Reduction in Mortality of Calves with Bovine Respiratory Disease in Detection with Influenza C and D Virus
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Farm Selection, Samples, and Data Collection
2.2. RNA Extraction and cDNA Synthesis
2.3. Real-Time RT-PCR for Virus Detection
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Overton, M.W.; Dhuyvetter, K.C. Symposium Review: An Abundance of Replacement Heifers: What Is the Economic Impact of Raising More than Are Needed? J. Dairy Sci. 2020, 103, 3828–3837. [Google Scholar] [CrossRef] [PubMed]
- Dubrovsky, S.A.; Van Eenennaam, A.L.; Karle, B.M.; Rossitto, P.V.; Lehenbauer, T.W.; Aly, S.S. Bovine Respiratory Disease (BRD) Cause-Specific and Overall Mortality in Preweaned Calves on California Dairies: The BRD 10K Study. J. Dairy Sci. 2019, 102, 7320–7328. [Google Scholar] [CrossRef] [PubMed]
- Dunn, T.R.; Ollivett, T.L.; Renaud, D.L.; Leslie, K.E.; LeBlanc, S.J.; Duffield, T.F.; Kelton, D.F. The Effect of Lung Consolidation, as Determined by Ultrasonography, on First-Lactation Milk Production in Holstein Dairy Calves. J. Dairy Sci. 2018, 101, 5404–5410. [Google Scholar] [CrossRef] [Green Version]
- Overton, M.W. Economics of Respiratory Disease in Dairy Replacement Heifers. Anim. Health Res. Rev. 2020, 21, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Buczinski, S.; Achard, D.; Timsit, E. Effects of Calfhood Respiratory Disease on Health and Performance of Dairy Cattle: A Systematic Review and Meta-Analysis. J. Dairy Sci. 2021, 104, 8214–8227. [Google Scholar] [CrossRef] [PubMed]
- Murray, G.M.; More, S.J.; Sammin, D.; Casey, M.J.; McElroy, M.C.; O’Neill, R.G.; Byrne, W.J.; Earley, B.; Clegg, T.A.; Ball, H.; et al. Pathogens, Patterns of Pneumonia, and Epidemiologic Risk Factors Associated with Respiratory Disease in Recently Weaned Cattle in Ireland. J. Vet. Diagn. Invest. 2017, 29, 20–34. [Google Scholar] [CrossRef] [PubMed]
- Nissly, R.H.; Zaman, N.; Ibrahim, P.A.S.; McDaniel, K.; Lim, L.; Kiser, J.N.; Bird, I.; Chothe, S.K.; Bhushan, G.L.; Vandegrift, K.; et al. Influenza C and D Viral Load in Cattle Correlates with Bovine Respiratory Disease (BRD): Emerging Role of Orthomyxoviruses in the Pathogenesis of BRD. Virology 2020, 551, 10–15. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, V.H.S.; Dall Agnol, A.M.; Fritzen, J.T.T.; Lorenzetti, E.; Alfieri, A.A.; Alfieri, A.F. Microbial Diversity Involved in the Etiology of a Bovine Respiratory Disease Outbreak in a Dairy Calf Rearing Unit. Comp. Immunol. Microbiol. Infect. Dis. 2020, 71, 101494. [Google Scholar] [CrossRef]
- Voges, H.; Horner, G.W.; Rowe, S.; Wellenberg, G.J. Persistent Bovine Pestivirus Infection Localized in the Testes of an Immuno-Competent, Non-Viraemic Bull. Vet. Microbiol. 1998, 61, 165–175. [Google Scholar] [CrossRef]
- Kozasa, T.; Tajima, M.; Yasutomi, I.; Sano, K.; Ohashi, K.; Onuma, M. Relationship of Bovine Viral Diarrhea Virus Persistent Infection to Incidence of Diseases on Dairy Farms Based on Bulk Tank Milk Test by RT-PCR. Vet. Microbiol. 2005, 106, 41–47. [Google Scholar] [CrossRef]
- Ellis, J.A. Bovine Parainfluenza-3 Virus. Vet. Clin. N. Am. Food Anim. Pract. 2010, 26, 575–593. [Google Scholar] [CrossRef] [PubMed]
- Mitra, N.; Cernicchiaro, N.; Torres, S.; Li, F.; Hause, B.M. Metagenomic Characterization of the Virome Associated with Bovine Respiratory Disease in Feedlot Cattle Identified Novel Viruses and Suggests an Etiologic Role for Influenza D Virus. J. Gen. Virol. 2016, 97, 1771–1784. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Porter, E.; Lohman, M.; Lu, N.; Peddireddi, L.; Hanzlicek, G.; Marthaler, D.; Liu, X.; Bai, J. Influenza C Virus in Cattle with Respiratory Disease, United States, 2016-2018. Emerg. Infect. Dis. 2018, 24, 1926–1929. [Google Scholar] [CrossRef] [PubMed]
- Flynn, O.; Gallagher, C.; Mooney, J.; Irvine, C.; Ducatez, M.; Hause, B.; McGrath, G.; Ryan, E. Influenza D Virus in Cattle, Ireland. Emerg. Infect. Dis. 2018, 24, 389–391. [Google Scholar] [CrossRef] [Green Version]
- Dane, H.; Duffy, C.; Guelbenzu, M.; Hause, B.; Fee, S.; Forster, F.; McMenamy, M.J.; Lemon, K. Detection of Influenza D Virus in Bovine Respiratory Disease Samples, UK. Transbound. Emerg. Dis. 2019, 66, 2184–2187. [Google Scholar] [CrossRef] [PubMed]
- Murakami, S.; Endoh, M.; Kobayashi, T.; Takenaka-Uema, A.; Chambers, J.K.; Uchida, K.; Nishihara, M.; Hause, B.; Horimoto, T. Influenza D Virus Infection in Herd of Cattle, Japan. Emerg. Infect. Dis. 2016, 22, 1517–1519. [Google Scholar] [CrossRef] [PubMed]
- Zhai, S.-L.; Zhang, H.; Chen, S.-N.; Zhou, X.; Lin, T.; Liu, R.; Lv, D.-H.; Wen, X.-H.; Wei, W.-K.; Wang, D.; et al. Influenza D Virus in Animal Species in Guangdong Province, Southern China. Emerg. Infect. Dis. 2017, 23, 1392–1396. [Google Scholar] [CrossRef] [Green Version]
- Rice, J.A.; Carrasco-Medina, L.; Hodgins, D.C.; Shewen, P.E. Mannheimia Haemolytica and Bovine Respiratory Disease. Anim. Health Res. Rev. 2007, 8, 117–128. [Google Scholar] [CrossRef] [Green Version]
- Bureau of Biotechnology for Livestock Production, Ministry of Agriculture and Cooperatives. DLD Dairy Sire Summary 2022. Department of Livestock Development, Bangkok, Thailand; 30 April 2022. Available online: http://docimage.dld.go.th/fileroom/cabdld_bookshelf2/drawer26/general/data0000/00000088.pdf (accessed on 30 April 2022).
- Buaban, S.; Duangjinda, M.; Suzuki, M.; Masuda, Y.; Sanpote, J.; Kuchida, K. Short Communication: Genetic Analysis for Fertility Traits of Heifers and Cows from Smallholder Dairy Farms in a Tropical Environment. J. Dairy Sci. 2015, 98, 4990–4998. [Google Scholar] [CrossRef] [Green Version]
- Charoenvisal, N.; Keawcharoen, J.; Sreta, D.; Tantawet, S.; Jittimanee, S.; Arunorat, J.; Amonsin, A.; Thanawongnuwech, R. Experimental Infection with a Thai Reassortant Swine Influenza Virus of Pandemic H1N1 Origin Induced Disease. Virol. J. 2013, 10, 88. [Google Scholar] [CrossRef]
- Mahlum, C.E.; Haugerud, S.; Shivers, J.L.; Rossow, K.D.; Goyal, S.M.; Collins, J.E.; Faaberg, K.S. Detection of Bovine Viral Diarrhea Virus by TaqMan Reverse Transcription Polymerase Chain Reaction. J. Vet. Diagn. Invest. 2002, 14, 120–125. [Google Scholar] [CrossRef] [PubMed]
- Boxus, M.; Letellier, C.; Kerkhofs, P. Real Time RT-PCR for the Detection and Quantitation of Bovine Respiratory Syncytial Virus. J. Virol. Methods 2005, 125, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Elia, G.; Campolo, M.; Desario, C.; Mari, V.; Radogna, A.; Colaianni, M.L.; Cirone, F.; Tempesta, M.; Buonavoglia, C. Detection of Bovine Coronavirus Using a TaqMan-Based Real-Time RT-PCR Assay. J. Virol. Methods 2008, 151, 167–171. [Google Scholar] [CrossRef] [PubMed]
- Fulton, R.W.; Neill, J.D.; Saliki, J.T.; Landis, C.; Burge, L.J.; Payton, M.E. Genomic and Antigenic Characterization of Bovine Parainfluenza-3 Viruses in the United States Including Modified Live Virus Vaccine (MLV) Strains and Field Strains from Cattle. Virus Res. 2017, 235, 77–81. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faccini, S.; De Mattia, A.; Chiapponi, C.; Barbieri, I.; Boniotti, M.B.; Rosignoli, C.; Franzini, G.; Moreno, A.; Foni, E.; Nigrelli, A.D. Development and Evaluation of a New Real-Time RT-PCR Assay for Detection of Proposed Influenza D Virus. J. Virol. Methods 2017, 243, 31–34. [Google Scholar] [CrossRef] [PubMed]
- Antos, A.; Miroslaw, P.; Rola, J.; Polak, M.P. Vaccination Failure in Eradication and Control Programs for Bovine Viral Diarrhea Infection. Front. Vet. Sci. 2021, 8, 688911. [Google Scholar] [CrossRef]
- Nilnont, T.; Aiumlamai, S.; Kanistanont, K.; Inchaisri, C.; Kampa, J. Bovine Viral Diarrhea Virus (BVDV) Infection in Dairy Cattle Herds in Northeast Thailand. Trop. Anim. Health Prod. 2016, 48, 1201–1208. [Google Scholar] [CrossRef]
- Hou, P.; Zhao, G.; Wang, H.; He, H. Prevalence of Bovine Viral Diarrhea Virus in Dairy Cattle Herds in Eastern China. Trop. Anim. Health Prod. 2019, 51, 791–798. [Google Scholar] [CrossRef]
- Virakul, P.; Suadsong, S.; Suwimonteerabutr, J.; Singlor, J. Prevalence of infectious bovine rhinotracheitis (IBR) (bovine herpesvirus 1), bovine diarrhea virus (BDV), parainfluenza-3 (PI-3) and bovine respiratory syncytial (BRS) viruses in Thai dairy farms. Thai J. Vet. Med. 1997, 27, 295–314. [Google Scholar]
- Stokstad, M.; Loken, T. Pestivirus in Cattle: Experimentally Induced Persistent Infection in Calves. J. Vet. Med. Series B 2002, 49, 494–501. [Google Scholar] [CrossRef]
- Luo, J.; Ferguson, L.; Smith, D.R.; Woolums, A.R.; Epperson, W.B.; Wan, X.-F. Serological Evidence for High Prevalence of Influenza D Viruses in Cattle, Nebraska, United States, 2003–2004. Virology 2017, 501, 88–91. [Google Scholar] [CrossRef] [PubMed]
- Pardon, B.; De Bleecker, K.; Dewulf, J.; Callens, J.; Boyen, F.; Catry, B.; Deprez, P. Prevalence of Respiratory Pathogens in Diseased, Non-Vaccinated, Routinely Medicated Veal Calves. Vet. Rec. 2011, 169, 278. [Google Scholar] [CrossRef] [PubMed]
- Juarez Barranco, F.; Trigo Tavera, F.J.; Chavez Gris, G.; Vargas Garcia, R.E. Viral participation in respiratory disease in feedlot cattle, as identified by immunohistochemistry. Vet. Mex. 2003, 34, 1–12. [Google Scholar]
- Pratelli, A.; Lucente, M.S.; Cordisco, M.; Ciccarelli, S.; Di Fonte, R.; Sposato, A.; Mari, V.; Capozza, P.; Pellegrini, F.; Carelli, G.; et al. Natural Bovine Coronavirus Infection in a Calf Persistently Infected with Bovine Viral Diarrhea Virus: Viral Shedding, Immunological Features and S Gene Variations. Animals 2021, 11, 3350. [Google Scholar] [CrossRef]
- Zhu, Q.; Li, B.; Sun, D. Advances in Bovine Coronavirus Epidemiology. Viruses 2022, 14, 1109. [Google Scholar] [CrossRef]
- Uttenthal, A.; Jensen, N.P.; Blom, J.Y. Viral Aetiology of Enzootic Pneumonia in Danish Dairy Herds: Diagnostic Tools and Epidemiology. Vet. Rec. 1996, 139, 114–117. [Google Scholar] [CrossRef]
- Fulton, R.W.; Step, D.L.; Wahrmund, J.; Burge, L.J.; Payton, M.E.; Cook, B.J.; Burken, D.; Richards, C.J.; Confer, A.W. Bovine Coronavirus (BCV) Infections in Transported Commingled Beef Cattle and Sole-Source Ranch Calves. Can. J. Vet. Res. 2011, 75, 191–199. [Google Scholar]
- Collin, E.A.; Sheng, Z.; Lang, Y.; Ma, W.; Hause, B.M.; Li, F. Cocirculation of Two Distinct Genetic and Antigenic Lineages of Proposed Influenza D Virus in Cattle. J. Virol. 2015, 89, 1036–1042. [Google Scholar] [CrossRef] [Green Version]
- Ferguson, L.; Eckard, L.; Epperson, W.B.; Long, L.-P.; Smith, D.; Huston, C.; Genova, S.; Webby, R.; Wan, X.-F. Influenza D Virus Infection in Mississippi Beef Cattle. Virology 2015, 486, 28–34. [Google Scholar] [CrossRef] [Green Version]
- Ducatez, M.F.; Pelletier, C.; Meyer, G. Influenza D Virus in Cattle, France, 2011–2014. Emerg. Infect. Dis. 2015, 21, 368. [Google Scholar] [CrossRef]
- Chiapponi, C.; Faccini, S.; De Mattia, A.; Baioni, L.; Barbieri, I.; Rosignoli, C.; Nigrelli, A.; Foni, E. Detection of Influenza D Virus among Swine and Cattle, Italy. Emerg. Infect. Dis. 2016, 22, 352–354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bell, R.L.; Turkington, H.L.; Cosby, S.L. The Bacterial and Viral Agents of BRDC: Immune Evasion and Vaccine Developments. Vaccines 2021, 9, 337. [Google Scholar] [CrossRef] [PubMed]
- Park, S.J.; Kim, G.Y.; Choy, H.E.; Hong, Y.J.; Saif, L.J.; Jeong, J.H.; Park, S.I.; Kim, H.H.; Kim, S.K.; Shin, S.S.; et al. Dual Enteric and Respiratory Tropisms of Winter Dysentery Bovine Coronavirus in Calves. Arch. Virol. 2007, 152, 1885–1900. [Google Scholar] [CrossRef] [PubMed]
- Blakebrough-Hall, C.; McMeniman, J.P.; González, L.A. An Evaluation of the Economic Effects of Bovine Respiratory Disease on Animal Performance, Carcass Traits, and Economic Outcomes in Feedlot Cattle Defined Using Four BRD Diagnosis Methods. J. Anim. Sci. 2020, 98, skaa005. [Google Scholar] [CrossRef] [PubMed]
- Snowder, G.D.; Van Vleck, L.D.; Cundiff, L.V.; Bennett, G.L. Bovine Respiratory Disease in Feedlot Cattle: Environmental, Genetic, and Economic Factors. J. Anim. Sci. 2006, 84, 1999–2008. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wisnieski, L.C.; Amrine, D.E.; Cernicchiaro, N.; Sanderson, M.W.; Renter, D.G. Weather Conditions Associated with Death Attributed to Bovine Respiratory Disease Complex in High-Risk Auction Market-Sourced Male Beef Calves. Am. J. Vet. Res. 2021, 82, 644–652. [Google Scholar] [CrossRef]
- Fahy, J.V.; Dickey, B.F. Airway Mucus Function and Dysfunction. N. Engl. J. Med. 2010, 363, 2233–2247. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Wang, Y.; Chang, Y.; Luo, H.; Brito, L.F.; Dong, Y.; Shi, R.; Wang, Y.; Dong, G.; Liu, L. Mortality-Culling Rates of Dairy Calves and Replacement Heifers and Its Risk Factors in Holstein Cattle. Animals 2019, 9, E730. [Google Scholar] [CrossRef] [Green Version]
- Brickell, J.S.; McGowan, M.M.; Pfeiffer, D.U.; Wathes, D.C. Mortality in Holstein-Friesian Calves and Replacement Heifers, in Relation to Body Weight and IGF-I Concentration, on 19 Farms in England. Animals 2009, 3, 1175–1182. [Google Scholar] [CrossRef] [Green Version]
- Skelton, R.M.; Shepardson, K.M.; Hatton, A.; Wilson, P.T.; Sreenivasan, C.; Yu, J.; Wang, D.; Huber, V.C.; Rynda-Apple, A. Contribution of Host Immune Responses Against Influenza D Virus Infection Toward Secondary Bacterial Infection in a Mouse Model. Viruses 2019, 11, E994. [Google Scholar] [CrossRef] [Green Version]
- Robinson, E.; Shepardson, K.M.; Skelton, R.M.; Hernandez, E.; Huber, V.C.; Rynda-Apple, A. Active Influenza D Coinfection Reduces Influenza A Disease Severity in Mice. J. Immunol. 2021, 206, 20. [Google Scholar]
- Eastham, N.T.; Coates, A.; Cripps, P.; Richardson, H.; Smith, R.; Oikonomou, G. Associations between Age at First Calving and Subsequent Lactation Performance in UK Holstein and Holstein-Friesian Dairy Cows. PLoS ONE 2018, 13, e0197764. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Steele, M. Age at First Calving in Dairy Cows: Which Months Do You Aim for to Maximise Productivity? Vet. Evid. 2020, 5, 2–22. [Google Scholar] [CrossRef] [Green Version]
- Cheng, Z.; Brown, L.E.; Wathes, D.C. Bovine Viral Diarrhoea Virus Infection Disrupts Uterine Interferon Stimulated Gene Regulatory Pathways During Pregnancy Recognition in Cows. Viruses 2019, 12, E1. [Google Scholar] [CrossRef]
- Rypuła, K.; Płoneczka-Janeczko, K.; Czopowicz, M.; Klimowicz-Bodys, M.D.; Shabunin, S.; Siegwalt, G. Occurrence of BVDV Infection and the Presence of Potential Risk Factors in Dairy Cattle Herds in Poland. Animals 2020, 10, E230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arnaiz, I.; Cerviño, M.; Martínez, S.; Fouz, R.; Diéguez, F.J. Bovine Viral Diarrhea Virus (BVDV) Infection: Effect on Reproductive Performance and Milk Yield in Dairy Herds. Vet. J. 2021, 277, 105747. [Google Scholar] [CrossRef]
Type | Gene Fragment | Primer | Sequence (5′ to 3′) | Ref. |
---|---|---|---|---|
1 BVDV | Matrix | BVDV-F BVDV-R | GGGNAGTCGTCARTGGTTCG GTGCCATGTACAGCAGAGWTTTT | [22] |
2 BRSV | N gene | BRSV-F BRSV-R | GCAATGCTGCAGGACTAGGTATAAT ACACTGTAATTGATGACCCCATTCT | [23] |
3 BCoV | Matrix | BCoV-F BCoV-R | CTGGAAGTTGGTGGAGTT ATTATCGGCCTAACATACATC | [24] |
4 BPIV-3 | P gene | PI3-F PI3-R | AGAGCACTCRATTTACAGARAGG GTATCYGCATTGTTNAGGACATT | [25] |
5 ICV | Matrix | ICV-F ICV-R | TCGGCAGATGGGAGAGATG GAATTGGTGAGTTGTCGGTTTC | [13] |
6 IDV | PB1 gene | IDV-F IDV-R | TGGATGGAGAGTGCTGCTTC GCCAATGCTTCCTCCCTGTA | [26] |
Fever | Diarrhoea | Mucous | ||||
---|---|---|---|---|---|---|
Yes | No | Yes | No | Yes | No | |
1 Viral Disease | (n = 12) | (n = 140) | (n = 84) | (n = 68) | (n = 103) | (n = 49) |
BVDV (n = 109) | 8.3 | 6.0 | 64.2 ** | 32.6 ** | 72.5 * | 55.8 * |
BRSV (n = 80) | 6.3 | 9.7 | 53.8 | 56.9 | 67.5 | 68.1 |
BCoV (n = 62) | 4.8 | 10.0 | 80.7 ** | 37.8 ** | 75.8 | 62.2 |
BPIV-3 (n = 16) | 6.3 | 8.1 | 50.0 | 55.9 | 68.8 | 67.7 |
ICV (n = 104) | 5.8 | 12.5 | 58.7 | 47.9 | 69.2 | 65.6 |
IDV (n = 100) | 7.0 | 9.6 | 59.0 | 48.1 | 71.0 | 61.5 |
BRSV | BCoV | BPIV-3 | ICV | IDV | ||||||
---|---|---|---|---|---|---|---|---|---|---|
Yes | No | Yes | No | Yes | No | Yes | No | Yes | No | |
BVDV | 73.8 | 69.4 | 79.0 * | 66.7 * | 75.0 | 71.3 | 70.2 | 75.0 | 70.0 | 75.0 |
BRSV | - | 58.1 | 48.9 | 56.3 | 52.2 | 53.9 | 50.0 | 50.0 | 54.0 | |
BCoV | - | - | 37.5 | 41.2 | 43.3 | 35.4 | 46.0 * | 30.8 * | ||
BPIV-3 | - | - | - | 11.5 | 8.3 | 9.0 | 13.5 | |||
ICV | - | - | - | - | 93.0 ** | 21.2 ** |
Odds Ratio | 95% CI of Odds Ratio | Chi-Square | p | |||||
---|---|---|---|---|---|---|---|---|
Parameter | Level | Estimate | SEM | Lower | Upper | |||
Secretion | Mucous | 1.45 | 0.73 | 4.27 | 1.03 | 17.79 | 3.98 | 0.05 |
Serous | -------------------------------Reference------------------------------ | |||||||
Detection of IDV | Yes | −1.66 | 0.60 | 0.19 | 0.06 | 0.61 | 7.75 | 0.01 |
No | -------------------------------Reference------------------------------ | |||||||
Age at sick | ≤ 6 months | 2.71 | 0.70 | 14.96 | 3.79 | 59.05 | 14.91 | >0.01 |
7–12 months | -------------------------------Reference------------------------------ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saipinta, D.; Panyamongkol, T.; Chuammitri, P.; Suriyasathaporn, W. Reduction in Mortality of Calves with Bovine Respiratory Disease in Detection with Influenza C and D Virus. Animals 2022, 12, 3252. https://doi.org/10.3390/ani12233252
Saipinta D, Panyamongkol T, Chuammitri P, Suriyasathaporn W. Reduction in Mortality of Calves with Bovine Respiratory Disease in Detection with Influenza C and D Virus. Animals. 2022; 12(23):3252. https://doi.org/10.3390/ani12233252
Chicago/Turabian StyleSaipinta, Duanghathai, Tanittian Panyamongkol, Phongsakorn Chuammitri, and Witaya Suriyasathaporn. 2022. "Reduction in Mortality of Calves with Bovine Respiratory Disease in Detection with Influenza C and D Virus" Animals 12, no. 23: 3252. https://doi.org/10.3390/ani12233252