Characterizing the Pathogenesis and Immune Response of Equine Herpesvirus 8 Infection in Lung of Mice
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Virus Culture
2.2. Animal Design and Ethics Statement
2.3. Clinical Evaluation and Sample Collection
2.4. Virus Replicates in Tissues
2.5. Histopathology and Immunohistochemistry Evaluation
2.6. Quantification of Cytokines mRNA
2.7. Statistical Analysis
3. Results
3.1. Clinical and Necropsy Findings
3.2. EHV-8 Replicates Efficiently in BALB/c Mice
3.3. Histopathological Evaluation and Immunohistochemical Detection of Viral Antigen
3.4. Cytokine Expression Patterns after EHV-8 Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Garvey, M.; Suarez, N.M.; Kerr, K.; Hector, R.; Moloney-Quinn, L.; Arkins, S.; Davison, A.J.; Cullinane, A. Equid herpesvirus 8: Complete genome sequence and association with abortion in mares. PLoS ONE 2018, 13, e0192301. [Google Scholar] [CrossRef] [PubMed]
- Azab, W.; Kato, K.; Abdel-Gawad, A.; Tohya, Y.; Akashi, H. Equine herpesvirus 4: Recent advances using BAC technology. Vet. Microbiol. 2011, 150, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Fukushi, H.; Yamaguchi, T.; Yamada, S. Complete genome sequence of equine herpesvirus type 9. J. Virol. 2012, 86, 13822. [Google Scholar] [CrossRef] [PubMed]
- Davison, A.J.; Eberle, R.; Ehlers, B.; Hayward, G.S.; McGeoch, D.J.; Minson, A.C.; Pellett, P.E.; Roizman, B.; Studdert, M.J.; Thiry, E. The order Herpesvirales. Arch. Virol. 2009, 154, 171–177. [Google Scholar] [CrossRef]
- Bloom, D.C. Alphaherpesvirus Latency: A Dynamic State of Transcription and Reactivation. Adv. Virus Res. 2016, 94, 53–80. [Google Scholar]
- Liu, C.; Guo, W.; Lu, G.; Xiang, W.; Wang, X. Complete genomic sequence of an equine herpesvirus type 8 Wh strain isolated from China. J. Virol. 2012, 86, 5407. [Google Scholar] [CrossRef]
- Strittmatter, G.E.; Sand, J.; Sauter, M.; Seyffert, M.; Steigerwald, R.; Fraefel, C.; Smola, S.; French, L.E.; Beer, H.D. IFN-gamma Primes Keratinocytes for HSV-1-Induced Inflammasome Activation. J. Investig. Dermatol. 2016, 136, 610–620. [Google Scholar] [CrossRef]
- Dunowska, M. A review of equid herpesvirus 1 for the veterinary practitioner. Part B: Pathogenesis and epidemiology. N. Z. Vet. J. 2014, 62, 179–188. [Google Scholar] [CrossRef]
- Browning, G.F.; Ficorilli, N.; Studdert, M.J. Asinine herpesvirus genomes: Comparison with those of the equine herpesviruses. Arch. Virol. 1988, 101, 183–190. [Google Scholar] [CrossRef]
- Schvartz, G.; Edery, N.; Moss, L.; Hadad, R.; Steinman, A.; Karniely, S. Equid Herpesvirus 8 Isolated from an Adult Donkey in Israel. J. Equine Vet. Sci. 2020, 94, 103247. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Hu, L.; Wang, Y.; Liu, W.; Liu, G.; Zhu, M.; Zhang, W.; Wang, C.; Ren, H.; Li, L. Identification of equine herpesvirus 8 in donkey abortion: A case report. Virol. J. 2022, 19, 10. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Hu, L.; Liu, M.; Wang, T.; Hu, X.; Li, Y.; Liu, W.; Li, Y.; Wang, Y.; Ren, H.; et al. The Emergence of Viral Encephalitis in Donkeys by Equid Herpesvirus 8 in China. Front. Microbiol. 2022, 13, 840754. [Google Scholar] [CrossRef] [PubMed]
- El-Habashi, N.; El-Nahass, E.S.; Abd-Ellatieff, H.; Saleh, A.; Abas, O.; Tsuchiya, Y.; Fukushi, H.; Yanai, T. Lesions and Distribution of Viral Antigen in the Brain of Hamsters Infected with Equine Herpesvirus (EHV)-9, EHV-1 Strain Ab4p, and Zebra-Borne EHV-1. Vet. Pathol. 2019, 56, 691–702. [Google Scholar] [CrossRef]
- Abas, O.; Abdo, W.; Kasem, S.; Alwazzan, A.; Saleh, A.G.; Saleh, I.G.; Fukushi, H.; Yanai, T.; Haridy, M. Time Course-Dependent Study on Equine Herpes Virus 9-Induced Abortion in Syrian Hamsters. Animals 2020, 10, 1369. [Google Scholar] [CrossRef] [PubMed]
- El-Habashi, N.; El-Nahass, E.; Haridy, M.; Nayel, M.; Abdelaziz, A.A.; Fukushi, H.; Kuroda, K.; Sakai, H.; Yanai, T. Pathological findings in equine herpesvirus 9-induced abortion in rats. J. Comp. Pathol. 2014, 151, 400–409. [Google Scholar] [CrossRef] [PubMed]
- Mesquita, L.P.; Costa, R.C.; Zanatto, D.A.; Bruhn, F.R.P.; Mesquita, L.L.R.; Lara, M.; Villalobos, E.M.C.; Massoco, C.O.; Mori, C.M.C.; Mori, E.; et al. Equine herpesvirus 1 elicits a strong proinflammatory response in the brain of mice. J. Gen. Virol. 2021, 102. [Google Scholar] [CrossRef] [PubMed]
- Saleh, A.G.; Anwar, S.I.; Abas, O.M.; Abd-Ellatieff, H.A.; Nasr, M.; Saleh, I.; Fukushi, H.; Yanai, T. Effect of a single point mutation on equine herpes virus 9 (EHV-9) neuropathogenicity after intranasal inoculation in a hamster model. J. Vet. Med. Sci. 2017, 79, 1426–1436. [Google Scholar] [CrossRef]
- Saleh, A.G.; El-Habashi, N.; Abd-Ellatieff, H.A.; Abas, O.M.; Anwar, S.; Fukushi, H.; Yanai, T. Comparative Study of the Pathogenesis of Rhinopneumonitis Induced by Intranasal Inoculation of Hamsters with Equine Herpesvirus-9, Equine Herpesvirus-1 strain Ab4p and Zebra-borne Equine Herpesvirus-1. J. Comp. Pathol. 2020, 180, 35–45. [Google Scholar] [CrossRef]
- Mesquita, L.P.; Costa, R.C.; Mesquita, L.L.R.; Lara, M.; Villalobos, E.M.C.; Mori, C.M.C.; Mori, E.; Howerth, E.W.; Maiorka, P.C. Pathogenesis of Equid Alphaherpesvirus 1 Infection in the Central Nervous System of Mice. Vet. Pathol. 2021, 58, 1075–1085. [Google Scholar] [CrossRef]
- Sun, Y.; Lu, Q.; Liu, B.; Sheng, Y.; Du, T.; Hiscox, J.A.; Zhou, E.M.; Zhao, Q. Cross-species infection of mice by rabbit hepatitis E virus. Vet. Microbiol. 2018, 225, 48–52. [Google Scholar] [CrossRef]
- Wen, L.; Gao, X.; Sheng, S.; Xiao, Q.; Wang, W.; He, K. Characterization of porcine circovirus-like virus P1 replication and lesions in BALB/c mice. Virology 2021, 556, 33–38. [Google Scholar] [CrossRef] [PubMed]
- Zanuzzi, C.N.; Bravi, M.E.; Scrochi, M.R.; Nishida, F.; Fuentealba, N.A.; Diessler, M.E.; Sguazza, H.G.; Muglia, C.I.; Gimeno, E.J.; Portiansky, E.L.; et al. Microvascular lesions and changes in cell proliferation and death, and cytokine expression in the placentas of mice experimentally infected with Equid Herpesvirus 1. Res. Vet. Sci. 2016, 109, 121–128. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.A.; Stanfield, B.A.; Chouljenko, V.N.; Naidu, S.; Langohr, I.; Del Piero, F.; Ferracone, J.; Roy, A.A.; Kousoulas, K.G. Intramuscular Immunization of Mice with the Live-Attenuated Herpes Simplex Virus 1 Vaccine Strain VC2 Expressing Equine Herpesvirus 1 (EHV-1) Glycoprotein D Generates Anti-EHV-1 Immune Responses in Mice. J. Virol. 2017, 91, e02445-16. [Google Scholar] [CrossRef]
- El-Nahass, E.; El-Dakhly, K.M.; El-Habashi, N.; Anwar, S.I.; Sakai, H.; Hirata, A.; Okada, A.; Abo-Sakaya, R.; Fukushi, H.; Yanai, T. Susceptibility of BALB/c-nu/nu mice and BALB/c mice to equine herpesvirus 9 infection. Vet. Pathol. 2014, 51, 581–590. [Google Scholar] [CrossRef]
- Gosztonyi, G.; Borchers, K.; Ludwig, H. Pathogenesis of equine herpesvirus-1 infection in the mouse model. APMIS 2009, 117, 10–21. [Google Scholar] [CrossRef]
- Kanitz, F.A.; Cargnelutti, J.F.; Anziliero, D.; Goncalves, K.V.; Masuda, E.K.; Weiblen, R.; Flores, E.F. Respiratory and neurological disease in rabbits experimentally infected with equid herpesvirus 1. Microb. Pathog. 2015, 87, 45–50. [Google Scholar] [CrossRef] [PubMed]
- Kirisawa, R.; Kobayashi, T.; Uematsu, R.; Ikeda, A.; Kuroiwa, R.; Urakami, A.; Iwai, H. Growth of recombinant equine herpesvirus 1 (EHV-1) replaced with passage-induced mutant gene 1 and gene 71 derived from an attenuated EHV-1 in cell cultures and in the lungs of mice. Vet. Microbiol. 2003, 95, 159–174. [Google Scholar] [CrossRef]
- van Reeth, K.; Nauwynck, H. Proinflammatory cytokines and viral respiratory disease in pigs. Vet. Res. 2000, 31, 187–213. [Google Scholar] [CrossRef] [PubMed]
- Jakovljevic, A.; Knezevic, A.; Nikolic, N.; Soldatovic, I.; Jovanovic, T.; Milasin, J.; Andric, M. Herpesviruses viral loads and levels of proinflammatory cytokines in apical periodontitis. Oral Dis. 2018, 24, 840–846. [Google Scholar] [CrossRef]
- Smith, P.M.; Zhang, Y.; Grafton, W.D.; Jennings, S.R.; O’Callaghan, D.J. Severe murine lung immunopathology elicited by the pathogenic equine herpesvirus 1 strain RacL11 correlates with early production of macrophage inflammatory proteins 1alpha, 1beta, and 2 and tumor necrosis factor alpha. J. Virol. 2000, 74, 10034–10040. [Google Scholar] [CrossRef]
- Coombs, D.K.; Patton, T.; Kohler, A.K.; Soboll, G.; Breathnach, C.; Townsend, H.G.; Lunn, D.P. Cytokine responses to EHV-1 infection in immune and non-immune ponies. Vet. Immunol. Immunopathol. 2006, 111, 109–116. [Google Scholar] [CrossRef] [PubMed]
Genes | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
---|---|---|
EHV-8-G1 | ACTCCAGTGCAGCGGATTCGTC | GTCCAATGAGAGCCAAGCAAAT |
EHV-8-G2 | TCAGACTGTCACTCGTGGGA | CCTGAAGGCCGTTTAACACA |
IFN-γ | GCTCTGAGACAATGAACGCTAC | TCTTCCACATCTATGCCACT |
TNF-α | ACGGCATGGATCTCAAAGAC | GTGGGTGAGGAGCACGTAGT |
IL-6 | GCTGCTTCCAAACCTTTGAC | AGCTTCTCCACAGCCACAAT |
IL-1β | CCGGAGAGGAGACTTCACAG | CAGAATTGCCATTGCACAAC |
GAPDH | CCCCTGGCCAAGGTCATCCATG | GGCCATGAGGTCCACCACCCTGT |
dpi | Lung | Brain | Spleen | Liver | Kidney |
---|---|---|---|---|---|
2 | 0/3 | 0/3 | 0/3 | 0/3 | 0/3 |
4 | 3/3 | 3/3 | 2/3 | 1/3 | 0/3 |
6 | 3/3 | 3/3 | 2/3 | 1/3 | 0/3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hu, L.; Wang, T.; Ren, H.; Liu, W.; Li, Y.; Wang, C.; Li, L. Characterizing the Pathogenesis and Immune Response of Equine Herpesvirus 8 Infection in Lung of Mice. Animals 2022, 12, 2495. https://doi.org/10.3390/ani12192495
Hu L, Wang T, Ren H, Liu W, Li Y, Wang C, Li L. Characterizing the Pathogenesis and Immune Response of Equine Herpesvirus 8 Infection in Lung of Mice. Animals. 2022; 12(19):2495. https://doi.org/10.3390/ani12192495
Chicago/Turabian StyleHu, Leyu, Tongtong Wang, Huiying Ren, Wenqiang Liu, Yubao Li, Changfa Wang, and Liangliang Li. 2022. "Characterizing the Pathogenesis and Immune Response of Equine Herpesvirus 8 Infection in Lung of Mice" Animals 12, no. 19: 2495. https://doi.org/10.3390/ani12192495