Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination
by
, , and
Hieu Van Dong
1,2
,
Giang Thi Huong Tran
2
,
Huong Thi Thu Nguyen
2,
Tuong Manh Nguyen
2,
Dai Quang Trinh
3,
Van Phan Le
2,
Kiattawee Choowongkomon
1,4 and
Jatuporn Rattanasrisomporn
1,5,*
1
Center for Advanced Studies for Agriculture and Food, Kasetsart University Institute for Advanced Studies, Kasetsart University, Bangkok 10900, Thailand
2
Faculty of Veterinary Medicine, Vietnam National University of Agriculture, Trau Quy Town, Gia Lam District, Hanoi 131000, Vietnam
3
Central Veterinary Medicine JSC No. 5, Ha Binh Phuong Industrial Zone, Hanoi 100000, Vietnam
4
Department of Biochemistry, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand
5
Department of Companion Animal Clinical Science, Faculty of Veterinary Medicine, Kasetsart University, Bangkok 10900, Thailand
*
Author to whom correspondence should be addressed.
Animals 2022, 12(20), 2846; https://doi.org/10.3390/ani12202846
Submission received: 7 September 2022
/
Revised: 2 October 2022
/
Accepted: 17 October 2022
/
Published: 19 October 2022
(This article belongs to the Section Poultry)
Abstract
:Simple Summary
Waterfowl parvoviruses are highly contagious lethal pathogens that cause economic loss in the duck production industry. In Vietnam, information is limited on epidemiological and genetic characterization of the viral genome. This study investigated epidemiological characteristics and the further genetic characterization of the viral genome in ducks farmed in northern Vietnam. The results revealed that waterfowl parvovirus was circulating among ducks at a moderately positive rate. The viral strains were clustered with another novel goose parvovirus from China.
Abstract
In total, 130 tissue-pooled samples collected from ducks in some provinces/cities in north Vietnam were examined for waterfowl parvovirus genome identification. Twenty-six (20%) samples were positive for the parvovirus infection, based on polymerase chain reaction analysis. Of the 38 farms tested, 14 (36.84%) were positive for the waterfowl parvovirus genome. The rate of the parvovirus genome detection in ducks aged 2–4 weeks (37.04%) was significantly (p < 0.05) higher than that at ages <2 weeks (9.09%) and >4 weeks (16.30%). The positive rate on medium-scale farms (9.36%) was significantly (p < 0.05) lower than for small-scale (31.03%) and large-scale (29.73%) farms. The lengths of the four Vietnamese waterfowl parvovirus genomes identified were 4750 nucleotides. Among the four Vietnamese parvovirus genomes, nucleotide identities were from 99.29% to 99.87%. Phylogenetic analysis of the near-complete genomes indicated that the waterfowl circulating in northern Vietnam belonged to the novel goose parvovirus (NGPV) group. The Vietnamese NGPV group was closely related to the Chinese group. Recombination analysis suggested that the Vietnam/VNUA-26/2021 strain was generated by a recombination event. One positive selection site of the capsid protein was detected.
1. Introduction
Waterfowl parvoviruses are highly contagious, lethal pathogens for goslings and ducklings. Waterfowl parvoviruses belong to the species Anseriform dependoparvovirus 1 of the genus Dependoparvovirus within the Parvoviridae family. The genus Dependoparvovirus can be divided into two divergent groups, consisting of Muscovy duck parvovirus (MDPV)-related groups and goose parvovirus (GPV)-related groups [1]. GPV, the agent of Derzy’s disease, causes the disease in young geese and Muscovy ducks with mortality rates up to 90% [2], while MDPV causes high mortality, watery diarrhea, wheezing, locomotor dysfunction, and stunning in Muscovy ducks [3]. Both GPV and MDPV can show 70–100% morbidity and mortality during the first 3–4 weeks of age.
Waterfowl parvovirus is characterized as a non-enveloped virus. The viral genome consists of a single-strand DNA with around 5100 bp. The translated regions contain two open reading frames (ORFs). The left ORF encodes for the non-structural protein, while the remaining ORF encodes for capsid proteins VP1, VP2, and VP3 [4,5]. Both GPV and MDPV are antigenically related to each other as they share about 85% protein sequence homology [6]. In detail, they show nucleotide differences in VP1 of about 20–24%, whereas these differences in VP1 within the GPV and MDPV groups are only 0.1–7% and 0.1–1.9%, respectively [6,7,8,9].
It was reported that recombination events occurred among parvoviruses. As a result, a novel strain may be generated from the recombination event between vaccine and wild-type strains [10]. In 2015, Chen et al. found a novel goose parvovirus (NGPV) causing a severe disease in duck flocks in China [11]. Later, other studies noted that NGPV strains induced short beak and dwarfism syndrome (SBDS) in China, Egypt, and Poland [12,13,14]. NGPV viruses were considered to derive from classical GPV strains. Furthermore, a novel recombinant MDPV (rMDPV) was reported in ducks from several provinces in mainland China, where it caused high mortality and embolism in the intestinal tracts of infected ducklings aged less than 3 weeks [15,16,17].
In Vietnam in 2019, waterfowl parvoviruses have been reported in sick ducks with short beak and dwarfism syndrome. The detected waterfowl parvovirus was genetically grouped with the NGPV group based on the partial NS and VP1 genes [18]. However, information on waterfowl parvoviruses has been limited up to now. Therefore, we investigated infections of waterfowl parvoviruses in ducks farmed in some provinces of northern Vietnam. The current study also carried out molecular characterization of the near-complete waterfowl parvovirus genome.
2. Materials and Methods
2.1. Ethics Statement
This research did not contain any studies involving human participants. Collection of duck tissue samples was conducted by the Vietnam National University of Agriculture after receiving institutional approval and permission from the owners of the ducks.
2.2. Samples
Tissue samples (brain, lung, liver, kidney, and Fabricius) from 130 broiler ducks aged 2–7 weeks were obtained from Thainguyen, Bacgiang, Haiduong, Thaibinh, Hungyen, and Hanoi in 2021 (Figure 1) and used in this study. From each flock, two to six diseased ducks were collected by the local veterinarian and transferred to the Vietnam National University of Agriculture for further analysis. The parvovirus vaccine was not used in tested duck farms. From each duck, collection of pooled tissue samples was performed. A 10% homogenate was prepared in phosphate-buffered saline.
2.3. DNA Extraction and Polymerase Chain Reaction (PCR)
DNA was extracted from the homogenized samples using Viral Gene-spin™ Viral DNA/RNA Extraction Kits (iNtRON Biotechnology, Seoul, Korea) according to the manufacturer’s instruction. Primers, PV-F, and PV-R were used to amplify the target 537 bp of the partial replication (Rep) geneor the parvovirus genome identification (Table 1), as previously described [4]. The thermal conditions were: 95 °C for 5 min, 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and extended at 72 °C for 10 min. A 1.5% agarose gel was used to run the PCR product. The product was observed by UV light.
2.4. Nucleotide Sequencing and Phylogenetic Analyses
Five pairs of primers, GPV-P1-F/R, GPV-P2-F/R, GPV-P3-F/R, GPV-P4-F/R, and GPV-P5-F/R (Table 1), were used to amplify the near-whole genome sequence of the waterfowl parvovirus strains, as described previously [14]. Electrophoresis was performed with 1.5% agarose gel to separate the PCR products. Regarding the purification of PCR products, GeneClean® II Kits (MP Biomedicals, Santa Ana, CA, USA) were used. Sequencing of the waterfowl parvovirus strains was demonstrated by 1st BASE, Malaysia.
The Clustal W multiple alignment tool [19] in BioEdit v.7.2.5 [20] was used to align and analyze the nucleotide sequences and deduced aa sequences derived from GPV. Homology in nucleotide and aa sequences was examined using the GENETYX v.10 software (GENETYX Corp., Tokyo, Japan) and compared with other publicly available sequences using the BLAST program. A maximum likelihood method with the Hasegawa–Kishino–Yano model of nucleotide substitutions was used to construct the phylogenetic tree based on nucleotide sequences of 4 currently identified Vietnamese and 40 foreign waterfowl parvovirus strains (Table 2). The confidence values on phylogenetic trees were assessed based on bootstrapping with 1000 replicates using the MEGA6 6.06 version [21]. The near-whole genomes of the current waterfowl parvovirus strains were submitted to GenBank with accession numbers OP265005–OP265008.
2.5. Analyses of Recombination and Natural Selection Profiles
The current and other waterfowl parvovirus sequences available in GenBank were determined to be recombination events using the Recombination Detection Program (RDP) version Beta 4.97 [22] (including RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan, Phyl-Pro, LARD, and 3Seq methods) with default settings. An algorithm producing a result that had p value lower 0.05 was regarded as dependable. The identification of sites under positive or negative selection was evaluated by following a FUBAR (a Fast Unconstrained Bayesian AppRoximation) method (accessed on 1 July 2022) [23].
2.6. Statistical Analysis
Fisher’s exact test was used to identify significant differences in the rate of waterfowl parvovirus genome detection between geographical regions, age, or flock-size groups. A value of p < 0.05 was considered statistically significant.
3. Results
3.1. Detection of Waterfowl Parvovirus Genome in Field Samples
Of the 130 samples tested, 26 (20%) were positive for the waterfowl parvovirus genome based on the PCR method. Among the provinces/cities, Haiduong had the highest rate (33.33%), followed by (p > 0.05) Thainguyen (26.67%), Hanoi (22.92%), and Hungyen (20%), that were all significantly higher (p < 0.05) than that of Thaibinh (14.29%) and Bacgiang (13.33%) (Table 3). Of the 38 farms tested, 14 were positive for the waterfowl parvovirus genome (Table 3).
The rate of parvovirus-positive ducks at age 2–4 weeks was 37.04% (10/27), which was highly significantly greater those aged <2 weeks (9.09%; p < 0.01) and >4 weeks (16.30%; p = 0.01) (Table 4). The flock levels were categorized as level 1 (number of ducks lower than 500, small scale), level 2 (number of ducks ranging 500–1000, medium scale), or level 3 (number of ducks more than 1000, large scale). The rates of parvovirus detection for the level 1 and level 3 flocks were 31.03% and 29.73%, respectively, which were significant (p < 0.05) higher than for level 2 flocks (9.38%), as shown in Table 4.
3.2. Characterization of Waterfowl Parvovirus Genome and Protein
The near-complete genome of the four Vietnamese waterfowl parvoviruses obtained in this study was 4750 nucleotides in length. The viral genomes of the four Vietnamese waterfowl parvovirus types consisted of two ORFs. Neither deletion nor insertion mutations were detected in the translated region of the current parvovirus.
Regarding genetic analysis, four parvovirus-detected samples obtained at different locations were randomly determined for viral genome sequencing. The alignment and comparison of the near-whole genome (4750 bp) of the four current strains and other reported sequences from GenBank were performed. The nucleotide identity ranged from 99.29% to 99.87% among the four Vietnamese waterfowl parvovirus strains obtained in this study. Among these, the highest nucleotide identity was between Vietnam/VNUA-07/2021 and Vietnam/VNUA-26/2021 (99.87%) while the lowest was between Vietnam/VNUA-30/2021 and Vietnam/VNUA-94/2021 (99.29%). Comparing the viral genomes from the four Vietnamese parvovirus strains in this study and those sequences abroad, four Vietnamese strains shared nucleotide identity of 99.17% (Vietnam/VNUA-94/2021 versus China/HuN001), 99.04% (Vietnam/VNUA-07/2021 versus China/HuN001, Vietnam/VNUA-26/2021 versus China/HuN001), and 98.82% (Vietnam/VNUA-30/2021 versus China/HuN001).
Phylogenetic analysis based on the near-complete genome (4880 bp), full-length Cap (2199 bp), and full-length Rep (1884 bp) gene sequences indicated that the current Vietnamese parvovirus strains belonged to the NGPV group. The four Vietnamese parvovirus strains obtained differed from vaccine strains Taiwan/VG32/1/2008 (EU583392.1), Taiwan/82-0321V/1982 (EU583389.1), and China/FZ91-30/1991 (KT865605.1). The present Vietnamese parvovirus strains were clustered with those of viral strains from China (Figure 2, Figure 3 and Figure 4).
Deduced aa sequences of the Rep and Cap proteins of the Vietnamese NGPV strains were compared with other waterfowl strains in various lineages. Four and fourteen major variable amino acid substitutions were detected on Rep and Cap proteins, respectively, of the Vietnamese NGPV strains in the current study, compared to other GPV and MDPV viruses (Table 5 and Table 6).
3.3. Recombination Analysis
Recombination analyses of the full-length Cap gene sequences suggested that Vietnam/VNUA-26/2021 resulted from a recombination event. The major and minor parents were the Duck/China/GXN45/2017 NGPV and Goose/China/YZ/2013 GPV viruses. This putative recombination event was detected by seven out of the nine methods using RDP 4 (Table 7). The two breakpoints were detected and located at residues 112 and 620 of the Cap gene sequence (Figure 5). No recombination events were detected in the Vietnamese NGPV Rep gene and the untranslated regions of the waterfowl parvovirus genome (data not shown).
3.4. Evolutionary Analysis of Viral Genome
Analyses of the natural selection profiles of the Vietnamese NGPV sequences indicated that eight residue sites (137, 147, 157, 159, 161, 168, 472, and 686) of the Cap protein and one residue (508) site of the Rep protein were from negative selection. However, only one positive selection was found at the residue 507 site of the Cap protein (Table 8).
4. Discussion
Understanding waterfowl parvovirus infections is important as they are associated with SBDS in ducks with a high or low mortality [12,13,14]. Recently, waterfowl parvoviruses were characterized based on partial sequences of the VP1 and NS1 gene sequences and divided into the NGPV group in Hungyen province [18]. The Vietnamese waterfowl parvovirus genome sequences are still limited in GenBank; additional sequence data of the complete genome are necessary to further characterize and understand the evolution of viral strains. This was the first study to conduct epidemiological analysis and to further characterize the whole-genome sequences (4880 bp) of Vietnamese waterfowl parvovirus strains.
In the current study, the waterfowl parvovirus genome was detected in 20% of duck samples, which was lower than that of ducklings from outbreak farms with SBDS in tissue samples (33/33 (100%)) or with no clinical signs (7/12 (58.33%)) [24]. The differences in the sampling numbers, location, time, and sensitivity of the detection methods were considered a reasonable cause for the variation in the result. Furthermore, 36.84% of the duck farms were positive for the viral genome in northern provinces in Vietnam. The current results suggested that waterfowl parvovirus may circulate and affect duck production in Vietnam. In the current study, we first found a moderate waterfowl parvovirus genome frequency of detection in Vietnamese ducks at age 2–4 weeks (37.04%), with the frequency of detection of viral genome higher than that in younger ducks aged <2 weeks (9.09%) and older ducks aged >4 weeks (16.30%). These findings suggested that during age 2–4 weeks the ducklings may be susceptible to viral infection.
Genetic and phylogenetic analyses indicated that the Vietnamese and Chinese strains were clustered in a single genogroup belonging to NGPV (Figure 2, Figure 3 and Figure 4). The results suggested that these viruses may have a similar origin, or that these viruses were widespread in Asia. In addition, the classification of the Vietnamese NGPV sequences was similar based on the complete genome, Rep gene, and Cap gene sequences, suggesting that using each gene sequence could characterize the viral strains. Amino acid substitutions on Rep and Cap proteins play critical roles in the change of host range and pathogenicity. In terms of Rep protein, a previous study reported that substitution at residue 140 (A to S), which was not be found in the current four Vietnamese strains, was associated with viral transcription [25]. Yu et al. noted that five substitutions at residues 494, 553, 555, 573, and 594 on Rep protein play roles in the antigenic epitopes of B cells [26]. Only one substitution at residue 555 N/D to P/T was detected in the present study. The roles of the remaining three substitutions on Rep protein of the Vietnamese strains were still unclear. In this study, 14 substitutions on Cap protein did not match with residues 35 and 660, which may be related to the host range identification of NGPV [27].
SBDS was recognized in the NGPV group in China in 2015 [11]. Since then, this pathogen has been critical in causing disease in ducks, mainly in China but also in other countries. In the current study, the four NGPVs were detected based on their complete genome sequences. The four Vietnamese NGPVs obtained were closely related to NGPV in China in 2019 (HuN18). The HuN18 NGPV virus has been isolated from ducks with BADS in China [28]. Therefore, it could be speculated that the current Vietnamese NGPV strains may be high-virulence strains.
Recombination has been reported in the evolutionary processes of waterfowl parvoviruses and described [17,28,29,30] based on the complete genome sequences. A recombination event may generate a novel waterfowl parvovirus strain [10]. The current study revealed the first evidence supporting a recombination event in the Vietnamese NGPV strain in the protein-coding region of the Capsid gene. In general, recombination usually occurs between viruses that are located closely to each other. However, the major and minor parents were from China. The explanation for this situation is that Vietnam and China share thousands of kilometers along their border. The recombination event could have occurred elsewhere in China and then could have been transferred to Vietnam through daily trading of live birds along the border between Vietnam and China [31]. Recombination may occur between the Vietnamese waterfowl parvovirus strains, which might be detected if there are sufficient data. Analysis of the additional viral genomes should be further studied.
Another evolutionary process is natural selection. Fan et al. [32] reported nine sites on VP protein that were estimated as positively selected sites, that may have been associated with host range [32]. In the current study, only one positive selection on a VP protein was found (residue 507), which has not been characterized. Further studies should be conducted to clarify this point.
5. Conclusions
A high positive rate of waterfowl parvovirus was detected among young ducks, aged 3–4 weeks, in flocks in northern Vietnam. The current study revealed that the four Vietnamese waterfowl parvovirus strains belonged to the NGPV group, based on phylogenetic and molecular analyses of the whole genome. The characterization of NGPV strains circulating in Vietnam was first reported based on viral whole-genome sequences. This study also detected a recombination event in the Vietnamese NGPV strain. Only one aa sequence on a Cap protein was identified under positive selection.
Author Contributions
Conceptualization, H.V.D., V.P.L. and J.R.; methodology, H.V.D., G.T.H.T., H.T.T.N., D.Q.T. and V.P.L.; software, H.V.D. and G.T.H.T.; formal analysis, H.V.D., T.M.N. and V.P.L.; investigation, H.V.D., H.T.T.N., D.Q.T., G.T.H.T. and J.R.; resources, K.C. and J.R.; data curation, H.V.D. and J.R.; original draft preparation, H.V.D., K.C. and J.R.; writing—review and editing, V.P.L. and J.R.; visualization, K.C. and J.R.; supervision, J.R.; project administration, K.C. and J.R.; funding acquisition, J.R. All authors have read and agreed to the published version of the manuscript.
Funding
This work was financially supported by the Office of the Ministry of Higher Education, Science, Research, and Innovation; and Thailand Science Research and Innovation through the Kasetsart University Reinventing University Program 2022 [RUP2565/Act-2_CASAF PD012]. The research was also funded by the Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand, and National Research Council of Thailand (NRCT): R. Thanawongnuwech NRCT Senior scholar 2022 #N42A650553 and the Kasetsart University Research and Development Institute (KURDI), Bangkok, Thailand, KURDI(FF(KU16.66)).
Institutional Review Board Statement
This study was approved by the Committee on Animal Research and Ethics, Faculty of Veterinary Medicine, Vietnam National University of Agriculture under the number CARE-2021/03.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data presented in this study are available within the article. Raw data supporting this study are available from the corresponding author.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Walker, P.J.; Siddell, S.G.; Lefkowitz, E.J.; Mushegian, A.R.; Dempsey, D.M.; Dutilh, B.E.; Harrach, B.; Harrison, R.L.; Hendrickson, R.C.; Junglen, S.; et al. Changes to virus taxonomy and the international code of virus classification and nomenclature ratified by the International Committee on Taxonomy of Viruses (2019). Arch. Virol. 2019, 164, 2417–2429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palya, V. Parvovirus infections of water fowl. In Diseases of Poultry, 13th ed.; Ames, I.A., Ed.; John Wiley: Hoboken, NJ, USA, 2013. [Google Scholar]
- Glavits, R.; Zolnai, A.; Szabo, E.; Ivanics, E.; Zarka, P.; Mato, T.; Palya, V. Comparative pathological studies on domestic geese (Anser anser domestica) and Muscovy ducks (Cairina moschata) experimentally infected with parvovirus strains of goose and Muscovy duck origin. Acta Vet. Hung. 2005, 53, 73–89. [Google Scholar] [CrossRef] [PubMed]
- Zadori, Z.; Stefancsik, R.; Rauch, T.; Kisary, J. Analysis of the complete nucleotide sequences of goose and muscovy duck parvoviruses indicates common ancestral origin with adeno-associated virus 2. Virology 1995, 212, 562–573. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zadori, Z.; Erdei, J.; Nagy, J.; Kisary, J. Characteristics of the genome of goose parvovirus. Avian Pathol. 1994, 23, 359–364. [Google Scholar] [CrossRef]
- Poonia, B.; Dunn, P.A.; Lu, H.; Jarosinski, K.W.; Schat, K.A. Isolation and molecular characterization of a new Muscovy duck parvovirus from Muscovy ducks in the USA. Avian Pathol. 2006, 35, 435–441. [Google Scholar] [CrossRef]
- Wang, S.; Cheng, X.X.; Chen, S.Y.; Lin, F.Q.; Chen, S.L.; Zhu, X.L.; Wang, J.X.; Huang, M.Q.; Zheng, M. Phylogenetic analysis of VP1 gene sequences of waterfowl parvoviruses from the Mainland of China revealed genetic diversity and recombination. Gene 2016, 578, 124–131. [Google Scholar] [CrossRef]
- Tsai, H.J.; Tseng, C.H.; Chang, P.C.; Mei, K.; Wang, S.C. Genetic variation of viral protein 1 genes of field strains of waterfowl parvoviruses and their attenuated derivatives. Avian Dis. 2004, 48, 512–521. [Google Scholar] [CrossRef]
- Tatar-Kis, T.; Mato, T.; Markos, B.; Palya, V. Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains. Avian Pathol. 2004, 33, 438–444. [Google Scholar] [CrossRef]
- Mochizuki, M.; Ohshima, T.; Une, Y.; Yachi, A. Recombination between vaccine and field strains of canine parvovirus is revealed by isolation of virus in canine and feline cell cultures. J. Vet. Med. Sci. 2008, 70, 1305–1314. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Dou, Y.; Tang, Y.; Zhang, Z.; Zheng, X.; Niu, X.; Yang, J.; Yu, X.; Diao, Y. Isolation and genomic characterization of a duck-origin GPV-related parvovirus from Cherry Valley ducklings in China. PLoS ONE 2015, 10, e0140284. [Google Scholar] [CrossRef]
- Soliman, M.A.; Erfan, A.M.; Samy, M.; Mahana, O.; Nasef, S.A. Detection of novel goose parvovirus disease associated with short beak and dwarfism syndrome in commercial ducks. Animals 2020, 10, 1833. [Google Scholar] [CrossRef] [PubMed]
- Matczuk, A.K.; Chmielewska-Wladyka, M.; Siedlecka, M.; Bednarek, K.J.; Wieliczko, A. Short beak and dwarfism syndrome in ducks in Poland caused by novel goose parvovirus. Animals 2020, 10, 2397. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Lin, S.; Zhang, R.; Chen, J.; Sun, D.; Lan, J.; Song, S.; Xie, Z.; Jiang, S. Isolation and characterization of novel goose parvovirus-related virus reveal the evolution of waterfowl parvovirus. Transbound. Emerg. Dis. 2018, 65, e284–e295. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Mi, Q.; Wang, Z.; Jia, J.; Li, Y.; Zhu, G. Sole recombinant Muscovy duck parvovirus infection in Muscovy ducklings can form characteristic intestinal embolism. Vet. Microbiol. 2020, 242, 108590. [Google Scholar] [CrossRef]
- Wang, J.; Wang, Z.; Jia, J.; Ling, J.; Mi, Q.; Zhu, G. Retrospective investigation and molecular characteristics of the recombinant Muscovy duck parvovirus circulating in Muscovy duck flocks in China. Avian Pathol. 2019, 48, 343–351. [Google Scholar] [CrossRef]
- Wang, J.; Ling, J.; Wang, Z.; Huang, Y.; Zhu, J.; Zhu, G. Molecular characterization of a novel Muscovy duck parvovirus isolate: Evidence of recombination between classical MDPV and goose parvovirus strains. BMC Vet. Res. 2017, 13, 327. [Google Scholar] [CrossRef]
- Nguyen, V.G.; Dang, H.A.; Nguyen, H.H.; Nguyen, T.B.; Cao, T.B.P.; Huynh, T.M. The preliminary result on detection of Waterfowl parvovirus in Hung Yen province 2019. Vietnam. J. Agri. Sci. 2019, 17, 816–825. [Google Scholar]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [Green Version]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [Green Version]
- Murrell, B.; Moola, S.; Mabona, A.; Weighill, T.; Sheward, D.; Kosakovsky Pond, S.L.; Scheffler, K. FUBAR: A fast, unconstrained bayesian approximation for inferring selection. Mol. Biol. Evol. 2013, 30, 1196–1205. [Google Scholar] [CrossRef] [PubMed]
- Yu, K.; Ma, X.; Sheng, Z.; Qi, L.; Liu, C.; Wang, D.; Huang, B.; Li, F.; Song, M. Identification of goose-origin parvovirus as a cause of newly emerging beak atrophy and dwarfism syndrome in ducklings. J. Clin. Microbiol. 2016, 54, 1999–2007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shien, J.H.; Wang, Y.S.; Chen, C.H.; Shieh, H.K.; Hu, C.C.; Chang, P.C. Identification of sequence changes in live attenuated goose parvovirus vaccine strains developed in Asia and Europe. Avian Pathol. 2008, 37, 499–505. [Google Scholar] [CrossRef]
- Yu, T.F.; Ma, B.; Wang, J.W. Identification of linear B-cell epitopes on goose parvovirus non-structural protein. Vet. Immunol. Immunopathol. 2016, 179, 85–88. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.J.; Yang, Y.T.; Zou, H.Y.; Chen, S.J.; Yang, C.; Tian, Y.B.; Huang, Y.M. Identification of recombination in novel goose parvovirus isolated from domesticated Jing-Xi partridge ducks in South China. Virus Genes 2020, 56, 600–609. [Google Scholar] [CrossRef] [PubMed]
- Wan, C.; Liu, R.; Chen, C.; Cheng, L.; Shi, S.; Fu, G.; Chen, H.; Fu, Q.; Huang, Y. Novel goose parvovirus in domestic Linwu sheldrakes with short beak and dwarfism syndrome, China. Transbound. Emerg. Dis. 2019, 66, 1834–1839. [Google Scholar] [CrossRef]
- Fu, Q.; Huang, Y.; Wan, C.; Fu, G.; Qi, B.; Cheng, L.; Shi, S.; Chen, H.; Liu, R.; Chen, Z. Genomic and pathogenic analysis of a Muscovy duck parvovirus strain causing short beak and dwarfism syndrome without tongue protrusion. Res. Vet. Sci. 2017, 115, 393–400. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhou, Z.; Huang, Y.; Yu, R.; Dong, S.; Li, Z.; Zhang, Y. Identification of a recombinant Muscovy Duck parvovirus (MDPV) in Shanghai, China. Vet. Microbiol. 2014, 174, 560–564. [Google Scholar] [CrossRef]
- Desvaux, S.; Nguyen, C.O.; Vu, D.T.; Henriquez, C.; Ky, V.D.; Roger, F.; Fenwick, S.; Goutard, F. Risk of introduction in northern Vietnam of HPAI viruses from China: Description, patterns and drivers of illegal poultry trade. Transbound. Emerg. Dis. 2016, 63, 389–397. [Google Scholar] [CrossRef]
- Fan, W.; Sun, Z.; Shen, T.; Xu, D.; Huang, K.; Zhou, J.; Song, S.; Yan, L. Analysis of evolutionary processes of species jump in waterfowl parvovirus. Front. Microbiol. 2017, 8, 421. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Geographical locations of sample areas in northern Vietnam (red circles) and distribution of sampling size in Thainguyen (15), Bacgiang (30), Haiduong (6), Thaibinh (21), Hungyen (10), and Hanoi (48).
Figure 1.
Geographical locations of sample areas in northern Vietnam (red circles) and distribution of sampling size in Thainguyen (15), Bacgiang (30), Haiduong (6), Thaibinh (21), Hungyen (10), and Hanoi (48).
Figure 2.
Phylogenetic trees of the near-complete genome (4750 bp) sequences of Vietnamese parvovirus strains compared with those available in GenBank. GenBank sequences are indicated by the country name/accession number. The maximum likelihood method in the MEGA6 software was used to establish phylogenetic trees (1000 bootstrap replicates). Numbers at each branch point indicate bootstrap values ≥50% in the bootstrap interior branch test. The current Vietnamese and vaccine strains are indicated by circles and diamonds, respectively.
Figure 2.
Phylogenetic trees of the near-complete genome (4750 bp) sequences of Vietnamese parvovirus strains compared with those available in GenBank. GenBank sequences are indicated by the country name/accession number. The maximum likelihood method in the MEGA6 software was used to establish phylogenetic trees (1000 bootstrap replicates). Numbers at each branch point indicate bootstrap values ≥50% in the bootstrap interior branch test. The current Vietnamese and vaccine strains are indicated by circles and diamonds, respectively.
Figure 3.
Phylogenetic trees of the full-length Cap gene (2199 bp) sequences of Vietnamese parvovirus strains compared with those available in GenBank. GenBank sequences are indicated by the country name/accession number. The maximum likelihood method in the MEGA6 software was used to establish phylogenetic trees (1000 bootstrap replicates). Numbers at each branch point indicate bootstrap values ≥50% in the bootstrap interior branch test. The current Vi-etnamese and vaccine strains are indicated by circles and diamonds, respectively.
Figure 3.
Phylogenetic trees of the full-length Cap gene (2199 bp) sequences of Vietnamese parvovirus strains compared with those available in GenBank. GenBank sequences are indicated by the country name/accession number. The maximum likelihood method in the MEGA6 software was used to establish phylogenetic trees (1000 bootstrap replicates). Numbers at each branch point indicate bootstrap values ≥50% in the bootstrap interior branch test. The current Vi-etnamese and vaccine strains are indicated by circles and diamonds, respectively.
Figure 4.
Phylogenetic trees of the full-length Rep gene (1884 bp) sequences of Vietnamese parvovirus strains com-pared with those available in GenBank. GenBank sequences are indicated by the country name/accession number. The maximum likelihood method in the MEGA6 software was used to establish phylogenetic trees (1000 bootstrap repli-cates). Numbers at each branch point indicate bootstrap values ≥50% in the bootstrap interior branch test. The current Vietnamese and vaccine strains are indicated by circles and diamonds, respectively.
Figure 4.
Phylogenetic trees of the full-length Rep gene (1884 bp) sequences of Vietnamese parvovirus strains com-pared with those available in GenBank. GenBank sequences are indicated by the country name/accession number. The maximum likelihood method in the MEGA6 software was used to establish phylogenetic trees (1000 bootstrap repli-cates). Numbers at each branch point indicate bootstrap values ≥50% in the bootstrap interior branch test. The current Vietnamese and vaccine strains are indicated by circles and diamonds, respectively.
Figure 5.
Detection of recombination events using BootScan analysis of full-length Cap gene sequences of Vietnam/VNUA-26/2021 NGPV strains. The pairwise distance model with window size 200, step size 20, and 1000 bootstrap replicates was generated by the RDP 4 program.
Figure 5.
Detection of recombination events using BootScan analysis of full-length Cap gene sequences of Vietnam/VNUA-26/2021 NGPV strains. The pairwise distance model with window size 200, step size 20, and 1000 bootstrap replicates was generated by the RDP 4 program.
Table 1.
Primers used in this study.
| Target | Name | Sequence (5’–3’) | PCR Product (bp) | Location of Target Genes on the Viral Genome | Reference |
|---|---|---|---|---|---|
| PCR | PV-F | CCAAGCTACAACAACCACAT | 539 | [4] | |
| PV-R | TGAGCGAACATGCTATGGAAGG | ||||
| Sequencing | GPV-P1-F | CTTATTGGAGGGTTCGTTCGT | 176 | 5′-UTR | [14] |
| GPV-P1-R | GCATGCGCGTGGTCAACCTAACA | ||||
| GPV-P2-F | GCATGCCGCGCGGTCAGCCCAATA | 1033 | 5′-UTR/Rep | [14] | |
| GPV-P2-R | ATTTCAATGAGCCAATCAACAAGG | ||||
| GPV-P3-F | GCCTTTATTTACTGCTGC | 1443 | Rep | [14] | |
| GPV-P3-R | GCTTTCAGATTCCGCCAC | ||||
| GPV-P4-F | CTTGATGATGCTGAAAATGAAC | 1446 | Rep/Cap | [14] | |
| GPV-P4-R | GCCCATGGTGCCATAAGC | ||||
| GPV-P5-F | CGCTCATTCACAGGACTTAGACA | 1170 | Cap/3′-UTR | [14] | |
| GPV-P5-R | GCATGCGCGTGGTCAACCTAACA |
Table 2.
Description of waterfowl parvovirus isolates compared in this study.
| GenBank Accession No. | Strain | Location | Source | Year |
|---|---|---|---|---|
| MN549533.1 | GDQY1802 | China | Duck | 2018 |
| MN549532.1 | GDSG1902 | China | Duck | 2018 |
| KT935531.2 | JS1 | China | Duck | 2015 |
| KX384726.2 | DS15 | China | Duck | 2015 |
| KU641558.1 | CVS01 | China | Duck | 2015 |
| KY679174.1 | SC16 | China | Duck | 2016 |
| MF441227.1 | AH1605 | China | Duck | 2016 |
| MH444513.1 | AH | China | Duck | 2018 |
| MN415972.1 | SD1228 | China | Duck | 2018 |
| MN415972.1 | SD1228 | China | Duck | 2018 |
| MN356044.1 | SDJN19 | China | Duck | 2019 |
| EU583392.1 | VG32/1 vaccine | Taiwan | Goose | 2008 |
| EU583389.1 | 82-0321V vaccine | Taiwan | Goose | 1982 |
| MT646164.1 | AHAU30 | China | Duck | 2019 |
| EF515837.1 | DY | China | Muscovy duck | 2007 |
| MT646163.1 | AHAU41 | China | Duck | 2019 |
| MF942876.1 | SQ0412 | China | Goose | 2017 |
| KY475562.1 | RC16 | China | Goose | 2016 |
| KC996730.1 | YZ99-6 | China | Goose | 1999 |
| KM272560.1 | LH | China | Goose | 2012 |
| KR136258.1 | Yan-2 | China | Goose | 2013 |
| KR091960.1 | YZ | China | Goose | 2013 |
| EU583391.1 | 06-0329 | Taiwan | Goose | 2008 |
| KC184133.1 | E | China | Goose | 2021 |
| MW386077.1 | Corum/19 | Turkey | Goose | 2019 |
| MW386079.1 | Yozgat/19 | Turkey | Goose | 2019 |
| MW386078.1 | Konya/19 | Turkey | Goose | 2019 |
| MF441223.1 | SDHZ1604 | China | Duck | 2016 |
| MF441221.1 | SDLY1512 | China | Duck | 2015 |
| MF441226.1 | JS1603 | China | Duck | 2016 |
| MF441222.1 | SDLY1602 | China | Duck | 2016 |
| MH444514.1 | GD | China | Duck | 2016 |
| MK000549.1 | HuN001 | China | Duck | 2018 |
| MK737642.1 | HN1P | China | Duck | 2019 |
| KY511124.1 | SD | China | Duck | 2015 |
| KT343253.1 | sdlc01 | China | Duck | 2015 |
| KM093740.1 | MDPV-GX5 | China | Muscovy duck | 2011 |
| KU844282.1 | P1 | China | Muscovy duck | 2016 |
| KT865605.1 | FZ91-30 vaccine | China | Muscovy duck | 1991 |
| KU844281.1 | P | China | Muscovy duck | 1988 |
Table 3.
Detection of waterfowl parvovirus genome in field duck samples obtained from different northern provinces/cities of Vietnam.
Table 3.
Detection of waterfowl parvovirus genome in field duck samples obtained from different northern provinces/cities of Vietnam.
| Province/City | No. of Collected Samples | Gene-Positive Samples/(%) | No. of Flocks | Gene-Positive Flocks/(%) |
|---|---|---|---|---|
| Hanoi | 48 | 11/(22.92) a,b | 11 | 4/(36.36) c |
| Haiduong | 6 | 2/(33.33) a,b | 2 | 1/(50.00) c,d |
| Thainguyen | 15 | 4/(26.67) a | 3 | 2/(66.67) d |
| Bacgiang | 30 | 4/(13.33) b | 11 | 3/(27.27) c,e |
| Thaibinh | 21 | 3/(14.29) b | 7 | 2/(28.57) c,e |
| Hungyen | 10 | 2/(20.00) a,b | 4 | 2/(50) c,d |
| Total | 130 | 26/(20.00) | 38 | 14/(36.84) |
Letters a,b,c,d,e indicate that the groups were significantly (p < 0.05) different from each other.
Table 4.
Detection of waterfowl parvovirus genome in field duck samples by age and flock size.
| Criteria | Ages/Duck Heads | Samples (n) | Gene-Positive Samples/(%) |
|---|---|---|---|
| Age (weeks) | <2 | 11 | 1/(9.09) a |
| 2–4 | 27 | 10/(37.04) b | |
| >4 | 92 | 15/(16.30) a | |
| Flock size | <500 | 29 | 9/(31.03) a |
| 500–1000 | 64 | 6/(9.38) b | |
| >1000 | 37 | 11/(29.73) a |
Letters a,b indicate that the groups were significantly (p < 0.05) different from each other.
Table 5.
Amino acid substitutions in Rep protein of Vietnamese NGPV strains.
| Virus Strain/Consensus a | Sites in Rep Protein | |||
|---|---|---|---|---|
| 154 | 551 | 555 | 560 | |
| GPV | T | R | N | C |
| MDPV | T | K | D | C |
| Vietnamese NGPVs | T/S | K/R | P/T | G/C |
a Deduced amino acid consensus was released with 102 waterfowl parvovirus sequences retrieved from GenBank by using GENETYX version 10.
Table 6.
Amino acid substitutions in Cap protein of Vietnamese NGPV strains.
| Virus Strain/Consensus a | Sites in Cap Protein | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 142 | 144 | 178 | 180 | 206 | 386 | 390 | 448 | 449 | 451 | 458 | 461 | 507 | 509 | |
| GPV | D | V | S | A | A | N | A | D | G | R | A | G | D | Q/E |
| MDPV | E | V | N | G | A | N | A | D/N | S/G | R | A | G | D | E |
| Vietnamese NGPVs | E/D | I/V | T/S | A/V | T/A | N/D | A/P | D/G | S/R | R/G | A/T | G/R | E/D/A | Q/P |
a Deduced amino acid consensus was released with 102 waterfowl parvovirus sequences retrieved from GenBank by using GENETYX version 10.
Table 7.
Recombination statistics of Vietnam/VNUA-26/2021 Cap gene sequence using RDP 4.
| Method | Recombination p-Value |
|---|---|
| RDP | 1.89 × 10−2 |
| GENECONV | 4.77 × 10−4 |
| BootScan | 2.84 × 10−2 |
| MaxChi | 2.72 × 10−5 |
| Chimaera | 8.11 × 10−6 |
| SiScan | 5.41 × 10−12 |
| PhylPro | - |
| LARD | - |
| 3Seq | 4.48 × 10−3 |
Recombination events with p-value < 0.05 were regarded as reliable.
Table 8.
Natural selection profile in waterfowl parvovirus capsid and replication protein of four current Vietnamese NGPV strains.
Table 8.
Natural selection profile in waterfowl parvovirus capsid and replication protein of four current Vietnamese NGPV strains.
| Protein | Site | a | b | b–a | Prob [a > b] | Prob [a < b] | Bayes Factor [a < b] |
|---|---|---|---|---|---|---|---|
| Capsid | 137 | 26.755 | 2.394 | −24.361 | 0.912 | 0.063 | 0.083 |
| 147 | 26.312 | 2.169 | −24.142 | 0.916 | 0.06 | 0.078 | |
| 157 | 25.594 | 2.021 | −23.573 | 0.915 | 0.061 | 0.079 | |
| 159 | 26.745 | 2.188 | −24.557 | 0.917 | 0.06 | 0.079 | |
| 161 | 24.335 | 2.109 | −22.226 | 0.906 | 0.068 | 0.089 | |
| 168 | 25.174 | 2.226 | −22.948 | 0.908 | 0.065 | 0.086 | |
| 472 | 24.338 | 2.108 | −22.23 | 0.906 | 0.068 | 0.089 | |
| 507 | 4.423 | 33.746 | 29.323 | 0.034 | 0.926 | 15.48 | |
| 686 | 25.729 | 2.158 | −23.571 | 0.912 | 0.063 | 0.083 | |
| Replication | 508 | 30.806 | 3.718 | −27.088 | 0.905 | 0.062 | 0.077 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Dong, H.V.; Tran, G.T.H.; Nguyen, H.T.T.; Nguyen, T.M.; Trinh, D.Q.; Le, V.P.; Choowongkomon, K.; Rattanasrisomporn, J. Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination. Animals 2022, 12, 2846. https://doi.org/10.3390/ani12202846
AMA Style
Dong HV, Tran GTH, Nguyen HTT, Nguyen TM, Trinh DQ, Le VP, Choowongkomon K, Rattanasrisomporn J. Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination. Animals. 2022; 12(20):2846. https://doi.org/10.3390/ani12202846
Chicago/Turabian StyleDong, Hieu Van, Giang Thi Huong Tran, Huong Thi Thu Nguyen, Tuong Manh Nguyen, Dai Quang Trinh, Van Phan Le, Kiattawee Choowongkomon, and Jatuporn Rattanasrisomporn. 2022. "Epidemiological Analysis and Genetic Characterization of Parvovirus in Ducks in Northern Vietnam Reveal Evidence of Recombination" Animals 12, no. 20: 2846. https://doi.org/10.3390/ani12202846
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
