Effects of Stocking Density on Fatty Acid Metabolism by Skeletal Muscle in Mice
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experiment Animals and Treatment Protocols
2.2. Sample Collection
2.3. Genomic DNA Extraction and PCR Amplification
2.4. 16S rRNA Sequencing and Bioinformatics Analysis
2.5. RT-qPCR
2.6. Database
2.7. Statistical Analysis
3. Results
3.1. Effects of Stocking Density on Body Weight and Shape of Spf Mice
3.2. The Intestinal Contents of Kunming Mice with Different Feeding Densities Were Analyzed by 16S rRNA
3.3. Alpha Diversity Analysis
3.4. Multi-Stage Species Composition Analysis of Single Sample
3.5. Effects of Stocking Density on Fat Metabolism of SPF Kunming Mice
3.6. Effects of Stocking Density on Muscle Function of Spf Kunming Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pessa-Morikawa, T.; Husso, A.; Kärkkäinen, O.; Koistinen, V.; Hanhineva, K.; Iivanainen, A.; Niku, M. Maternal microbiota-derived metabolic profile in fetal murine intestine, brain and placenta. BMC Microbiol. 2022, 22, 46. [Google Scholar] [CrossRef] [PubMed]
- Masuoka, H.; Suda, W.; Tomitsuka, E.; Shindo, C.; Takayasu, L.; Horwood, P.; Greenhill, A.R.; Hattori, M.; Umezaki, M.; Hirayama, K. The influences of low protein diet on the intestinal microbiota of mice. Sci. Rep. 2020, 10, 17077. [Google Scholar] [CrossRef] [PubMed]
- Joisten, N.; Schenk, A.; Zimmer, P. Talking About Physical “Activity” or “Inactivity”? The Need of Accurate Activity Controlling in Exercise Studies in Rodents. Front. Physiol. 2020, 11, 611193. [Google Scholar] [CrossRef]
- Hurst, J.; Barnard, C.; Tolladay, U.; Nevision, C.; West, C. Housing and welfare in laboratory rats: Effects of cage stocking density and behavioural predictors of welfare. Anim. Behav. 1999, 58, 563–586. [Google Scholar] [CrossRef]
- Spangenberg, E.; Augustsson, H.; Dahlborn, K.; Essén-Gustavsson, B.; Cvek, K. Housing-related activity in rats: Effects on body weight, urinary corticosterone levels, muscle properties and performance. Lab. Anim. 2005, 39, 45–57. [Google Scholar] [CrossRef]
- Scariot, P.P.M.; de Barros Manchado-Gobatto, F.; Torsoni, A.; Torsoni, M.A.; Dos Reis, I.G.M.; Beck, W.R.; Gobatto, C.A. Wide housing space and chronic exercise enhance physical fitness and adipose tissue morphology in rats. Appl. Physiol. Nutr. Metab. 2015, 40, 489–492. [Google Scholar] [CrossRef]
- Scariot, P.P.; Gobatto, C.A.; Polisel, E.E.; Gomes, A.E.; Beck, W.R.; Manchado-Gobatto, F.B. Early-life mice housed in standard stocking density reduce the spontaneous physical activity and increase visceral fat deposition before reaching adulthood. Lab. Anim. 2022, 56, 344–355. [Google Scholar] [CrossRef]
- Santo, C.E.; Caseiro, C.; Martins, M.; Monteiro, R.; Brandão, I. Gut Microbiota, in the Halfway between Nutrition and Lung Function. Nutrients 2021, 13, 1716. [Google Scholar] [CrossRef]
- Chen, C.-Y.; Chen, P.-C.; Weng, F.C.-H.; Shaw, G.T.-W.; Wang, D. Habitat and indigenous gut microbes contribute to the plasticity of gut microbiome in oriental river prawn during rapid environmental change. PLoS ONE 2017, 12, e0181427. [Google Scholar] [CrossRef]
- Zhang, L.; Yu, Y.; Dong, L.; Gan, J.; Mao, T.; Liu, T.; Li, X.; He, L. Effects of moderate exercise on hepatic amino acid and fatty acid composition, liver transcriptome, and intestinal microbiota in channel catfish (Ictalurus punctatus). Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 40, 100921. [Google Scholar] [CrossRef]
- Yin, X.; Liu, W.; Chen, H.; Qi, C.; Chen, H.; Niu, H.; Yang, J.; Kwok, K.W.H.; Dong, W. Effects of ferulic acid on muscle development and intestinal microbiota of zebrafish. J. Anim. Physiol. Anim. Nutr. 2022, 106, 429–440. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Lyu, W.; Hong, Q.; Zhang, X.; Yang, H.; Xiao, Y. Gut Microbiota Influence Lipid Metabolism of Skeletal Muscle in Pigs. Front. Nutr. 2021, 8, 675445. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Kong, X.; Wu, G.; Ren, P.; Tang, H.; Hao, F.; Huang, R.; Li, T.; Tan, B.; Li, P.; et al. Metabolomic analysis of the response of growing pigs to dietary l-arginine supplementation. Amino Acids 2009, 37, 199–208. [Google Scholar] [CrossRef]
- Oyola, M.G.; Johnson, R.C.; Bauman, B.M.; Frey, K.G.; Russell, A.L.; Cho-Clark, M.; Buban, K.N.; Bishop-Lilly, K.A.; Merrell, D.S.; Handa, R.J.; et al. Gut microbiota and metabolic marker alteration following dietary isoflavone-photoperiod interaction. Endocrinol. Diabetes Metab. 2021, 4, e00190. [Google Scholar] [CrossRef]
- Lichtenstein, L.; Berbée, J.F.P.; van Dijk, S.J.; van Dijk, K.W.; Bensadoun, A.; Kema, I.P.; Voshol, P.J.; Müller, M.; Rensen, P.C.N.; Kersten, S. Angptl4 upregulates cholesterol synthesis in liver via inhibition of LPL- and HL-dependent hepatic cholesterol uptake. Arte Riosclerosis Thromb. Vasc. Biol. 2007, 27, 2420–2427. [Google Scholar] [CrossRef]
- Yu, J.; Fu, Y.; Deng, Z.; Fan, Y.; Li, H. Effects of soluble dietary fiber from soybean residue fermented by Neurospora crassa on the intestinal flora in rats. Food Funct. 2020, 11, 7433–7445. [Google Scholar] [CrossRef] [PubMed]
- Mio, K.; Yamanaka, C.; Matsuoka, T.; Kobayashi, T.; Aoe, S. Effects of β-glucan Rich Barley Flour on Glucose and Lipid Metabolism in the Ileum, Liver, and Adipose Tissues of High-Fat Diet Induced-Obesity Model Male Mice Analyzed by DNA Microarray. Nutrients 2020, 12, 3546. [Google Scholar] [CrossRef]
- Tang, R.; Li, L. Modulation of Short-Chain Fatty Acids as Potential Therapy Method for Type 2 Diabetes Mellitus. Can. J. Infect. Dis. Med. Microbiol. 2021, 2021, 6632266. [Google Scholar] [CrossRef]
- Liu, L.; Fu, C.; Li, F. Acetate Affects the Process of Lipid Metabolism in Rabbit Liver, Skeletal Muscle and Adipose Tissue. Animals 2019, 9, 799. [Google Scholar] [CrossRef]
- Zhou, H.; Yu, B.; Sun, J.; Liu, Z.; Chen, H.; Ge, L.; Chen, D. Short-chain fatty acids can improve lipid and glucose metabolism independently of the pig gut microbiota. J. Anim. Sci. Biotechnol. 2021, 12, 61. [Google Scholar] [CrossRef]
- Wang, L.; Kong, L.; Hu, X.; Bai, H.; Wang, Z.; Jiang, Y.; Bi, Y.; Chang, G.; Chen, G. Effect of stocking density on performance, meat quality and cecal bacterial communities of yellow feather broilers. Anim. Biotechnol. 2021, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Guardia, S.; Konsak, B.; Combes, S.; Levenez, F.; Cauquil, L.; Guillot, J.-F.; Moreau-Vauzelle, C.; Lessire, M.; Juin, H.; Gabriel, I. Effects of stocking density on the growth performance and digestive microbiota of broiler chickens. Poult. Sci. 2011, 90, 1878–1889. [Google Scholar] [CrossRef] [PubMed]
- Ivarsson, E.; Roos, S.; Liu, H.; Lindberg, J.E. Fermentable non-starch polysaccharides increases the abundance of Bacteroides–Prevotella–Porphyromonas in ileal microbial community of growing pigs. Animal 2014, 8, 1777–1787. [Google Scholar] [CrossRef]
- Mun, S.; Lee, J.; Chung, K.-S.; Son, M.-Y.; Son, M. Effect of Microbial Short-Chain Fatty Acids on CYP3A4-Mediated Metabolic Activation of Human Pluripotent Stem Cell-Derived Liver Organoids. Cells 2021, 10, 126. [Google Scholar] [CrossRef] [PubMed]
- Bloemen, J.G.; Damink, S.W.O.; Venema, K.; Buurman, W.A.; Jalan, R.; Dejong, C.H. Short chain fatty acids exchange: Is the cirrhotic, dysfunctional liver still able to clear them? Clin. Nutr. 2010, 29, 365–369. [Google Scholar] [CrossRef]
- Low, K.E.; Xing, X.; Moote, P.E.; Inglis, G.D.; Venketachalam, S.; Hahn, M.G.; King, M.L.; Tétard-Jones, C.Y.; Jones, D.R.; Willats, W.G.T.; et al. Combinatorial Glycomic Analyses to Direct CAZyme Discovery for the Tailored Degradation of Canola Meal Non-Starch Dietary Polysaccharides. Microorganisms 2020, 8, 1888. [Google Scholar] [CrossRef]
- Li, R.; Li, X.; Huang, T.; Wang, Y.; Xue, M.; Sun, S.; Yan, D.; Song, G.; Sun, G.; Li, M. Influence of cecotrophy on fat metabolism mediated by caecal microorganisms in New Zealand white rabbits. J. Anim. Physiol. Anim. Nutr. 2020, 104, 749–757. [Google Scholar] [CrossRef]
- Chen, P.; Torralba, M.; Tan, J.; Embree, M.; Zengler, K.; Stärkel, P.; van Pijkeren, J.-P.; DePew, J.; Loomba, R.; Ho, S.B.; et al. Supplementation of Saturated Long-Chain Fatty Acids Maintains Intestinal Eubiosis and Reduces Ethanol-induced Liver Injury in Mice. Gastroenterology 2015, 148, 203–214.e16. [Google Scholar] [CrossRef]
- Hassan, M.A.; Taha, T.H.; Hamad, G.M.; Hashem, M.; Alamri, S.; Mostafa, Y.S. Biochemical characterisation and application of keratinase from Bacillus thuringiensis MT1 to enable valorisation of hair wastes through biosynthesis of vitamin B-complex. Int. J. Biol. Macromol. 2020, 153, 561–572. [Google Scholar] [CrossRef]
- Liu, J.-P.; Zou, W.-L.; Chen, S.-J.; Wei, H.-Y.; Yin, Y.-N.; Zou, Y.-Y.; Lu, F.-G. Effects of different diets on intestinal microbiota and nonalcoholic fatty liver disease development. World J. Gastroenterol. 2016, 22, 7353–7364. [Google Scholar] [CrossRef]
- Moinard, A.; Payen, C.; Ouguerram, K.; André, A.; Hernandez, J.; Drut, A.; Biourge, V.C.; Suchodolski, J.S.; Flanagan, J.; Nguyen, P.; et al. Effects of High-Fat Diet at Two Energetic Levels on Fecal Microbiota, Colonic Barrier, and Metabolic Parameters in Dogs. Front. Veter. Sci. 2020, 7, 566282. [Google Scholar] [CrossRef] [PubMed]
- Basson, A.R.; Gomez-Nguyen, A.; LaSalla, A.; Buttó, L.; Kulpins, D.; Warner, A.; Di Martino, L.; Ponzani, G.; Osme, A.; Rodriguez-Palacios, A.; et al. Replacing Animal Protein with Soy-Pea Protein in an “American Diet” Controls Murine Crohn Disease–Like Ileitis Regardless of Firmicutes: Bacteroidetes Ratio. J. Nutr. 2021, 151, 579–590. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, Y.; Li, J.; Xing, T.; Jiang, Y.; Zhang, L.; Gao, F. Dietary corn-resistant starch suppresses broiler abdominal fat deposition associated with the reduced cecal Firmicutes. Poult. Sci. 2020, 99, 5827–5837. [Google Scholar] [CrossRef] [PubMed]
- Drogan, D.; Boeing, H.; Janke, J.; Schmitt, B.D.; Zhou, Y.; Walter, J.H.; Pischon, T.; Tierling, S. Regional distribution of body fat in relation to DNA methylation within the LPL, ADIPOQ and PPARγ promoters in subcutaneous adipose tissue. Nutr. Diabetes 2015, 5, e168. [Google Scholar] [CrossRef]
- Whitacre, B.E.; Howles, P.; Street, S.; Morris, J.; Swertfeger, D.; Davidson, W.S. Apolipoprotein E content of VLDL limits LPL-mediated triglyceride hydrolysis. J. Lipid Res. 2022, 63, 100157. [Google Scholar] [CrossRef]
- Munshi, A.; Babu, M.S.; Kaul, S.; Rajeshwar, K.; Balakrishna, N.; Jyothy, A. Association of LPL gene variant and LDL, HDL, VLDL cholesterol and triglyceride levels with ischemic stroke and its subtypes. J. Neurol. Sci. 2012, 318, 51–54. [Google Scholar] [CrossRef]
- Yan, Y.; Zhou, Y.; Li, J.; Zheng, Z.; Hu, Y.; Li, L.; Wu, W. Sulforaphane downregulated fatty acid synthase and inhibited microtubule-mediated mitophagy leading to apoptosis. Cell Death Dis. 2021, 12, 917. [Google Scholar] [CrossRef]
- Bruning, U.; Morales-Rodriguez, F.; Kalucka, J.; Goveia, J.; Taverna, F.; Queiroz, K.C.; Dubois, C.; Cantelmo, A.R.; Chen, R.; Loroch, S.; et al. Impairment of Angiogenesis by Fatty Acid Synthase Inhibition Involves mTOR Malonylation. Cell Metab. 2018, 28, 866–880.e15. [Google Scholar] [CrossRef]
- Liang, T.; Jinglong, X.; Shusheng, D.; Aiyou, W. Maternal obesity stimulates lipotoxicity and up-regulates inflammatory signaling pathways in the full-term swine placenta. Anim. Sci. J. 2018, 89, 1310–1322. [Google Scholar] [CrossRef]
- Toth, M.J.; Callahan, D.M.; Miller, M.S.; Tourville, T.W.; Hackett, S.B.; Couch, M.E.; Dittus, K. Skeletal muscle fiber size and fiber type distribution in human cancer: Effects of weight loss and relationship to physical function. Clin. Nutr. 2016, 35, 1359–1365. [Google Scholar] [CrossRef]
- Huo, W.; Weng, K.; Gu, T.; Zhang, Y.; Zhang, Y.; Chen, G.; Xu, Q. Effect of muscle fiber characteristics on meat quality in fast- and slow-growing ducks. Poult. Sci. 2021, 100, 101264. [Google Scholar] [CrossRef]
- Ahn, J.S.; Kim, D.-H.; Park, H.-B.; Han, S.-H.; Hwang, S.; Cho, I.-C.; Lee, J.-W. Ectopic Overexpression of Porcine Myh1 Increased in Slow Muscle Fibers and Enhanced Endurance Exercise in Transgenic Mice. Int. J. Mol. Sci. 2018, 19, 2959. [Google Scholar] [CrossRef] [PubMed]
- Bizjak, D.A.; Zügel, M.; Schumann, U.; Tully, M.A.; Dallmeier, D.; Denkinger, M.; Steinacker, J.M. Do skeletal muscle composition and gene expression as well as acute exercise-induced serum adaptations in older adults depend on fitness status? BMC Geriatr. 2021, 21, 697. [Google Scholar] [CrossRef] [PubMed]
- Sellers, R.S.; Mahmood, S.R.; Perumal, G.S.; Macaluso, F.P.; Kurland, I.J. Phenotypic Modulation of Skeletal Muscle Fibers in LPIN1-Deficient Lipodystrophic (fld) Mice. Veter. Pathol. 2019, 56, 322–331. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.-D.; Tang, C.-L.; Huang, S.-Q.; Luo, A.; Zhang, A.-N.; Wu, M.-J.; An, H.-Y.; Tan, C.-F.; Qiu, L. Effect of electroacupuncture on amyotrophia and expression of myogenic differentiation-related genes of gastrocnemius in rats with chronic constriction injury of sciatic nerve. Zhen Ci Yan Jiu Acupunct. Res. 2019, 44, 37–42. [Google Scholar]
- Cho, I.-C.; Park, H.-B.; Ahn, J.S.; Han, S.-H.; Lee, J.-B.; Lim, H.-T.; Yoo, C.-K.; Jung, E.-J.; Kim, D.-H.; Sun, W.-S.; et al. A functional regulatory variant of MYH3 influences muscle fiber-type composition and intramuscular fat content in pigs. PLoS Genet. 2019, 15, e1008279. [Google Scholar] [CrossRef]
Primer Name | Sequence (5’-3’) |
---|---|
LPL | TGGCGTAGCAGGAAGTCTGA TGCCTCCATTGGGATAAATGTC |
FASN | GGCTCTATGGATTACCCAAGC CCAGTGTTCGTTCCTCGGA |
ACACA | CGCCAACAATGGTATTGCAGC TCGGATTGCACGTTCATTTCG |
PNPLA2 | GGGTGCGCTATGTGGATGG CTCTCGCCTGAGAATGGGG |
MYH1 | CGGAGTCAGGTGAATACTCACG GAGCATGAGCTAAGGCACTCT |
MYH2 | TAAACGCAAGTGCCATTCCTG GGGTCCGGGTAATAAGCTGG |
MYH4 | AGGACCAACTGAGTGAAGTGA GGGAAAACTCGCCTGACTCTG |
MYH7 | AGACTGTCAACACTAAGAGGGT TGCCCCAAAATGGATTCGGAT |
GAPDH | TGGCCTTCCGTGTTCCTAC GAGTTGCTGTTGAAGTCGCA |
Sample Name | Raw Reads | Clean Reads | Effective Reads | Effective (%) |
---|---|---|---|---|
LSD | 172,621 | 171,854 | 120,409 | 70.06 |
MSD | 182,646 | 180,548 | 126,361 | 69.99 |
HSD | 226,753 | 224,399 | 169,981 | 75.75 |
Phylum | LSD (%) | MSD (%) | HSD (%) |
---|---|---|---|
Firmicutes | 50.28 | 63.51 | 52.53 |
Bacteroidetes | 40.93 | 21.78 | 25.14 |
Proteobacteria | 3.15 | 5.35 | 4.24 |
Cyanobacteria_Chloroplas | 1.75 | 0.32 | 3.46 |
Actinobacteria | 1.46 | 4.01 | 1.46 |
unclassified_Bacteria | 1.41 | 0.57 | 3.35 |
Candidatus_Saccharibacteria | 0.84 | 0.66 | 0.76 |
Verrucomicrobia | 0.16 | 3.74 | 9.04 |
Tenericutes | 0.01246 | 0.00791 | 0.02118 |
Planctomycetes | 0.00415 | 0.00712 | 0.00118 |
Ignavibacteriae | 0.00166 | 0.00079 | 0.00118 |
Chloroflexi | 0.00083 | 0.00079 | 0.00000 |
Deferribacteres | 0.00083 | 0.03324 | 0.00235 |
Acidobacteria | 0.00000 | 0.00000 | 0.00118 |
LSD | MSD | HSD | |||
---|---|---|---|---|---|
Genu | Percent (%) | Genu | Percent (%) | Genu | Percent (%) |
Lactobacillus | 31.05 | Lactobacillus | 40.91 | Lactobacillus | 41.16 |
unclassified_Porphyromonadaceae | 21.73 | unclassified_Porphyromonadaceae | 14.99 | unclassified_Porphyromonadaceae | 20.96 |
Alloprevotella | 6.58 | unclassified_Lachnospiraceae | 6.78 | Akkermansia | 9.04 |
unclassified_Lachnospiraceae | 6.13 | unclassified_Erysipelotrichaceae | 4.46 | Streptophyta | 3.44 |
Barnesiella | 5.99 | Akkermansia | 3.74 | unclassified_Bacteria | 3.35 |
Bacteroides | 4.21 | Bifidobacterium | 3.58 | unclassified_Lachnospiraceae | 3.20 |
Streptococcus | 3.37 | Turicibacter | 3.41 | Turicibacter | 2.36 |
unclassified_Erysipelotrichaceae | 3.19 | Barnesiella | 2.02 | Barnesiella | 1.68 |
Streptophyta | 1.73 | Alloprevotella | 1.90 | Acinetobacter | 1.35 |
Turicibacter | 1.55 | unclassified_Desulfovibrionaceae | 1.70 | unclassified_Erysipelotrichaceae | 0.97 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Li, X.; Cui, J.; Xu, C.; Wei, H.; Zhao, Q.; Yao, H.; You, H.; Zhang, D.; Yu, H. Effects of Stocking Density on Fatty Acid Metabolism by Skeletal Muscle in Mice. Animals 2022, 12, 2538. https://doi.org/10.3390/ani12192538
Chen Q, Li X, Cui J, Xu C, Wei H, Zhao Q, Yao H, You H, Zhang D, Yu H. Effects of Stocking Density on Fatty Acid Metabolism by Skeletal Muscle in Mice. Animals. 2022; 12(19):2538. https://doi.org/10.3390/ani12192538
Chicago/Turabian StyleChen, Qiuyan, Xiaohui Li, Jiarun Cui, Caiyun Xu, Hongfei Wei, Qian Zhao, Hongli Yao, Hailong You, Dawei Zhang, and Huimei Yu. 2022. "Effects of Stocking Density on Fatty Acid Metabolism by Skeletal Muscle in Mice" Animals 12, no. 19: 2538. https://doi.org/10.3390/ani12192538
APA StyleChen, Q., Li, X., Cui, J., Xu, C., Wei, H., Zhao, Q., Yao, H., You, H., Zhang, D., & Yu, H. (2022). Effects of Stocking Density on Fatty Acid Metabolism by Skeletal Muscle in Mice. Animals, 12(19), 2538. https://doi.org/10.3390/ani12192538