Slaughtered Sheep and Buffaloes in Ardabil, Iran. J. Anim. Vet. Adv. 2006, 5, 60–62. [Google Scholar]
- Dehaghi, M.M.; Fallahi, M.; Sami, M.; Radfar, M.H. Survey of Sarcocystis Infection in Slaughtered Sheep in Kerman Abattoir, Kerman, Iran. Comp. Clin. Path. 2013, 22, 343–346. [Google Scholar] [CrossRef]
- El-Morsey, A.; Abdo, W.; Zaid, A.A.; Sorour, S.S. Morphologic and Molecular Identification of Three Macroscopic Sarcocystis Species Infecting Domestic Sheep (Ovis aries) and Cattle (Bos taurus) in Egypt. Parasitol. Res. 2021, 120, 637–654. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.F.; Semeniuk, C.A.; Kutz, S.J.; Massolo, A. Dog-walking Behaviours Affect Gastrointestinal Parasitism in Park-attending Dogs. Parasites Vectors 2014, 7, 429. [Google Scholar] [CrossRef] [PubMed]
- Munday, B.L.; Obendorf, D.L. Morphology of Sarcocystis gigantea in Experimentally Infected Sheep. Vet. Parasitol. 1984, 15, 193–199. [Google Scholar] [CrossRef]
- Obendorf, D.L.; Munday, B.L. Experimental Infection with Sarcocystis medusiformis in Sheep. Vet. Parasitol. 1987, 24, 59–65. [Google Scholar] [CrossRef]



| Sarcocystis Species | Primer Name | Orientation | Primer Sequence | Ta, °C | Length of PCR Product, bp |
|---|---|---|---|---|---|
| S. arieticanis | SF1 1 | Forward | ATGGCGTACAACAATCATAAAGAA | 53 | 913 |
| SsunR3 PS | Reverse | CCGTTGGWATGGCRATCAT | |||
| V2arie3 PS | Forward | TAGTTCTTGGCCTGGCTATTCTT | 60 | 371 | |
| V2arie4 PS | Reverse | CTGACCTCCAAAAACTGGCTTAC | |||
| S. gigantea | V2gig1 PS | Forward | GCACTTCGAGCATTCTTGG | 57 | 548 |
| V2gig2 2 | Reverse | ATCTACATCCACCGTAGGAACCTTA | |||
| V2gig3 2 | Forward | CAGCAAGTACCAAGTTCTGTACGTC | 62 | 322 | |
| V2gig4 PS | Reverse | GGTGCCGAGTACCGAGATACAT | |||
| S. medusiformis | V2medu1 PS | Forward | TTAATGGCATATCGTACTACCTATTG | 56 | 729 |
| V2medu2 PS | Reverse | CCCATGCATCAACCTCCAG | |||
| V2medu3 PS | Forward | GTATCCTGGGGGCCATTAACTT | 61 | 389 | |
| V2medu4 PS | Reverse | CCAAACCAGTGTTCCGAGTATTG | |||
| S. mihoensis | V2miho1 PS | Forward | ATCTTTACACTGCACGGTTTGTTT | 60 | 844 |
| V2miho2 PS | Reverse | AGTCGTTATGTCGGAAGTCAACAG | |||
| V2miho3 PS | Forward | GATGTTACCTCGGGTAAATGCTCTT | 60 | 526 | |
| V2miho4 PS | Reverse | AAAAACATGTCTAGCTCCTAACACC | |||
| S. tenella | SF1 1 | Forward | ATGGCGTACAACAATCATAAAGAA | 53 | 913 |
| SsunR3 PS | Reverse | CCGTTGGWATGGCRATCAT | |||
| V3tenF3 PS | Forward | ACGCTATTTACCTGGGCAATC | 59 | 381 | |
| V3tenR2 PS | Reverse | TAGTCACGGCAGAGAAGTAGGAC |
| Sequence Similarity, % | Intermediate Host | Country | NCBI GenBank Acc. No. | Reference |
|---|---|---|---|---|
| S. arieticanis | ||||
| 99.33–99.78 | Ovis aries | Spain | MK419975–MK419976 | [7] |
| 98.77–99.11 | Ovis aries | China | MF039324 | [4] |
| 92.39–93.85 | Ovis aries | Egypt | MH413047–MH413048 | [14] |
| S. tenella | ||||
| 97.77–99.89 | Ovis aries musimon | Austria | MW768881–MW768899 | [25] |
| 98.76–99.78 | Rupicapra rupicapra tatrica | Poland | KP263744–KP263751 | [28] |
| 98.66–99.78 | Ammotragus lervia | Spain | MW848314–MW848319 | [29] |
| 98.43–99.78 | Ovis aries | Spain | MK419977–MK420010 | [7] |
| 98.21–99.78 | Ovis aries | Norway | KC209723–KC209732 | [24] |
| 98.96–99.65 | Ovis ammon | China | MH561854 | [9] |
| 98.55–99.55 | Ovis aries | India | MH523439–MH523443 | [3] |
| 97.32–98.10 | Ovis aries | China | MF039322–MF039323 | [4] |
| 95.86–97.54 | Ovis aries | Egypt | MH413045–MH413046 | [14] |
| Species | Sequence Similarity, % | ||
|---|---|---|---|
| Intraspecific Variation | Interpsecific Variation | ||
| Comparison between Isolates Obtained in the Present Study | Comparison of Sequences from the Same Species Available in Genbank | ||
| S. arieticanis | 97.54–100 | 91.36–99.69 | 86.83–88.09 S. hircicanis, 77.35–79.30 S. cervicanis, 76.47–78.57 S. capracanis |
| S. tenella | 97.93–100 | 95.27–100 | 89.05–92.63 S. capracanis, 86.73–87.91 S. heydorni, 81.55–84.52 S. gracilis |
| Positive Cases of Sarcocystis spp. | Muscle Type | ||
|---|---|---|---|
| Diaphragm | Oesophagus | Heart | |
| Sarcocystis spp. | 69/69 (100 %) | 67/69 (97.10 %) | 52/52 (100 %) |
| S. arieticanis overall | 65/69 (94.20 %) | 63/69 (91.30 %) | 46/52 (88.46 %) |
| S. tenella overall ** | 69/69 (100 %) a,*** | 57/69 (82.61 %) b,*** | 49/52 (94.23 %) |
| S. arieticanis single infection | 0/69 (0 %) | 10/69 (14.49 %) | 3/52 (5.77 %) |
| S. tenella single infection | 4/69 (5.80 %) | 4/69 (5.80 %) | 6/52 (11.54 %) |
| Mixed infections with S. arieticanis and S. tenella * | 65/69 (94.20 %) c,** | 53/69 (76.81 %) d,** | 43/52 (82.69 %) |
| The prevalence of Sarcocystis spp. depending on the age group of sheep | |||
| S. arieticanis in sheep younger than two years | 42/46 (91.3 %) | 41/46 (89.1 %) | 29/31 (93.5 %) |
| S. arieticanis in sheep older than two years | 23/23 (100 %) | 22/23 (95.7 %) | 17/21 (81.0 %) |
| S. tenella in sheep younger than two years | 46/46 (100 %) | 39/46 (84.8 %) | 30/31 (96.8 %) |
| S. tenella in sheep older than two years | 23/23 (100 %) | 18/23 (78.3 %) | 19/21 (90.5 %) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Januškevičius, V.; Rudaitytė-Lukošienė, E.; Prakas, P. Molecular Identification of Sarcocystis Species in Sheep from Lithuania. Animals 2022, 12, 2048. https://doi.org/10.3390/ani12162048
Marandykina-Prakienė A, Butkauskas D, Gudiškis N, Juozaitytė-Ngugu E, Januškevičius V, Rudaitytė-Lukošienė E, Prakas P. Molecular Identification of Sarcocystis Species in Sheep from Lithuania. Animals. 2022; 12(16):2048. https://doi.org/10.3390/ani12162048
Chicago/Turabian StyleMarandykina-Prakienė, Alina, Dalius Butkauskas, Naglis Gudiškis, Evelina Juozaitytė-Ngugu, Vytautas Januškevičius, Eglė Rudaitytė-Lukošienė, and Petras Prakas. 2022. "Molecular Identification of Sarcocystis Species in Sheep from Lithuania" Animals 12, no. 16: 2048. https://doi.org/10.3390/ani12162048
APA StyleMarandykina-Prakienė, A., Butkauskas, D., Gudiškis, N., Juozaitytė-Ngugu, E., Januškevičius, V., Rudaitytė-Lukošienė, E., & Prakas, P. (2022). Molecular Identification of Sarcocystis Species in Sheep from Lithuania. Animals, 12(16), 2048. https://doi.org/10.3390/ani12162048

