Expression of CSF1, AR, and SRD5A2 during Postnatal Development of the Boar Reproductive Tract
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. RNA Extraction and cDNA Synthesis
2.3. qRT-PCR
2.4. Immunohistochemistry
2.5. Statistical Analysis
3. Results
3.1. Gene Expression and Leukocyte/Protein Localization during Normal Testicular Development
3.2. Gene Expression and Leukocyte/Protein Localization during Normal Prostate Development
3.3. Gene Expression during Normal Development of the Seminal Vesicles
3.4. SRD5A Expression in Other Tissues
3.5. Gene Expression in the Testis following Reduced Estrogenic or Androgenic Signaling
3.6. Gene Expression in the Prostate following Reduced Estrogenic or Androgenic Signaling
3.7. Gene Expression in the Seminal Vesicles Following Reduced Estrogenic or Androgenic Signaling
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Allrich, R.D.; Christenson, R.K.; Ford, J.J.; Zimmerman, D.R. Pubertal development of the boar: Testosterone, estradiol-17 beta, cortisol and LH concentrations before and after castration at various ages. J. Anim. Sci. 1982, 55, 1139–1146. [Google Scholar] [CrossRef]
- Ford, J.J. Serum estrogen concentrations during postnatal development in male pigs. Proc. Soc. Exp. Biol. Med. 1983, 174, 160–164. [Google Scholar] [CrossRef]
- Colenbrander, B.; de Jong, F.H.; Wensing, C.J. Changes in serum testosterone concentrations in the male pig during development. J. Reprod. Fertil. 1978, 53, 377–380. [Google Scholar] [CrossRef]
- Colenbrander, B.; Kruip, T.A.; Dieleman, S.J.; Wensing, C.J. Changes in serum LH concentrations during normal and abnormal sexual development in the pig. Biol. Reprod. 1977, 17, 506–513. [Google Scholar] [CrossRef] [Green Version]
- Schwarzenberger, F.; Toole, G.S.; Christie, H.L.; Raeside, J.I. Plasma levels of several androgens and estrogens from birth to puberty in male domestic pigs. Acta Endocrinol. 1993, 128, 173–177. [Google Scholar] [CrossRef]
- At-Taras, E.E.; Conley, A.J.; Berger, T.; Roser, J.F. Reducing estrogen synthesis does not affect gonadotropin secretion in the developing boar. Biol. Reprod. 2006, 74, 58–66. [Google Scholar] [CrossRef] [Green Version]
- Jones, C.V.; Ricardo, S.D. Macrophages and CSF-1: Implications for development and beyond. Organogenesis 2013, 9, 249–260. [Google Scholar] [CrossRef] [Green Version]
- Stefater, J.A., 3rd; Ren, S.; Lang, R.A.; Duffield, J.S. Metchnikoff’s policemen: Macrophages in development, homeostasis and regeneration. Trends Mol. Med. 2011, 17, 743–752. [Google Scholar] [CrossRef] [Green Version]
- De, M.; Wood, G.W. Influence of oestrogen and progesterone on macrophage distribution in the mouse uterus. J. Endocrinol. 1990, 126, 417–424. [Google Scholar] [CrossRef]
- Dama, A.; Baggio, C.; Boscaro, C.; Albiero, M.; Cignarella, A. Estrogen Receptor Functions and Pathways at the Vascular Immune Interface. Int. J. Mol. Sci. 2021, 22, 4254. [Google Scholar] [CrossRef]
- Becerra-Diaz, M.; Song, M.; Heller, N. Androgen and Androgen Receptors as Regulators of Monocyte and Macrophage Biology in the Healthy and Diseased Lung. Front. Immunol. 2020, 11, 1698. [Google Scholar] [CrossRef]
- Saunders, F.J. Some Aspects of Relation of Structure of Steroids to Their Prostate-Stimulating Effects. Natl. Cancer Inst. Monogr. 1963, 12, 139–159. [Google Scholar]
- Saartok, T.; Dahlberg, E.; Gustafsson, J.A. Relative binding affinity of anabolic-androgenic steroids: Comparison of the binding to the androgen receptors in skeletal muscle and in prostate, as well as to sex hormone-binding globulin. Endocrinology 1984, 114, 2100–2106. [Google Scholar] [CrossRef]
- Wilson, J.D. Role of dihydrotestosterone in androgen action. Prostate Suppl. 1996, 6, 88–92. [Google Scholar] [CrossRef]
- Booth, W.D. In-vitro metabolism of unconjugated androgens, oestrogens and the sulphate conjugates of androgens and oestrone by accessory sex organs of the mature domestic boar. J. Endocrinol. 1983, 96, 457–464. [Google Scholar] [CrossRef]
- Raeside, J.I.; Christie, H.L.; Renaud, R.L. Androgen and estrogen metabolism in the reproductive tract and accessory sex glands of the domestic boar (Sus scrofa). Biol. Reprod. 1999, 61, 1242–1248. [Google Scholar] [CrossRef] [Green Version]
- Thigpen, A.E.; Silver, R.I.; Guileyardo, J.M.; Casey, M.L.; McConnell, J.D.; Russell, D.W. Tissue distribution and ontogeny of steroid 5 alpha-reductase isozyme expression. J. Clin. Investig. 1993, 92, 903–910. [Google Scholar] [CrossRef]
- Eicheler, W.; Dreher, M.; Hoffmann, R.; Happle, R.; Aumuller, G. Immunohistochemical evidence for differential distribution of 5 alpha-reductase isoenzymes in human skin. Br. J. Dermatol. 1995, 133, 371–376. [Google Scholar] [CrossRef]
- Eicheler, W.; Tuohimaa, P.; Vilja, P.; Adermann, K.; Forssmann, W.G.; Aumuller, G. Immunocytochemical localization of human 5 alpha-reductase 2 with polyclonal antibodies in androgen target and non-target human tissues. J. Histochem. Cytochem. 1994, 42, 667–675. [Google Scholar] [CrossRef] [Green Version]
- Watkins, W.J.; Goldring, C.E.; Gower, D.B. Properties of 4-ene-5 alpha-reductase and studies on its solubilization from porcine testicular microsomes. J. Steroid Biochem. 1988, 29, 325–331. [Google Scholar] [CrossRef]
- Gorowska, E.; Zarzycka, M.; Chojnacka, K.; Bilinska, B.; Hejmej, A. Postnatal exposure to flutamide affects CDH1 and CTNNB1 gene expression in adult pig epididymis and prostate and alters metabolism of testosterone. Andrology 2014, 2, 186–197. [Google Scholar] [CrossRef]
- Palin, M.F.; Faguy, M.; LeHoux, J.G.; Pelletier, G. Inhibitory effects of Serenoa repens on the kinetic of pig prostatic microsomal 5alpha-reductase activity. Endocrine 1998, 9, 65–69. [Google Scholar] [CrossRef]
- Joshi, H.S.; Raeside, J.I. Synergistic effects of testosterone and oestrogens on accessory sex glands and sexual behaviour of the boar. J. Reprod. Fertil. 1973, 33, 411–423. [Google Scholar] [CrossRef]
- Carreau, S.; Hess, R.A. Oestrogens and spermatogenesis. Philos. Trans. R Soc. Lond. B Biol. Sci. 2010, 365, 1517–1535. [Google Scholar] [CrossRef] [Green Version]
- At-Taras, E.E.; Berger, T.; McCarthy, M.J.; Conley, A.J.; Nitta-Oda, B.J.; Roser, J.F. Reducing estrogen synthesis in developing boars increases testis size and total sperm production. J. Androl. 2006, 27, 552–559. [Google Scholar] [CrossRef]
- Berger, T.; McCarthy, M.; Pearl, C.A.; At-Taras, E.; Roser, J.F.; Conley, A. Reducing endogenous estrogens during the neonatal and juvenile periods affects reproductive tract development and sperm production in postpuberal boars. Anim. Reprod. Sci. 2008, 109, 218–235. [Google Scholar] [CrossRef]
- Pollard, J.W.; Lin, E.Y.; Zhu, L. Complexity in uterine macrophage responses to cytokines in mice. Biol. Reprod. 1998, 58, 1469–1475. [Google Scholar] [CrossRef] [Green Version]
- Pepe, G.; Locati, M.; Della Torre, S.; Mornata, F.; Cignarella, A.; Maggi, A.; Vegeto, E. The estrogen-macrophage interplay in the homeostasis of the female reproductive tract. Hum. Reprod. Update 2018, 24, 652–672. [Google Scholar] [CrossRef]
- Pollanen, P.; Maddocks, S. Macrophages, lymphocytes and MHC II antigen in the ram and the rat testis. J. Reprod. Fertil. 1988, 82, 437–445. [Google Scholar] [CrossRef] [Green Version]
- Mullen, T.E., Jr.; Kiessling, R.L.; Kiessling, A.A. Tissue-specific populations of leukocytes in semen-producing organs of the normal, hemicastrated, and vasectomized mouse. AIDS Res. Hum. Retroviruses 2003, 19, 235–243. [Google Scholar] [CrossRef]
- Pollard, J.W.; Dominguez, M.G.; Mocci, S.; Cohen, P.E.; Stanley, E.R. Effect of the colony-stimulating factor-1 null mutation, osteopetrotic (csfm(op)), on the distribution of macrophages in the male mouse reproductive tract. Biol. Reprod. 1997, 56, 1290–1300. [Google Scholar] [CrossRef] [PubMed]
- Theyer, G.; Kramer, G.; Assmann, I.; Sherwood, E.; Preinfalk, W.; Marberger, M.; Zechner, O.; Steiner, G.E. Phenotypic characterization of infiltrating leukocytes in benign prostatic hyperplasia. Lab. Investig. 1992, 66, 96–107. [Google Scholar]
- Wang, M.; Yang, Y.; Cansever, D.; Wang, Y.; Kantores, C.; Messiaen, S.; Moison, D.; Livera, G.; Chakarov, S.; Weinberger, T.; et al. Two populations of self-maintaining monocyte-independent macrophages exist in adult epididymis and testis. Proc. Natl. Acad. Sci. USA 2021, 118, e2013686117. [Google Scholar] [CrossRef] [PubMed]
- Padilla, L.; Martinez-Hernandez, J.; Barranco, I.; Lucas, X.; Pastor, L.M.; Rodriguez-Martinez, H.; Roca, J.; Parrilla, I. Granulocyte-macrophage colony stimulating factor (GM-CSF) is fully expressed in the genital tract, seminal plasma and spermatozoa of male pigs. Sci. Rep. 2020, 10, 13360. [Google Scholar] [CrossRef] [PubMed]
- Yee, J.B.; Hutson, J.C. Effects of testicular macrophage-conditioned medium on Leydig cells in culture. Endocrinology 1985, 116, 2682–2684. [Google Scholar] [CrossRef]
- Hales, D.B. Testicular macrophage modulation of Leydig cell steroidogenesis. J. Reprod. Immunol. 2002, 57, 3–18. [Google Scholar] [CrossRef]
- Raith, L.; Karl, H.J. Enzymes of androgen metabolism in human leucocytes. Acta Endocrinol. Suppl. 1973, 173, 137. [Google Scholar] [CrossRef]
- Clair, P.; Patricot, M.C.; Mathian, B.; Revol, A. Androgen metabolism in vitro by human leukocytes, variations with sex and age. J. Steroid Biochem. 1984, 20, 377–381. [Google Scholar] [CrossRef]
- Araneo, B.A.; Dowell, T.; Diegel, M.; Daynes, R.A. Dihydrotestosterone exerts a depressive influence on the production of interleukin-4 (IL-4), IL-5, and gamma-interferon, but not IL-2 by activated murine T cells. Blood 1991, 78, 688–699. [Google Scholar] [CrossRef] [Green Version]
- Fang, L.Y.; Izumi, K.; Lai, K.P.; Liang, L.; Li, L.; Miyamoto, H.; Lin, W.J.; Chang, C. Infiltrating macrophages promote prostate tumorigenesis via modulating androgen receptor-mediated CCL4-STAT3 signaling. Cancer Res. 2013, 73, 5633–5646. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Lin, W.J.; Izumi, K.; Jiang, Q.; Lai, K.P.; Xu, D.; Fang, L.Y.; Lu, T.; Li, L.; Xia, S.; et al. Increased infiltrated macrophages in benign prostatic hyperplasia (BPH): Role of stromal androgen receptor in macrophage-induced prostate stromal cell proliferation. J. Biol. Chem. 2012, 287, 18376–18385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Summerfield, A. Special issue on porcine immunology: An introduction from the guest editor. Dev. Comp. Immunol. 2009, 33, 265–266. [Google Scholar] [CrossRef] [PubMed]
- Raeside, J.I. The formation of unconjugated and sulfoconjugated estrogens by Leydig cells of the boar testis. Can. J. Biochem. Cell Biol. 1983, 61, 790–795. [Google Scholar] [CrossRef] [PubMed]
- Raeside, J.I.; Renaud, R.L. Estrogen and androgen production by purified Leydig cells of mature boars. Biol. Reprod. 1983, 28, 727–733. [Google Scholar] [CrossRef] [PubMed]
- Berger, T.; Conley, A.J.; Van Klompenberg, M.; Roser, J.F.; Hovey, R.C. Increased testicular Sertoli cell population induced by an estrogen receptor antagonist. Mol. Cell Endocrinol. 2013, 366, 53–58. [Google Scholar] [CrossRef]
- Bassols, A.; Costa, C.; Eckersall, P.D.; Osada, J.; Sabria, J.; Tibau, J. The pig as an animal model for human pathologies: A proteomics perspective. Proteom. Clin. Appl. 2014, 8, 715–731. [Google Scholar] [CrossRef]
- Walters, E.M.; Prather, R.S. Advancing swine models for human health and diseases. Mo. Med. 2013, 110, 212–215. [Google Scholar]
- Lunney, J.K. Advances in swine biomedical model genomics. Int. J. Biol. Sci. 2007, 3, 179–184. [Google Scholar] [CrossRef]
- Legacki, E.; Conley, A.J.; Nitta-Oda, B.J.; Berger, T. Porcine sertoli cell proliferation after androgen receptor inactivation. Biol. Reprod. 2015, 92, 93. [Google Scholar] [CrossRef]
- Berger, T.; Tang, S.; Tu, L.; Soto, D.A.; Conley, A.J.; Nitta-Oda, B. Changes in testicular gene expression following reduced estradiol synthesis: A complex pathway to increased porcine Sertoli cell proliferation. Mol. Cell Endocrinol. 2021, 523, 111099. [Google Scholar] [CrossRef]
- Winnall, W.R.; Muir, J.A.; Hedger, M.P. Differential responses of epithelial Sertoli cells of the rat testis to Toll-like receptor 2 and 4 ligands: Implications for studies of testicular inflammation using bacterial lipopolysaccharides. Innate Immun. 2011, 17, 123–136. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Human Protein Atlas. Available online: https://www.proteinatlas.org (accessed on 1 August 2022).
- Lyck Hansen, M.; Beck, H.C.; Irmukhamedov, A.; Jensen, P.S.; Olsen, M.H.; Rasmussen, L.M. Proteome analysis of human arterial tissue discloses associations between the vascular content of small leucine-rich repeat proteoglycans and pulse wave velocity. Arterioscler. Thromb. Vasc. Biol. 2015, 35, 1896–1903. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niemi, M.; Sharpe, R.M.; Brown, W.R. Macrophages in the interstitial tissue of the rat testis. Cell Tissue Res. 1986, 243, 337–344. [Google Scholar] [CrossRef] [PubMed]
- Hume, D.A.; Halpin, D.; Charlton, H.; Gordon, S. The mononuclear phagocyte system of the mouse defined by immunohistochemical localization of antigen F4/80: Macrophages of endocrine organs. Proc. Natl. Acad. Sci. USA 1984, 81, 4174–4177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sun, X.R.; Hedger, M.P.; Risbridger, G.P. The effect of testicular macrophages and interleukin-1 on testosterone production by purified adult rat Leydig cells cultured under in vitro maintenance conditions. Endocrinology 1993, 132, 186–192. [Google Scholar] [CrossRef]
- Hutson, J.C. Physiologic interactions between macrophages and Leydig cells. Exp. Biol. Med. 2006, 231, 1–7. [Google Scholar] [CrossRef]
- Potter, S.J.; DeFalco, T. Role of the testis interstitial compartment in spermatogonial stem cell function. Reproduction 2017, 153, R151–R162. [Google Scholar] [CrossRef] [Green Version]
- DeFalco, T.; Potter, S.J.; Williams, A.V.; Waller, B.; Kan, M.J.; Capel, B. Macrophages Contribute to the Spermatogonial Niche in the Adult Testis. Cell. Rep. 2015, 12, 1107–1119. [Google Scholar] [CrossRef] [Green Version]
- Oatley, J.M.; Oatley, M.J.; Avarbock, M.R.; Tobias, J.W.; Brinster, R.L. Colony stimulating factor 1 is an extrinsic stimulator of mouse spermatogonial stem cell self-renewal. Development 2009, 136, 1191–1199. [Google Scholar] [CrossRef] [Green Version]
- Bergh, A.; Damber, J.E.; van Rooijen, N. Liposome-mediated macrophage depletion: An experimental approach to study the role of testicular macrophages in the rat. J. Endocrinol. 1993, 136, 407–413. [Google Scholar] [CrossRef]
- Hutson, J.C. Development of cytoplasmic digitations between Leydig cells and testicular macrophages of the rat. Cell Tissue Res. 1992, 267, 385–389. [Google Scholar] [CrossRef] [PubMed]
- Mossadegh-Keller, N.; Gentek, R.; Gimenez, G.; Bigot, S.; Mailfert, S.; Sieweke, M.H. Developmental origin and maintenance of distinct testicular macrophage populations. J. Exp. Med. 2017, 214, 2829–2841. [Google Scholar] [CrossRef] [PubMed]
- Gomez Perdiguero, E.; Schulz, C.; Geissmann, F. Development and homeostasis of “resident” myeloid cells: The case of the microglia. Glia 2013, 61, 112–120. [Google Scholar] [CrossRef]
- Cecchini, M.G.; Hofstetter, W.; Halasy, J.; Wetterwald, A.; Felix, R. Role of CSF-1 in bone and bone marrow development. Mol. Reprod. Dev. 1997, 46, 75–83. [Google Scholar] [CrossRef]
- Cecchini, M.G.; Dominguez, M.G.; Mocci, S.; Wetterwald, A.; Felix, R.; Fleisch, H.; Chisholm, O.; Hofstetter, W.; Pollard, J.W.; Stanley, E.R. Role of colony stimulating factor-1 in the establishment and regulation of tissue macrophages during postnatal development of the mouse. Development 1994, 120, 1357–1372. [Google Scholar] [CrossRef]
- Sasmono, R.T.; Williams, E. Generation and characterization of MacGreen mice, the Cfs1r-EGFP transgenic mice. Methods Mol. Biol. 2012, 844, 157–176. [Google Scholar] [CrossRef]
- Gow, D.J.; Sester, D.P.; Hume, D.A. CSF-1, IGF-1, and the control of postnatal growth and development. J. Leukoc. Biol. 2010, 88, 475–481. [Google Scholar] [CrossRef]
- Schuler, G. Steroid sulfates in domestic mammals and laboratory rodents. Domest. Anim. Endocrinol. 2021, 76, 106622. [Google Scholar] [CrossRef]
- Schuler, G.; Dezhkam, Y.; Tenbusch, L.; Klymiuk, M.C.; Zimmer, B.; Hoffmann, B. Sulfation pathways: Formation and hydrolysis of sulfonated estrogens in the porcine testis and epididymis. J. Mol. Endocrinol. 2018, 61, M13–M25. [Google Scholar] [CrossRef]
- Kucera, H.; Puschner, B.; Conley, A.; Berger, T. Tissue steroid levels in response to reduced testicular estrogen synthesis in the male pig, Sus scrofa. PLoS ONE 2019, 14, e0215390. [Google Scholar] [CrossRef]
- Mahendroo, M.S.; Cala, K.M.; Hess, D.L.; Russell, D.W. Unexpected virilization in male mice lacking steroid 5 alpha-reductase enzymes. Endocrinology 2001, 142, 4652–4662. [Google Scholar] [CrossRef] [PubMed]
- Titus, M.A.; Gregory, C.W.; Ford, O.H., 3rd; Schell, M.J.; Maygarden, S.J.; Mohler, J.L. Steroid 5alpha-reductase isozymes I and II in recurrent prostate cancer. Clin. Cancer Res. 2005, 11, 4365–4371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levine, A.C.; Wang, J.P.; Ren, M.; Eliashvili, E.; Russell, D.W.; Kirschenbaum, A. Immunohistochemical localization of steroid 5 alpha-reductase 2 in the human male fetal reproductive tract and adult prostate. J. Clin. Endocrinol. Metab. 1996, 81, 384–389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shan, L.X.; Rodriguez, M.C.; Janne, O.A. Regulation of androgen receptor protein and mRNA concentrations by androgens in rat ventral prostate and seminal vesicles and in human hepatoma cells. Mol. Endocrinol. 1990, 4, 1636–1646. [Google Scholar] [CrossRef] [Green Version]
- Quarmby, V.E.; Yarbrough, W.G.; Lubahn, D.B.; French, F.S.; Wilson, E.M. Autologous down-regulation of androgen receptor messenger ribonucleic acid. Mol. Endocrinol. 1990, 4, 22–28. [Google Scholar] [CrossRef] [Green Version]
Age (Treatment) | Testis | Prostate | Seminal Vesicles |
---|---|---|---|
2 weeks (control) | 4 | 4 | |
6.5 weeks (control) | 9 | 6 | 5 |
11 weeks (control) | 5 | 6 | 6 |
16 weeks (control) | 4 | 3 | 3 |
20 weeks (control) | 3 | 3 | 3 |
40 weeks (control) | 3 | 4 | 6 |
2 weeks (letrozole) | 4 | 4 | |
6.5 weeks (letrozole) | 9 | 4 | 4 |
11 weeks (letrozole) | 5 | 5 | 5 |
20 weeks (letrozole) | 3 | 3 | |
6.5 weeks (fulvestrant) | 6 | 4 | 4 |
6.5 weeks (flutamide) | 4 | 3 | |
11 weeks (flutamide) | 4 | 4 | 4 |
Gene | Gene ID | Forward Primer | Reverse Primer | Source | Size |
---|---|---|---|---|---|
SPAG749 | NM_001243921.1 | GAGCTGGATTCCTACCGTCG | CCTTCAGCCTCCGTTTCTCC | Millipore Sigma | 70 |
SRD5A1 | XM_003134156.6 | TCTGCACCTACAACGGCTAC | CCTGCTAGAAATCGGGGGTC | Integrated DNA Technologies | 94 |
SRD5A2 | NM_213988.1 | ATGGATCGGCTATGCCTTGG | AGGGCTTTTCGAGACTTGGG | Invitrogen | 147 |
AR | NM_214314.2 | TACCTGTGTGCCAGCAGAAAT | AGCTCCCAGTGTCATCCCT | Invitrogen | 108 |
CSF1 | NM_001244523.1 | GGTGTCGGAGAACTGTAGCC | ACACTGGATCCGTCAACTGC | Integrated DNA Technologies | 137 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Katleba, K.; Legacki, E.; Berger, T. Expression of CSF1, AR, and SRD5A2 during Postnatal Development of the Boar Reproductive Tract. Animals 2022, 12, 2167. https://doi.org/10.3390/ani12172167
Katleba K, Legacki E, Berger T. Expression of CSF1, AR, and SRD5A2 during Postnatal Development of the Boar Reproductive Tract. Animals. 2022; 12(17):2167. https://doi.org/10.3390/ani12172167
Chicago/Turabian StyleKatleba, Kimberley, Erin Legacki, and Trish Berger. 2022. "Expression of CSF1, AR, and SRD5A2 during Postnatal Development of the Boar Reproductive Tract" Animals 12, no. 17: 2167. https://doi.org/10.3390/ani12172167