Next Article in Journal
Outcome of Acquired Fanconi Syndrome Associated with Ingestion of Jerky Treats in 30 Dogs
Next Article in Special Issue
Effects of Compound Probiotics on Growth Performance, Serum Biochemical and Immune Indices, Antioxidant Capacity, and Intestinal Tissue Morphology of Shaoxing Duck
Previous Article in Journal
Comparative Study of the Expression Profiles of miRNAs of Milk-Derived Exosomes of Yak and Jeryak
Previous Article in Special Issue
Effect of Dietary Supplementation of Probiotic Aspergillus niger on Performance and Cecal Microbiota in Hy-Line W-36 Laying Hens
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 12
Issue 22
10.3390/ani12223191
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence of Extended-Spectrum β-Lactamase-Resistant Genes in Escherichia coli Isolates from Central China during 2016–2019

by
Zui Wang
1,2,3,†,
Qin Lu
1,2,3,†,
Xiaohui Mao
1,2,3,
Li Li
1,2,3,
Junfeng Dou
1,2,
Qigai He
3,
Huabin Shao
1,2 and
Qingping Luo
1,2,*
1
Key Laboratory of Prevention and Control Agents for Animal Bacteriosis (Ministry of Agriculture and Rural Affairs), Institute of Animal Husbandry and Veterinary, Hubei Academy of Agricultural Sciences, Wuhan 430064, China
2
Hubei Hongshan Laboratory, Wuhan 430064, China
3
State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430064, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2022, 12(22), 3191; https://doi.org/10.3390/ani12223191
Submission received: 26 September 2022 / Revised: 4 November 2022 / Accepted: 15 November 2022 / Published: 18 November 2022
(This article belongs to the Collection Application of Antibiotic Alternatives in the Poultry Industry)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

β-lactam antibiotics are commonly used for the treatment of severe infection in both animals and humans, and the resistance of E. coli to third-generation cephalosporins is becoming a worldwide problem. Our results revealed 407 E. coli strains isolated from central China exhibited strong resistance to first- to fourth-generation cephalosporins and monobactam antibiotics, and piperacillin/tazobactam was the most effective drug. Phenotypically, 63.88% of the isolates were positive for ESBL production and the isolation rates kept growing. Genetic characterization identified CTX-M as the most prevalent type and blaTEM + blaCTX-M as the most common ESBL genotype combination. Furthermore, a novel multiplex real-time PCR method for detecting the three most common ESBL genes was developed as a complementary rapid-screening test for antimicrobial resistance genes. These results confirm the cephalosporins resistance urgency in the central Chinese poultry sector and suggest the continuous monitoring and timely detection of ESBL-producing isolates is vitally important in establishing appropriate antimicrobial therapies and blocking their transmission.

Abstract

The emergence and dissemination of Escherichia coli (E. coli) strains that produce extended-spectrum beta-lactamases (ESBLs) represents a major public health threat. The present study was designed to evaluate the prevalence and characteristics of ESBL-producing Escherichia coli isolates from chickens in central China during 2016–2019. A total of 407 E. coli strains isolated from 581 chicken swabs were identified conventionally and analyzed for various cephalosporin susceptibility by disk-diffusion assay. ESBL-producing strains were screened using the double=disk synergy test and ESBL-encoding genes were carried out by PCR/sequencing. A total of 402 E. coli isolates exhibited strong resistance to first- to fourth-generation cephalosporins and monobactam antibiotics, especially cefazolin (60.69%), cefuroxime (54.05%), cefepime (35.14%), ceftriaxone (54.30%), and aztreonam (40.29%). Piperacillin/tazobactam (1.72%) was the most effective drug against the strains, but the resistance rates increased each year. Among the isolates, 262 were identified as ESBL producers and the isolation rates for the ESBL producers increased from 63.37% to 67.35% over the four years. CTX-M (97.33%) was the most prevalent type, followed by TEM (76.72%) and SHV (3.05%). The most common ESBL genotype combination was blaTEM + blaCTX-M (74.46%), in which the frequency of carriers increased steadily, followed by blaCTX-M + blaSHV (3.05%). In addition, the most predominant specific CTX-M subtypes were CTX-M-55 (48.47%) and CTX-M-1 (17.94%), followed by CTX-M-14 (11.01%), CTX-M-15 (8.02%), CTX-M-9 (6.11%), CTX-M-65 (4.58%), and CTX-M-3 (1.15%). Moreover, a novel multiplex qPCR assay was developed to detect blaCTX-M, blaTEM, and blaSHV, with limits of detection of 2.06 × 101 copies/μL, 1.10 × 101 copies/μL, and 1.86 × 101 copies/μL, respectively, and no cross-reactivity with other ESBL genes and avian pathogens. The assays exhibited 100% sensitivity and specificities of 85%, 100%, and 100% for blaCTX-M, blaTEM, and blaSHV, respectively. In conclusion, our findings indicated that ESBL-producing E.coli strains isolated from chickens in central China were highly resistant to cephalosporins and frequently harbored diversity in ESBL-encoding genes. These isolates can pose a significant public health risk. The novel multiplex qPCR method developed in this study may be a useful tool for molecular epidemiology and surveillance studies of ESBL genes.

1. Introduction

Escherichia coli (E. coli) is one of the main pathogens that cause diarrhea in pigs and chickens, and it is an important cause of death among piglets and young poultry [1]. Antibiotics are generally used to treat E. coli infections due to the lack of an effective vaccine. However, bacteria with resistance to multiple drugs have increasingly been found because of the overuse and misuse of antibiotics on farms to reduce and prevent the risk of infection [2]. Pigs and chickens are food-producing animals but are also major reservoirs of organisms with antimicrobial resistance [3,4]. In addition to antibiotic residues in food, antibiotic resistance genes can disseminate between animals and humans via the food chain [5]. Therefore, drug-resistant E. coli strains pose severe hazards to animal husbandry and food safety.
Resistance to third-generation cephalosporins is growing, so much attention has been increasingly focused on extended-spectrum β-lactamase (ESBL) enzymes that can hydrolyze the β-lactam ring in a wide range of β-lactam antimicrobials [6]. ESBL-producing E. coli isolates are also among the most critical antibiotic-resistant pathogens categorized by the World Health Organization. In general, the most prevalent ESBLs are encoded by blaTEM, blaCTX-M, and blaSHV, and the frequency of carrying blaCTX-M is highest in ESBL-producing E. coli. Up to 97.8% of E. coli isolates from pigs, cattle, chicken, and sheep produce CTX-M group enzymes [7]. In recent years, the extensive use of antimicrobial agents, coupled with the transmissibility of resistance determinants, such as integrons, has resulted in the emergence and spread of MDR ESBL-producing strains. Previous studies have demonstrated that E. coli is one of the major causes of childhood diarrhea, and the distribution of class 1 integrons and ESBLs in the strains is highly prevalent [8]. The production of ESBLs can greatly restrict the uses of clinical medication, so the continuous monitoring and timely detection of ESBL-producing isolates is vitally important in establishing appropriate antimicrobial therapies and blocking their transmission [9]. At present, the common methods used to identify ESBL-producing bacteria include the drug-sensitive disk-diffusion method, microbroth-dilution method, and E-test method. However, these are culture-based methods for phenotypic screening, which are time-consuming, laborious, and incapable of distinguishing different ESBL genotypes. Molecular techniques, such as multiplex PCR and real-time PCR, have been applied to detect the specific genes that encode ESBLs [10,11]. The emergence of ESBL enzymes is mainly due to plasmids and chromosomal mutations [12]. Unfortunately, many new mutations have been found because of the misuse of third-generation cephalosporins, thereby leading to the emergence of new drug-resistant gene subtypes. For example, the CTX-M genotypes include CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, and CTX-M-25 [13]. Therefore, it is necessary to improve the existing molecular detection techniques. In the present study, we developed a novel multiplex real-time PCR method to detect the three most common ESBL genes (blaTEM, blaCTX-M, and blaSHV) and to identify the trends in cephalosporin resistance among E. coli isolates obtained from chicken feces samples collected in central China during 2016–2019.

2. Methods

2.1. Collection of Bacterial Strains

From 2016 to 2019, a total of 581 swab samples were obtained from broiler chickens at different farms located in central China, including Wuhan, Xiangyang, Xiantao, Xinyang, Daye, Tianmen, Jinan, Hanchuan, Changde, and Yucheng. The collected samples were streaked onto MacConkey agar and eosin-methylene blue agar (Haibo, Qingdao, China), and then incubated at 37 °C for 24 h. Typical E. coli colonies were subsequently confirmed by PCR amplification of the phoA gene using E. coli-specific primers. In addition, reference strain ATCC 29522 was obtained from the China Veterinary Culture Collection Center. Unless otherwise stated, all cultures were maintained in Luria broth (Haibo) in the presence of oxygen at 37 °C.

2.2. Antimicrobial Susceptibility Testing

The susceptibility of E. coli isolates to antimicrobial agents was determined using the disk-diffusion assay according to the methods of the Clinical and Laboratory Standards Institute (CLSI). Briefly, antimicrobial disks were placed on the surfaces of Mueller–Hinton agar (Haibo) plates inoculated with E. coli. The inoculated plates were incubated at 37 °C for 24 h, before the diameters of the zones of inhibition were measured and interpreted following CLSI guidelines. The E. coli ATCC 25922 strain was used for quality control in the test. The antimicrobial disks (Oxoid, England, UK) contained cefazolin (CZO), cefuroxime (CXM), cefoxitin (FOX), ceftriaxone (CRO), ceftazidime (CAZ), cefoperazone/sulbactam (SCF), cefepime (FEP), aztreonam (ATM), amoxicillin/clavulanic acid (AMC), ampicillin/sulbactam (SAM), and piperacillin/tazobactam (TZP).

2.3. Screening for ESBL-Producing Strains

The E. coli isolates were phenotypically screened using the double-disk synergy test. Briefly, antimicrobial disks containing CAZ (30 μg) and CAZ/clavulanic acid (30/10 μg), or cefotaxime (30 μg) and cefotaxime/clavulanic acid (30/10 μg) (Solarbio, Beijing, China), were placed on the surfaces of Mueller–Hinton agar plates inoculated with E. coli. After inverted culture at 37 °C for 24 h, the diameters of the zones of inhibition were measured. ESBL production was indicated when the zone of inhibition in the CAZ or cefotaxime group was expanded by clavulanate (≥5 mm). E. coli ATCC 25922 was used as the negative control.

2.4. Characterization of ESBL Genes by PCR Sequencing

The ESBL genes (blaTEM, blaCTX-M, and blaSHV) were detected in ESBL-producing E. coli isolated by PCR and confirmed by DNA sequencing. Briefly, nucleic acid was extracted from the isolates using the boiling method. PCR was performed using gene-specific primers (Table 1) and the products were sequenced by Sangon Biotech (Shanghai, China).

2.5. Probe and Primer Design

Genetic sequences of blaTEM, blaCTX-M, and blaSHV were downloaded from the GenBank database and aligned using Megalign (Madison, WI, USA). The primers and probes were designed using Primer Express 3.0 (ABI, La Jolla, CA, USA) software based on the conserved sequences (Table 1). Subsequently, the specificities of the primers and probes were evaluated by BLAST searching against the GenBank non-redundant database. Appropriate fluorophore groups and quenched groups were labeled at the 5′ and 3′ ends of the probes (Table 1). All primers were synthesized by Sangon Biotech.

2.6. Multiplex Quantitative PCR Amplification

The optimal qPCR system contained 5 μL of AceQ® qPCR Probe Master Mix (Vazyme, Nanjing, China), 0.4 μM of primers (TEM), 0.2 μM of primers (CTX-M), 0.3 μM of primers (SHV), 0.8 μM of primers (TEM), 0.4 μM of primers (CTX-M and SHV), 1 μL of cDNA, and 1.5 μL of nuclease-free H2O. The optimum reaction temperature was tested from 55.6 °C to 64.6 °C, with a temperature gradient of 1.5 °C. The specificity of the qPCR assay was examined with E. coli strains, including ESBL-producing strains and E. coli ATCC 25922. Nuclease-free H2O was used for the negative controls. Amplification and signal detection were conducted with a Bio-Rad system (Bio-Rad, Hercules, CA, USA).

2.7. Sensitivity Tests and Standard Curve

The detection targets were cloned into the pMD18-T vector and the concentrations of pMD-CTX-M, pMD-TEM, and pMD-SHV were determined using a NanoDrop One/OneC spectrophotometer (Thermo, Waltham, MA, USA). Sensitivity and standard curve tests were conducted using a 10-fold dilution series of the recombinant plasmids. Nuclease-free H2O was used as the negative control. Sensitivity tests were performed under the optimized reaction conditions and the results were compared to the PCR results. Standard curves were also established.

2.8. Detection of ESBL Genes Using the Novel Multiplex qPCR Method

All of the ESBL-positive E. coli isolates were screened for the presence of blaTEM, blaCTX-M, and blaSHV using the novel multiplex qPCR method. The results obtained by multiplex qPCR were compared to those produced using the normal PCR method. The agreement between the two methods was measured based on the significance using kappa (κ) statistics in QuickCals software (https://www.graphpad.com/quickcalcs/kappa1 accessed on 5 May 2022) (Montrose, CA, USA). The sensitivity and specificity were measured with MedCalc software (https://www.medcalc.org/calc/diagnostic_test.php accessed on 5 May 2022) (Ostend, Belgium).

3. Results

3.1. Antimicrobial Susceptibility and Phenotypic Identification

During 2016–2019, 407 E. coli strains were obtained using cloacae swabs from chickens in central China and 64.37% (262/407) were ESBL producers (Table 2), with 63.37% (64/101) in 2016, 60.42% (58/96) in 2017, 66.07% (74/112) in 2018, and 67.35% (66/98) in 2019. The isolation rate of ESBL producers increased each year, except in 2017.
Among the 407 isolates tested with different antibiotics, the resistance rates were as follows: CZO = 247/407 (60.69%); CXM = 220/407 (54.05%); FEP = 143/407 (35.14%); CRO = 221/407 (54.30%); ATM = 164/407 (40.29%); SAM = 91/407 (22.36%); FOX = 64/407 (15.72%); CAZ = 57/407 (14.05%); SCF = 25/407 (6.14%); AMC = 51/407 (12.53%); and TZP = 7/407 (1.72%). TZP was the most potent antibiotic with a susceptibility of 98.28%, followed by SCF (93.86%), but the resistance rates to TZP and SCF tended to increase during the four years (Figure 1). Similar to the phenotypic test results, the resistance rates to the major antibiotics were lower in 2017. In addition, all of the ESBL producers (100%, 262/262) were resistant to at least one or more β-lactam antibiotic, and the resistance rate was 16.55% (24/145) in non-ESBL producers, which increased rapidly (Table 2).

3.2. Genotypic Characterization of ESBL Producers

Among the 262 ESBL-positive isolates, all isolates were positive for ESBL genes, thereby indicating the high sensitivity of the phenotypic tests (Table 3). Among the ESBL-positive isolates, blaCTX-M genes were detected in 97.33% (255/262) of the isolates and blaTEM genes were detected in 76.72% (201/262) of the isolates. However, blaSHV genes had the lowest detection rate of (3.05%) 8/262, and they were only detected in 2019. In addition, the most common ESBL genotype combination in E. coli was blaTEM + blaCTX-M (194/262, 74.46%), and the rate increased steadily (Table 3). By contrast, the detection rates for blaTEM (7/262, 2.67%) and blaCTX-M (53/262, 20.23%) alone decreased slowly. Furthermore, the CTX-M genotypes include several variants (CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, and CTX-M-25) but only two CTX-M genotypes (CTX-M-1G, 75.57%; CTX-M-9G, 21.76%) were detected in the isolates (Figure 2). The predominant specific CTX-M types were CTX-M-55 (48.47%) and CTX-M-1 (17.94%), followed by CTX-M-14 (11.01%), CTX-M-15 (8.02%), CTX-M-9 (6.11%), CTX-M-65 (4.58%), and CTX-M-3 (1.15%). It should be noted that the rate of CTX-M-14, CTX-M-15, CTX-M-65, and CTX-M-3 detection increased each year. Moreover, some new combinations of ESBL genotypes were developed in the last two years, including CTX-M-3/TEM-1, CTX-M-15/TEM-30, CTX-M-15/SHV-12, CTX-M-55/SHV-12, and CTX-M-65/SHV-12.

3.3. Establishment of a Novel Multiplex qPCR Method

Primers and probes were designed based on the conserved sequences in order to establish a novel multiplex qPCR method to detect the three common ESBL genes (blaTEM, blaCTX-M, and blaSHV) (Figure 3). Some point mutations cannot be avoided when detecting the targets in the CTX-M groups, so primers and probes were inserted with degenerate bases. The optimal reaction conditions for multiplex qPCR comprised initial denaturation at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 57 °C for 30 s.
In the qPCR specificity tests, only ESBL-producing strains produced three positive fluorescence signals, and no positive signals were observed with ATCC 29522 and nuclease-free H2O (Figure 4A).
In the qPCR sensitivity tests, the detection limits for blaCTX-M, blaTEM, and blaSHV were determined as 2.06 × 101 copies/μL, 1.10 × 101 copies/μL, and 1.86 × 101 copies/μL in a single-tube assay system, respectively, and the limits were 2.06 × 103 copies/μL, 1.10 × 103 copies/μL, and 1.86 × 104 copies/μL in the PCR sensitivity tests (Figure 5). Thus, the sensitivity of the new method was at least 100 times that of the PCR assays. Using the standard curves established for the three ESBL genes (Figure 4B), three linear relationships were obtained between the copy number (x-axis) and quantification cycle (Cq) value (y axis) as follows: y = −3.328x + 38.561, R2 = 0.999 for blaTEM; y = −3.309x + 38.09, R2 = 0.998 for blaCTX-M; and y = −3.304x + 37.928, R2 = 0.999 for blaSHV.

3.4. Comparison of the Novel Multiplex qPCR Method and PCR

To determine the efficiency of the novel multiplex qPCR method, 262 ESBL-producing E. coli isolates were analyzed by multiplex qPCR and normal PCR. The results are compared in Table 4.
Among the 262 strains tested, 53 (20.23%) were positive for the presence of blaCTX-M alone and eight (3.05%) were positive for the presence of the blaCTX-M + blaSHV combination using multiplex qPCR. The same results were obtained with the PCR method, which is considered the gold standard. Six strains (6/262, 2.29%) were detected as positive for blaTEM alone by multiplex qPCR and seven strains (7/262, 2.67%) were detected as positive by PCR. The strain with a different result was detected as the combination of blaCTX-M + blaTEM using multiplex qPCR, thereby resulting in the discrepancy for one of the blaCTX-M + blaTEM samples. Both assays were negative for the detection of other β-lactamase gene patterns. Therefore, the novel multiplex qPCR method obtained almost perfect agreement with the gold standard PCR method (κ = 0.921 for blaCTX-M and κ = 1.000 for both blaTEM and blaSHV). In addition, the specificity, sensitivity, positive predictive value (PPV), and negative predictive value (NPV) results are shown in Table 5.

4. Discussion

E. coli infection remains a major health concern in poultry because it can be transmitted to humans through the food chain [14]. E. coli infections severely threaten the health of humans and poultry, as well as the development of the poultry industry and the economy. The resistance of E. coli to third-generation cephalosporins is a worldwide problem [2], mainly caused by the production of ESBLs. The transfer of ESBLs between bacteria is usually mediated by plasmids [15]. More than 600 ESBLs have been reported [16], and the majority are TEM, SHV, and CTX-M-type β-lactamases. A previous study showed that poultry feces could play an important role as potential reservoirs for resistant isolates and resistance genes [17]. In the present study, 407 avian E. coli strains were isolated from fecal samples collected during 2016–2019 in central China. The isolates exhibited severe resistance to first- to fourth-generation cephalosporins and monobactam antibiotics, especially CZO (60.69%), CXM (54.05%), FEP (35.14%), CRO (54.30%), and ATM (40.29%). The resistance rates were much higher than those found in other areas of China [18,19,20]. It indicated that the E. coli recovered from chickens developed serious resistance to cephalosporins; therefore, the use of these drugs should be suspended. TZP is effective against ESBL-producing Gram-negative bacteria and it is used as a first-line drug to treat serious infections [21]. In our study, TZP was the most potent antibiotic with a susceptibility of 98.28%. Although it could be used to treat the resistant isolates, the drug resistance rates increased each year, which reminds people to use antibiotics correctly and appropriately. ESBLs can hydrolyze all types of cephalosporins and monobactams, so they are the most significant in the spread of resistant determinants worldwide, mainly in E. coli [22]. The current study identified a prevalence (64.37%, 262/407) of ESBL producers. The isolation rates of ESBL producers increased from 63.37% to 67.35% during the four years, and the rates were much higher than those found in previous similar studies of chickens in China during 2004–2007 (28.8%) [23] and 2008–2014 (41.53%) [24]. Among the ESBL-positive isolates, the dominant resistance gene was blaCTX-M (97.33%), and the most common genotype combination was blaTEM + blaCTX-M (74.46%). Compared with the OXA and SHV types, the CTX-M and TEM types have spread more widely and they are now dominant in China, possibly because cefotaxime and CRO are the most commonly used clinical drugs for the treatment of bacterial diseases caused by Enterobacterales [25,26]. In addition, the CTX-M group is used most widely in China, so CTX-M-1G (75.57%) and CTX-M-9G (21.76%) were detected in ESBL-producing strains, and the detection rate of CTX-M-9G increased each year. In some regions of Asia, CTX-M-9G is the predominant group [27] and CTX-M-9-producing E. coli are always detected in urinary tract infections [28]. Moreover, previous studies have shown that two or more CTX-M groups frequently coexist in the same isolate, which could promote the occurrence of other recombinant enzymes in the future [29]. Fortunately, CTX-M-1 and CTX-M-9 group members were not found to coexist in the isolates in the present study. Additionally, the predominant specific CTX-M types were CTX-M-55 (48.47%) and CTX-M-1 (17.94%), followed by CTX-M-14 (11.01%), CTX-M-15 (8.02%), CTX-M-9 (6.11%), CTX-M-65 (4.58%), and CTX-M-3 (1.15%). A high carrying rate of CTX-M-55 has been reported in E. coli previously in many countries, including Hong Kong and Vietnam [30,31]. The emergence of CTX-M-55 has also been detected in Salmonella strains from raw meat and food animals in China [32]. Moreover, many avian ESBL E. coli isolates can produce CTX-M-14, CTX-M-15, and CTX-M-65 commonly detected in clinical samples, which is worrying in terms of food safety. CTX-M-15 has become the most prevalent CTX-M variant in both hospitals and the environment worldwide [33]. CTX-M-3 is frequently found in Salmonella and rarely detected in E. coli. However, it should be noted that the rate of CTX-M-14, CTX-M-15, CTX-M-65, and CTX-M-3 detection increased each year in the present study. On the other hand, the phenotypic resistance to cephalosporins was not validated completely by the genotypic ESBL results, possibly due to the presence on another resistance mechanism, such as AmpC β-lactamases [34,35], which was one of the reasons for the reduction in sensitivity towards newer generations of antibiotics [36]. In addition, ESBL-producing strains with AmpC β-lactamases could cause a false-negative ESBL production [8]. In summary, our results showed that the isolates exhibited very high resistance to cephalosporins and the frequency of ESBL producers increased during 2016–2019. Therefore, the early detection and characterization of ESBLs are vitally important in establishing appropriate antimicrobial therapies and preventing their transmission.
The routine diagnostic methods currently used to detect ESBL producers involve culture-based phenotypic screening, which is time-consuming and laborious, and they cannot distinguish different ESBL genotypes [37]. Molecular detection techniques have potential advantages due to the limitations of phenotypic detection methods. In the present study, we developed a novel multiplex qPCR assay for the rapid detection of blaCTX-M, blaTEM, and blaSHV with high specificity and low detection limits. CTX-M genotypes comprise CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9, and CTX-M-25 with a low homology and a few conserved regions among each group. Therefore, it is difficult to design probes and primers to detect all of these genotypes at the same time. CTX-M-1 and CTX-M-9 were the predominant types found in avian E. coli isolates in China and we only detected these genotypes in the 262 ESBL producers by PCR in the present study. Thus, the primers used to detect CTX-M could detect CTX-M-1 and CTX-M-9 at the same time. Some point mutations cannot be avoided when detecting targets in CTX-M groups, so the primers and probe were inserted with degenerate bases. The detection limits in the multiplex qPCR assays in the single-tube assay system were determined as 2.06 × 101 copies/μL for blaCTX-M, 1.10 × 101 copies/μL for blaTEM, and 1.86 × 101 copies/μL for blaSHV, and they were around 100 to 1000 times higher than those using the conventional PCR method. In addition, our assays were conducted using various resistance genes and ATCC 29522. Only ESBL-producing strains produced three positive fluorescence signals, and no positive signals were obtained with ATCC 29522 and nuclease-free H2O. In the efficiency tests, 262 ESBLs producers were detected using the normal PCR method and multiplex qPCR assay. The qPCR assay results were in almost perfect agreement with the PCR results, except for one sample. Therefore, the results demonstrated that the novel multiplex qPCR assay was highly efficient at detection with high specificity; thus, it can be used as a clinical detection method or as a complementary rapid-screening test for antimicrobial-resistant genes while phenotypic tests are being conducted.

5. Conclusions

In the present study, ESBL-producing E. coli isolates from chickens in central China during 2016–2019 exhibited high resistance to cephalosporins and they frequently carried diverse ESBL genes, thereby indicating that chickens have become reservoirs of antimicrobial-resistant organisms and that the continuous monitoring and timely detection of ESBL-producing isolates is vitally important. The novel multiplex qPCR method developed in this study could be effective in monitoring the prevalence of ESBL-producing E. coli in chickens to reduce the risk of transmission to humans.

Author Contributions

Formal analysis, Z.W.; Funding acquisition, H.S. and Q.L. (Qingping Luo); Methodology, Z.W. and X.M.; Project administration, Q.L. (Qingping Luo); Resources, L.L. and J.D.; Writing—original draft, Z.W.; Writing—review and editing, Q.L. (Qin Lu) and Q.H. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Science and Technology Major Project of Hubei Province (2020ABA016) and (2021CFA019), and the China Agriculture Research System of MOF and MARA (CARS-41-G13).

Institutional Review Board Statement

All the animal research activities in this study were approved by the Ethics Committee of Hubei Academy of Agricultural Sciences according to Hubei Province Laboratory Animal Management Regulations—2005.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

All the data are presented in this study.

Acknowledgments

We would like to thank Qingping Luo for her careful review of the manuscript.

Conflicts of Interest

The authors declare that they have no competing interests.

References

  1. Kanokudom, S.; Assawakongkarat, T.; Akeda, Y.; Ratthawongjirakul, P.; Chuanchuen, R.; Chaichanawongsaroj, N. Rapid detection of extended spectrum beta-lactamase producing Escherichia coli isolated from fresh pork meat and pig cecum samples using multiplex recombinase polymerase amplification and lateral flow strip analysis. PLoS ONE 2021, 16, e0248536. [Google Scholar] [CrossRef] [PubMed]
  2. Fulgenzio, C.; Massari, M.; Traversa, G.; Da Cas, R.; Ferrante, G.; Aschbacher, R.; Moser, V.; Pagani, E.; Vestri, A.R.; Massidda, O.; et al. Impact of Prior Antibiotic Use in Primary Care on Escherichia coli Resistance to Third Generation Cephalosporins: A Case-Control Study. Antibiotics 2021, 10, 451. [Google Scholar] [CrossRef] [PubMed]
  3. Rasheed, M.U.; Thajuddin, N.; Ahamed, P.; Teklemariam, Z.; Jamil, K. Antimicrobial drug resistance in strains of Escherichia coli isolated from food sources. Rev. Inst. Med. Trop. Sao Paulo 2014, 56, 341–346. [Google Scholar] [CrossRef] [PubMed]
  4. Costa, M.; Cardo, M.; Cara d’Anjo, M.; Leite, A. Assessing antimicrobial resistance occurrence in the Portuguese food system: Poultry, pigs and derived food, 2014-2018. Zoonoses Public Health 2022, 69, 312–324. [Google Scholar] [CrossRef] [PubMed]
  5. Cardozo, M.V.; Liakopoulos, A.; Brouwer, M.; Kant, A.; Pizauro, L.J.L.; Borzi, M.M.; Mevius, D.; de Avila, F.A. Occurrence and Molecular Characteristics of Extended-Spectrum Beta-Lactamase-Producing Enterobacterales Recovered From Chicken, Chicken Meat, and Human Infections in Sao Paulo State, Brazil. Front. Microbiol. 2021, 12, 628738. [Google Scholar] [CrossRef]
  6. Tooke, C.L.; Hinchliffe, P.; Bragginton, E.C.; Colenso, C.K.; Hirvonen, V.H.A.; Takebayashi, Y.; Spencer, J. beta-Lactamases and beta-Lactamase Inhibitors in the 21st Century. J. Mol. Biol. 2019, 431, 3472–3500. [Google Scholar] [CrossRef]
  7. Geser, N.; Stephan, R.; Hachler, H. Occurrence and characteristics of extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet. Res. 2012, 8, 21. [Google Scholar] [CrossRef] [Green Version]
  8. Jomehzadeh, N.; Ahmadi, K.; Javaherizadeh, H.; Afzali, M. The first evaluation relationship of integron genes and the multidrug-resistance in class A ESBLs genes in enteropathogenic Escherichia coli strains isolated from children with diarrhea in Southwestern Iran. Mol. Biol. Rep. 2021, 48, 307–313. [Google Scholar] [CrossRef]
  9. Hosu, M.C.; Vasaikar, S.D.; Okuthe, G.E.; Apalata, T. Detection of extended spectrum beta-lactamase genes in Pseudomonas aeruginosa isolated from patients in rural Eastern Cape Province, South Africa. Sci. Rep. 2021, 11, 7110. [Google Scholar] [CrossRef]
  10. Basbas, C.; Byrne, B.A.; Chigerwe, M.; Escobar, E.D.; Hodzic, E.; Pires, A.F.A.; Pereira, R.V. Detection of Cephalosporin and Fluoroquinolone Resistance Genes via Novel Multiplex qPCR in Fecal Salmonella Isolates From Northern Californian Dairy Cattle, 2002–2016. Front. Microbiol. 2021, 12, 601924. [Google Scholar] [CrossRef]
  11. Shahi, S.K.; Singh, V.K.; Kumar, A. Detection of Escherichia coli and associated beta-lactamases genes from diabetic foot ulcers by multiplex PCR and molecular modeling and docking of SHV-1, TEM-1, and OXA-1 beta-lactamases with clindamycin and piperacillin-tazobactam. PLoS ONE 2013, 8, e68234. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Bedenic, B.; Mestrovic, T. Mechanisms of Resistance in Gram-Negative Urinary Pathogens: From Country-Specific Molecular Insights to Global Clinical Relevance. Diagnostics 2021, 11, 800. [Google Scholar] [CrossRef] [PubMed]
  13. D’Andrea, M.M.; Arena, F.; Pallecchi, L.; Rossolini, G.M. CTX-M-type beta-lactamases: A successful story of antibiotic resistance. Int. J. Med. Microbiol. IJMM 2013, 303, 305–317. [Google Scholar] [CrossRef] [PubMed]
  14. Havelaar, A.H.; Kirk, M.D.; Torgerson, P.R.; Gibb, H.J.; Hald, T.; Lake, R.J.; Praet, N.; Bellinger, D.C.; de Silva, N.R.; Gargouri, N.; et al. World Health Organization Global Estimates and Regional Comparisons of the Burden of Foodborne Disease in 2010. PLoS Med. 2015, 12, e1001923. [Google Scholar] [CrossRef] [Green Version]
  15. Azargun, R.; Sadeghi, M.R.; Soroush Barhaghi, M.H.; Samadi Kafil, H.; Yeganeh, F.; Ahangar Oskouee, M.; Ghotaslou, R. The prevalence of plasmid-mediated quinolone resistance and ESBL-production in Enterobacteriaceae isolated from urinary tract infections. Infect. Drug Resist. 2018, 11, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
  16. Rivoarilala, O.L.; Garin, B.; Andriamahery, F.; Collard, J.M. Rapid in vitro detection of CTX-M groups 1, 2, 8, 9 resistance genes by LAMP assays. PLoS ONE 2018, 13, e0200421. [Google Scholar] [CrossRef]
  17. Osman, K.M.; Kappell, A.D.; Elhadidy, M.; ElMougy, F.; El-Ghany, W.A.A.; Orabi, A.; Mubarak, A.S.; Dawoud, T.M.; Hemeg, H.A.; Moussa, I.M.I.; et al. Poultry hatcheries as potential reservoirs for antimicrobial-resistant Escherichia coli: A risk to public health and food safety. Sci. Rep. 2018, 8, 5859. [Google Scholar] [CrossRef] [Green Version]
  18. Liu, Z.; Wang, K.; Zhang, Y.; Xia, L.; Zhao, L.; Guo, C.; Liu, X.; Qin, L.; Hao, Z. High Prevalence and Diversity Characteristics of blaNDM, mcr, and blaESBLs Harboring Multidrug-Resistant Escherichia coli From Chicken, Pig, and Cattle in China. Front. Cell Infect. Microbiol. 2021, 11, 755545. [Google Scholar] [CrossRef]
  19. Wang, Y.; Zhou, J.; Li, X.; Ma, L.; Cao, X.; Hu, W.; Zhao, L.; Jing, W.; Lan, X.; Li, Y.; et al. Genetic diversity, antimicrobial resistance and extended-spectrum beta-lactamase type of Escherichia coli isolates from chicken, dog, pig and yak in Gansu and Qinghai Provinces, China. J. Glob. Antimicrob. Resist. 2020, 22, 726–732. [Google Scholar] [CrossRef]
  20. Tong, P.; Sun, Y.; Ji, X.; Du, X.; Guo, X.; Liu, J.; Zhu, L.; Zhou, B.; Zhou, W.; Liu, G.; et al. Characterization of antimicrobial resistance and extended-spectrum beta-lactamase genes in Escherichia coli isolated from chickens. Foodborne Pathog. Dis. 2015, 12, 345–352. [Google Scholar] [CrossRef]
  21. Suzuki, Y.; Sato, T.; Fukushima, Y.; Nakajima, C.; Suzuki, Y.; Takahashi, S.; Yokota, S.I. Contribution of beta-lactamase and efflux pump overproduction to tazobactam-piperacillin resistance in clinical isolates of Escherichia coli. Int. J. Antimicrob. Agents 2020, 55, 105919. [Google Scholar] [CrossRef] [PubMed]
  22. Doi, Y.; Iovleva, A.; Bonomo, R.A. The ecology of extended-spectrum beta-lactamases (ESBLs) in the developed world. J. Travel. Med. 2017, 24, S44–S51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Li, L.; Jiang, Z.G.; Xia, L.N.; Shen, J.Z.; Dai, L.; Wang, Y.; Huang, S.Y.; Wu, C.M. Characterization of antimicrobial resistance and molecular determinants of beta-lactamase in Escherichia coli isolated from chickens in China during 1970–2007. Vet. Microbiol. 2010, 144, 505–510. [Google Scholar] [CrossRef] [PubMed]
  24. Wu, C.; Wang, Y.; Shi, X.; Wang, S.; Ren, H.; Shen, Z.; Wang, Y.; Lin, J.; Wang, S. Rapid rise of the ESBL and mcr-1 genes in Escherichia coli of chicken origin in China, 2008–2014. Emerg. Microbes Infect. 2018, 7, 30. [Google Scholar] [CrossRef] [Green Version]
  25. Canton, R.; Gonzalez-Alba, J.M.; Galan, J.C. CTX-M Enzymes: Origin and Diffusion. Front. Microbiol. 2012, 3, 110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  26. Soren, O.; Brinch, K.S.; Patel, D.; Liu, Y.; Liu, A.; Coates, A.; Hu, Y. Antimicrobial Peptide Novicidin Synergizes with Rifampin, Ceftriaxone, and Ceftazidime against Antibiotic-Resistant Enterobacteriaceae In Vitro. Antimicrob. Agents Chemother. 2015, 59, 6233–6240. [Google Scholar] [CrossRef] [Green Version]
  27. Merida-Vieyra, J.; De Colsa, A.; Calderon Castaneda, Y.; Arzate Barbosa, P.; Aquino Andrade, A. First Report of Group CTX-M-9 Extended Spectrum Beta-Lactamases in Escherichia coli Isolates from Pediatric Patients in Mexico. PLoS ONE 2016, 11, e0168608. [Google Scholar] [CrossRef] [Green Version]
  28. Cheng, M.F.; Chen, W.L.; Hung, W.Y.; Huang, I.F.; Chiou, Y.H.; Chen, Y.S.; Lee, S.S.; Hung, C.H.; Wang, J.L. Emergence of extended spectrum-beta-lactamase-producing Escherichia coli O25b-ST131: A major community-acquired uropathogen in infants. Pediatr. Infect. Dis. J. 2015, 34, 469–475. [Google Scholar] [CrossRef]
  29. Sun, Y.; Zeng, Z.; Chen, S.; Ma, J.; He, L.; Liu, Y.; Deng, Y.; Lei, T.; Zhao, J.; Liu, J.H. High prevalence of bla(CTX-M) extended-spectrum beta-lactamase genes in Escherichia coli isolates from pets and emergence of CTX-M-64 in China. Clin. Microbiol. Infect. 2010, 16, 1475–1481. [Google Scholar] [CrossRef]
  30. Nguyen, D.T.; Kanki, M.; Nguyen, P.D.; Le, H.T.; Ngo, P.T.; Tran, D.N.; Le, N.H.; Dang, C.V.; Kawai, T.; Kawahara, R.; et al. Prevalence, antibiotic resistance, and extended-spectrum and AmpC beta-lactamase productivity of Salmonella isolates from raw meat and seafood samples in Ho Chi Minh City, Vietnam. Int. J. Food Microbiol. 2016, 236, 115–122. [Google Scholar] [CrossRef]
  31. Sapugahawatte, D.N.; Li, C.; Zhu, C.; Dharmaratne, P.; Wong, K.T.; Lo, N.; Ip, M. Prevalence and Characteristics of Extended-Spectrum-beta-Lactamase-Producing and Carbapenemase-Producing Enterobacteriaceae from Freshwater Fish and Pork in Wet Markets of Hong Kong. mSphere 2020, 5, e00107-20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Zhang, C.Z.; Ding, X.M.; Lin, X.L.; Sun, R.Y.; Lu, Y.W.; Cai, R.M.; Webber, M.A.; Ding, H.Z.; Jiang, H.X. The Emergence of Chromosomally Located blaCTX-M-55 in Salmonella From Foodborne Animals in China. Front. Microbiol. 2019, 10, 1268. [Google Scholar] [CrossRef] [PubMed]
  33. Szmolka, A.; Wiener, Z.; Matulova, M.E.; Varmuzova, K.; Rychlik, I. Gene Expression Profiles of Chicken Embryo Fibroblasts in Response to Salmonella Enteritidis Infection. PLoS ONE 2015, 10, e0127708. [Google Scholar] [CrossRef] [Green Version]
  34. Nossair, M.A.; Abd El Baqy, F.A.; Rizk, M.S.Y.; Elaadli, H.; Mansour, A.M.; Abd El-Aziz, A.H.; Alkhedaide, A.; Soliman, M.M.; Ramadan, H.; Shukry, M.; et al. Prevalence and Molecular Characterization of Extended-Spectrum beta-Lactamases and AmpC beta-lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry. Pathogens 2022, 11, 852. [Google Scholar] [CrossRef]
  35. Mallik, D.; Jain, D.; Bhakta, S.; Ghosh, A.S. Role of AmpC-Inducing Genes in Modulating Other Serine Beta-Lactamases in Escherichia coli. Antibiotics 2022, 11, 67. [Google Scholar] [CrossRef]
  36. Jomehzadeh, N.; Ahmadi, K.; Rahmani, Z. Prevalence of plasmid-mediated AmpC beta-lactamases among uropathogenic Escherichia coli isolates in southwestern Iran. Osong. Public Health Res. Perspect. 2021, 12, 390–395. [Google Scholar] [CrossRef]
  37. Deccache, Y.; Irenge, L.M.; Ambroise, J.; Savov, E.; Marinescu, D.; Chirimwami, R.B.; Gala, J.L. A qPCR and multiplex pyrosequencing assay combined with automated data processing for rapid and unambiguous detection of ESBL-producers Enterobacteriaceae. AMB Express 2015, 5, 136. [Google Scholar] [CrossRef]
Animals 12 03191 g001 550
Figure 1. Antimicrobial resistance patterns in 407 E. coli isolates. First-generation cephalosporin: CZO, cefazolin. Second-generation cephalosporins: CXM, cefuroxime; FOX, cefoxitin. Third-generation cephalosporins: CRO, ceftriaxone; CAZ, ceftazidime; SCF, cefoperazone/sulbactam. Fourth-generation cephalosporin: FEP, cefepime. Other β-lactam antibiotics: ATM, aztreonam; AMC, amoxicillin/clavulanic acid; SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam.
Figure 1. Antimicrobial resistance patterns in 407 E. coli isolates. First-generation cephalosporin: CZO, cefazolin. Second-generation cephalosporins: CXM, cefuroxime; FOX, cefoxitin. Third-generation cephalosporins: CRO, ceftriaxone; CAZ, ceftazidime; SCF, cefoperazone/sulbactam. Fourth-generation cephalosporin: FEP, cefepime. Other β-lactam antibiotics: ATM, aztreonam; AMC, amoxicillin/clavulanic acid; SAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam.
Animals 12 03191 g001
Animals 12 03191 g002 550
Figure 2. Percentage of ESBL subtypes in ESBL-producing E. coli isolates from chicken feces samples (n = 262).
Figure 2. Percentage of ESBL subtypes in ESBL-producing E. coli isolates from chicken feces samples (n = 262).
Animals 12 03191 g002
Animals 12 03191 g003 550
Figure 3. Design of probes and primers for detecting blaCTX-M, blaSHV, and blaTEM genes.
Figure 3. Design of probes and primers for detecting blaCTX-M, blaSHV, and blaTEM genes.
Animals 12 03191 g003
Animals 12 03191 g004 550
Figure 4. Specificity (A) and standard curve (B) for multiple qPCR assay of blaTEM, blaCTX-M, and blaSHV genes.
Figure 4. Specificity (A) and standard curve (B) for multiple qPCR assay of blaTEM, blaCTX-M, and blaSHV genes.
Animals 12 03191 g004
Animals 12 03191 g005 550
Figure 5. Sensitivity of multiple qPCR assay and PCR for blaTEM, blaCTX-M, and blaSHV genes.
Figure 5. Sensitivity of multiple qPCR assay and PCR for blaTEM, blaCTX-M, and blaSHV genes.
Animals 12 03191 g005
Table
Table 1. Primer sequences used for detecting blaCTX-M, blaSHV, and blaTEM genes.
Table 1. Primer sequences used for detecting blaCTX-M, blaSHV, and blaTEM genes.
Primer and ProbeSequence (5′-3′)Product Size (bp)
qTEM-FCGGATGGCATGACAGTAAGA
qTEM-RGTAAGTTGGCAGCAGTGTTATC101
qTEM-PHex-TGCAGTGCTGCCATAACCATGAGT-BHQ1
qCTX-M-FCTATGGCACCACCAAYGATA
qCTX-M-RTTGAGGCTGGGTRAARTARG86
qCTX-M-PTAMRA-ACCAGAAYCAGCGGCGCACGAY-BHQ2
qSHV-FTGGATGCCGGTGACGAA
qSHV-RCAAGGTGTTTTTCGCTGACC90
qSHV-PFAM-CTGGAGCGAAAGATCCACTATCGCCA-BHQ1
TEM-FAAACGCTGGTGAAAGTA822
TEM-RAGCGATCTGTCTAT
CTX-M-1-FGGTTAAAAAATCACTGCGTC850
CTX-M-1-RTTGGTGACGATTTTAGCCGC
CTX-M-9-FATGGTGACAAAGAGAGTGCA850
CTX-M-9-RCCCTTCGGCGATGATTCTC
CTX-M-2-FCGACGCTACCCCTGCTATT552
CTX-M-2-RCCAGCGTCAGATTTTTCAGG
CTX-M-8-FTCGCGTTAAGCGGATGATGC666
CTX-M-8-RAACCCACGATGTGGGTAG
CTX-M-25-FTTGTTGAGTCAGCGGGTTGA474
CTX-M-25-RGCGCGACCTTCCGGCCAAAT
SHV-FATGCGTTATATTCGCCTGTG753
SHV-RTGCTTTGTTATTCGGGCCAA
Table
Table 2. Antimicrobial susceptibility and phenotypic identification.
Table 2. Antimicrobial susceptibility and phenotypic identification.
YearsNumberESBL Producers (%)β-Lactam Antibiotics Resistant (%)
ESBL ProducersNone-ESBL Producers
201610164 (63.37%)64/64 (100%)4/37 (10.81%)
20179658 (60.42%)58/58 (100%)4/38 (10.52%)
201811274 (66.07%)74/74 (100%)8/38 (21.05%)
20199866 (67.35%)66/66 (100%)8/32 (25%)
Total407262 (64.37%)262/262 (100%)24/145 (16.55%)
Table
Table 3. Frequency and combinations of ESBL genes among in ESBL-producing E. coli (n = 262).
Table 3. Frequency and combinations of ESBL genes among in ESBL-producing E. coli (n = 262).
Beta-Lactamase Genes in E. coli2016
(n = 64)		2017
(n = 58)		2018
(n = 74)		2019
(n = 66)		Total
(n = 262)
TEM-1 232-7
CTX-M 171318553
CTX-M-1325-10
CTX-M-152-1-3
CTX-M-55784322
CTX-M-9321-6
CTX-M-1421519
CTX-M-65--213
CTX-M+TEM 45425453194
CTX-M-1, TEM-112119537
CTX-M-3, TEM-1--123
CTX-M-15, TEM-1233513
CTX-M-15, TEM-30--112
CTX-M-55, TEM-12318272391
CTX-M-55, TEM-30214310
CTX-M-9, TEM-1133310
CTX-M-14, TEM-1444820
CTX-M-65, TEM-112238
CTX-M+SHV ---88
CTX-M-15, SHV-12---33
CTX-M-55, SHV-12---44
CTX-M-65, SHV-12---11
Table
Table 4. Pairwise comparison of blaTEM, blaCTX-M, and blaSHV detection using multiplex qPCR and PCR (n = 262).
Table 4. Pairwise comparison of blaTEM, blaCTX-M, and blaSHV detection using multiplex qPCR and PCR (n = 262).
β-Lactamase GenesPCRMultiplex qPCR
blaCTX-MblaTEMblaSHV
blaCTX-M alone535300
blaTEM alone7060
blaSHV alone0000
blaCTX-M + blaTEM1941951950
blaCTX-M + blaSHV8808
blaTEM + blaSHV0000
blaCTX-M + blaTEM + blaSHV0000
Table
Table 5. Agreement of multiplex qPCR and PCR at detecting blaTEM, blaCTX-M, and blaSHV (n = 262).
Table 5. Agreement of multiplex qPCR and PCR at detecting blaTEM, blaCTX-M, and blaSHV (n = 262).
Multiplex qPCRPCRSensitivity [IC]Specificity [IC]PPV a [IC]NPV b [IC]
CTX-MPositiveNegative
Positive2551100
[98–100]		85
[42–99]		99
[97–99]		100
Negative06
TEMPositiveNegative
Positive2010100
[98–100]		100
[94–100]		100100
Negative061
SHVPositiveNegative
Positive80100
[63–100]		100
[98–100]		100100
Negative0254
a: positive predictive value; b: negative predictive value.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, Z.; Lu, Q.; Mao, X.; Li, L.; Dou, J.; He, Q.; Shao, H.; Luo, Q. Prevalence of Extended-Spectrum β-Lactamase-Resistant Genes in Escherichia coli Isolates from Central China during 2016–2019. Animals 2022, 12, 3191. https://doi.org/10.3390/ani12223191

AMA Style

Wang Z, Lu Q, Mao X, Li L, Dou J, He Q, Shao H, Luo Q. Prevalence of Extended-Spectrum β-Lactamase-Resistant Genes in Escherichia coli Isolates from Central China during 2016–2019. Animals. 2022; 12(22):3191. https://doi.org/10.3390/ani12223191

Chicago/Turabian Style

Wang, Zui, Qin Lu, Xiaohui Mao, Li Li, Junfeng Dou, Qigai He, Huabin Shao, and Qingping Luo. 2022. "Prevalence of Extended-Spectrum β-Lactamase-Resistant Genes in Escherichia coli Isolates from Central China during 2016–2019" Animals 12, no. 22: 3191. https://doi.org/10.3390/ani12223191

APA Style

Wang, Z., Lu, Q., Mao, X., Li, L., Dou, J., He, Q., Shao, H., & Luo, Q. (2022). Prevalence of Extended-Spectrum β-Lactamase-Resistant Genes in Escherichia coli Isolates from Central China during 2016–2019. Animals, 12(22), 3191. https://doi.org/10.3390/ani12223191

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop