MicroRNA Expression Variation in Female Dog (Canis familiaris) Reproductive Organs with Age and Presence of Uteropathy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Tissue Samples
2.2. RNA Isolation and Quality Check of RNA and cDNA Synthesis
2.3. Gene MicoRNA Hybridization, Scanning, and Data Processing
2.4. Real-Time PCR Quantification
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lopez-Otin, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. The hallmarks of aging. Cell 2013, 153, 1194–1217. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bushati, N.; Cohen, S.M. microRNA functions. Annu. Rev. Cell Dev. Biol. 2007, 23, 175–205. [Google Scholar] [CrossRef] [PubMed]
- Garzon, R.; Calin, G.A.; Croce, C.M. MicroRNAs in Cancer. Annu. Rev. Med. 2009, 60, 167–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bates, D.J.; Liang, R.; Li, N.; Wang, E. The impact of noncoding RNA on the biochemical and molecular mechanisms of aging. Biochim. Biophys. Acta 2009, 1790, 970–979. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, J.; Hayder, H.; Zayed, Y.; Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. (Lausanne) 2018, 9, 402. [Google Scholar] [CrossRef] [Green Version]
- Khanna, A.; Muthusamy, S.; Liang, R.; Sarojini, H.; Wang, E. Gain of survival signaling by down-regulation of three key miRNAs in brain of calorie-restricted mice. Aging 2011, 3, 223–236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hunter, M.P.; Ismail, N.; Zhang, X.; Aguda, B.D.; Lee, E.J.; Yu, L.; Xiao, T.; Schafer, J.; Lee, M.L.; Schmittgen, T.D.; et al. Detection of microRNA expression in human peripheral blood microvesicles. PLoS ONE 2008, 3, e3694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Noren Hooten, N.; Fitzpatrick, M.; Wood, W.H., 3rd; De, S.; Ejiogu, N.; Zhang, Y.; Mattison, J.A.; Becker, K.G.; Zonderman, A.B.; Evans, M.K. Age-related changes in microRNA levels in serum. Aging 2013, 5, 725–740. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.; Collins, D.; Creevy, K.E.; Promislow, D.E.L.; Dog Aging Project, C. Age and Physical Activity Levels in Companion Dogs: Results from the Dog Aging Project. J. Gerontol. A Biol. Sci. Med. Sci. 2022, 77, 1986–1993. [Google Scholar] [CrossRef]
- Hoffman, J.M.; O’Neill, D.G.; Creevy, K.E.; Austad, S.N. Do Female Dogs Age Differently Than Male Dogs? J. Gerontol. A Biol. Sci. Med. Sci. 2018, 73, 150–156. [Google Scholar] [CrossRef]
- Egenvall, A.; Hagman, R.; Bonnett, B.N.; Hedhammar, A.; Olson, P.; Lagerstedt, A.S. Breed risk of pyometra in insured dogs in Sweden. J. Vet. Intern. Med. 2001, 15, 530–538. [Google Scholar] [CrossRef]
- Hagman, R. Molecular aspects of uterine diseases in dogs. Reprod. Domest. Anim. 2017, 52 (Suppl. S3), 37–42. [Google Scholar] [CrossRef] [Green Version]
- Hagman, R. Pyometra in Small Animals 2.0. Vet. Clin. N. Am. Small Anim. Pract. 2022, 52, 631–657. [Google Scholar] [CrossRef] [PubMed]
- Wira, C.R.; Grant-Tschudy, K.S.; Crane-Godreau, M.A. Epithelial cells in the female reproductive tract: A central role as sentinels of immune protection. Am. J. Reprod. Immunol. 2005, 53, 65–76. [Google Scholar] [CrossRef]
- Yan, C.; Lv, H.; Peng, Z.; Yang, D.; Shen, P.; Yu, J.; Tong, C.; Wang, X. Analysis of miRNA expression changes in bovine endometrial stromal cells treated with lipopolysaccharide. Theriogenology 2021, 167, 85–93. [Google Scholar] [CrossRef]
- Liu, F.; Li, Y.; Jiang, R.; Nie, C.; Zeng, Z.; Zhao, N.; Huang, C.; Shao, Q.; Ding, C.; Qing, C.; et al. miR-132 inhibits lipopolysaccharide-induced inflammation in alveolar macrophages by the cholinergic anti-inflammatory pathway. Exp. Lung Res. 2015, 41, 261–269. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.P.; Luoreng, Z.M.; Zan, L.S.; Raza, S.H.; Li, F.; Li, N.; Liu, S. Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle. Mol. Cell Probes 2016, 30, 342–344. [Google Scholar] [CrossRef]
- Hailemariam, D.; Ibrahim, S.; Hoelker, M.; Drillich, M.; Heuwieser, W.; Looft, C.; Cinar, M.U.; Tholen, E.; Schellander, K.; Tesfaye, D. MicroRNA-regulated molecular mechanism underlying bovine subclinical endometritis. Reprod. Fertil. Dev. 2014, 26, 898–913. [Google Scholar] [CrossRef] [Green Version]
- Ro, W.B.; Kang, M.H.; Song, D.W.; Lee, S.H.; Park, H.M. Expression Profile of Circulating MicroRNAs in Dogs With Cardiac Hypertrophy: A Pilot Study. Front. Vet. Sci. 2021, 8, 652224. [Google Scholar] [CrossRef] [PubMed]
- Vansteenkiste, D.P.; Fenger, J.M.; Fadda, P.; Martin-Vaquero, P.; da Costa, R.C. MicroRNA expression in the cerebrospinal fluid of dogs with and without cervical spondylomyelopathy. J. Vet. Intern. Med. 2019, 33, 2685–2692. [Google Scholar] [CrossRef]
- McCulloch, K.; Litherland, G.J.; Rai, T.S. Cellular senescence in osteoarthritis pathology. Aging Cell 2017, 16, 210–218. [Google Scholar] [CrossRef] [PubMed]
- Ran, Y.; Hossain, F.; Pannuti, A.; Lessard, C.B.; Ladd, G.Z.; Jung, J.I.; Minter, L.M.; Osborne, B.A.; Miele, L.; Golde, T.E. gamma-Secretase inhibitors in cancer clinical trials are pharmacologically and functionally distinct. EMBO Mol. Med. 2017, 9, 950–966. [Google Scholar] [CrossRef]
- Hu, W.; Liu, T.; Ivan, C.; Sun, Y.; Huang, J.; Mangala, L.S.; Miyake, T.; Dalton, H.J.; Pradeep, S.; Rupaimoole, R.; et al. Notch3 pathway alterations in ovarian cancer. Cancer Res. 2014, 74, 3282–3293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fischer, S.; Mathias, S.; Schaz, S.; Emmerling, V.V.; Buck, T.; Kleemann, M.; Hackl, M.; Grillari, J.; Aschrafi, A.; Handrick, R.; et al. Enhanced protein production by microRNA-30 family in CHO cells is mediated by the modulation of the ubiquitin pathway. J. Biotechnol. 2015, 212, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Lange-Consiglio, A.; Perrini, C.; Albini, G.; Modina, S.; Lodde, V.; Orsini, E.; Esposti, P.; Cremonesi, F. Oviductal microvesicles and their effect on in vitro maturation of canine oocytes. Reproduction 2017, 154, 167–180. [Google Scholar] [CrossRef] [PubMed]
- Hamrick, M.W.; Herberg, S.; Arounleut, P.; He, H.Z.; Shiver, A.; Qi, R.Q.; Zhou, L.; Isales, C.M.; Mi, Q.S. The adipokine leptin increases skeletal muscle mass and significantly alters skeletal muscle miRNA expression profile in aged mice. Biochem. Biophys. Res. Commun. 2010, 400, 379–383. [Google Scholar] [CrossRef] [Green Version]
- Mackenzie, N.C.; Staines, K.A.; Zhu, D.; Genever, P.; Macrae, V.E. miRNA-221 and miRNA-222 synergistically function to promote vascular calcification. Cell Biochem. Funct. 2014, 32, 209–216. [Google Scholar] [CrossRef]
- Chawla, G.; Deosthale, P.; Childress, S.; Wu, Y.C.; Sokol, N.S. A let-7-to-miR-125 MicroRNA Switch Regulates Neuronal Integrity and Lifespan in Drosophila. PLoS Genet. 2016, 12, e1006247. [Google Scholar] [CrossRef] [Green Version]
- Drummond, M.J.; McCarthy, J.J.; Sinha, M.; Spratt, H.M.; Volpi, E.; Esser, K.A.; Rasmussen, B.B. Aging and microRNA expression in human skeletal muscle: A microarray and bioinformatics analysis. Physiol. Genom. 2011, 43, 595–603. [Google Scholar] [CrossRef] [Green Version]
- Zhao, G.; Zhang, T.; Wu, H.; Jiang, K.; Qiu, C.; Deng, G. MicroRNA let-7c Improves LPS-Induced Outcomes of Endometritis by Suppressing NF-kappaB Signaling. Inflammation 2019, 42, 650–657. [Google Scholar] [CrossRef]
- Jiang, R.; Li, Y.; Zhang, A.; Wang, B.; Xu, Y.; Xu, W.; Zhao, Y.; Luo, F.; Liu, Q. The acquisition of cancer stem cell-like properties and neoplastic transformation of human keratinocytes induced by arsenite involves epigenetic silencing of let-7c via Ras/NF-kappaB. Toxicol. Lett 2014, 227, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Toms, D.; Pan, B.; Li, J. Endocrine Regulation in the Ovary by MicroRNA during the Estrous Cycle. Front. Endocrinol. 2017, 8, 378. [Google Scholar] [CrossRef] [PubMed]
MicroRNA | Ortholog of Target Gene | Gene Name | Ori | Primer Sequence | Accession No. |
---|---|---|---|---|---|
cfa-miR-151 | APH1A | APH1A gamma secretase subunit | F | cctactacaagctgcttaag | XM_038423042.1 |
R | gataacagagaagacaccac | ||||
cfa-miR-708 | MRPS35 | mitochondrial ribosomal protein S35 | F | gcacgagtagtaaccttaag | NM_001284487.1 |
R | ctgtctgttgtgatggtaag | ||||
SLC37A4 | solute carrier family 37 (glucose-6-phosphate transporter), member 4 | F | gttgtctccttcctctgt | NM_001287131.2 | |
R | gtaatgtactctcgtccttc | ||||
cfa-miR-30d | LHX8 | LIM homeobox 8 | F | cacatccattctactgactg | XM_038670394.1 |
R | tctgcagaggactttctc | ||||
CYP24A1 | cytochrome P450, family 24, subfamily A, polypeptide 1 | F | gtatactgctggcttacttg | XM_038434121.1 | |
R | ggacaggtacatttagtgac | ||||
cfa-miR-140 | SIGMAR1 | sigma naon-opioid intracellular receptor 1 | F | cagactcacataccacaag | XM_038681024.1 |
R | ccagacagagtataataccc | ||||
HELLS | helicase, lymphoid-specific | F | gagaaagaagagaggaagag | XM_038439975.1 | |
R | cacagagattagaagaggag | ||||
cfa-miR-23a | SESN3 | sestrin 3 | F | ctgtgtttccctactgtatc | XM_038429728.1 |
R | ctgttgactgagaggaatac | ||||
AUH | AU RNA binding methylglutaconyl-CoA hydratase | F | gatatacgtgtagcagcttc | XM_038655406.1 | |
R | gtgcagagaagatgagct | ||||
cfa-miR-10a | PATL1 | PAT1 homolog 1, processing body mRNA decay factor | F | cttcctaccttctgtgttac | XM_038424237.1 |
R | ctacggtctactctgaactg | ||||
ZNF367 | zinc finger protein 367 | F | cataggctgctattctgtag | XM_038654936.1 | |
R | ctgtactagaagtcccgtat | ||||
cfa-miR-26a | ARPP19 | cAMP-regulated phosphoprotein, 19kDa | F | ttggatccaggcatcttttc | XM_038442363.1 |
R | gtgggtggagcaggaagata | ||||
STRADB | STE20-related kinase adaptor beta | F | ggacatgcacaggactcaga | XM_038447612.1 | |
R | tcgggaattcttcattctgg | ||||
cfa-miR-125b | EIF1AD | eukaryotic translation initiation factor 1A domain containing | F | ggctgagatctcctttgtgc | XM_038424930.1 |
R | tcctgatgactgtggctctg |
Variables (Mean ± SEM) | Healthy Dogs below 1 year (n = 6) | Healthy Dogs above 3 year (n = 6) | Uteropathy (n = 6) | Reference Value |
Age, months | 8.5 ± 1.9 | 78.2 ± 29.0 | 104.4 ± 15.1 | |
Breed | mixed, shiba inu, pomeranian, maltese, poodle | poodle, bichon frise, shih tzu, chihuahua, maltese | mixed, shih tzu, spitz, yorkshire terrier | |
Total protein | 6.2 ± 0.3 | 6.1 ± 0.2 | 7.1 ± 0.4 | 5~7.2 (g/dL) |
Glucose | 116.3 ± 5.9 | 109.3 ± 2.3 | 115.0 ± 14.1 | 75~128 (mg/dL) |
BUN | 19.9 ± 1.2 | 20.5 ± 2.9 | 24.1 ± 14.8 | 9.2~29.2 (mg/dL) |
Creatine | 0.6 ± 0.1 | 0.6 ± 0.1 | 0.7 ± 0.3 | 0.4~1.4 (mg/dL) |
WBC | 10.3 ± 0.8 | 10.6 ± 0.5 | 12.1 ± 4.2 | 5~20 (109/L) |
RBC | 7.0 ± 0.2 | 7.1 ± 0.2 | 7.2 ± 0.8 | 5.5~8.5 (1012/L) |
HCT | 47.6 ± 1.0 | 48.8 ± 1.7 | 48.3 ± 6.7 | 35~56 (%) |
Platelet | 277.3 ± 36.7 | 348.5 ± 36.8 | 324.7 ± 195.8 | 100~500 (109/L) |
ALKP | 198.3 ± 24.0 | 176.0 ± 9.3 | 359.5 ± 211.8 | 47~254 (U/L) |
ALT | 52.2 ± 5.8 | 62.3 ± 6.7 | 46.8 ± 48.9 | 17~78 (U/L) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, E.P.; Kim, C.Y.; Heo, M.Y.; Kim, S.W.; Kim, G.A. MicroRNA Expression Variation in Female Dog (Canis familiaris) Reproductive Organs with Age and Presence of Uteropathy. Animals 2022, 12, 3352. https://doi.org/10.3390/ani12233352
Kim EP, Kim CY, Heo MY, Kim SW, Kim GA. MicroRNA Expression Variation in Female Dog (Canis familiaris) Reproductive Organs with Age and Presence of Uteropathy. Animals. 2022; 12(23):3352. https://doi.org/10.3390/ani12233352
Chicago/Turabian StyleKim, Eun Pyo, Chae Young Kim, Min Young Heo, Sang Wha Kim, and Geon A. Kim. 2022. "MicroRNA Expression Variation in Female Dog (Canis familiaris) Reproductive Organs with Age and Presence of Uteropathy" Animals 12, no. 23: 3352. https://doi.org/10.3390/ani12233352
APA StyleKim, E. P., Kim, C. Y., Heo, M. Y., Kim, S. W., & Kim, G. A. (2022). MicroRNA Expression Variation in Female Dog (Canis familiaris) Reproductive Organs with Age and Presence of Uteropathy. Animals, 12(23), 3352. https://doi.org/10.3390/ani12233352