Nervous Necrosis Virus (NNV) Booster Vaccination Increases Senegalese Sole Survival and Enhances Immunoprotection
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Viral Strain and Propagation
2.2. Vaccine Preparation
2.3. Fish Vaccination
2.4. NNV Challenge
2.5. Fish Sampling
2.6. Specific and Neutralizing Antibody Levels
2.7. Gene Expression by Real-Time Polymerase Chain Reaction
2.8. Viral Quantification
2.9. Calculations and Statistics
3. Results
3.1. Antibody Production after Prime- and Booster-Vaccination
3.2. Expression of Immune Genes in Vaccinated Fish
3.3. Efficacy Protection of Prime- and Booster-Vaccination
3.4. Progression of the Viral Load in the Vaccinated and Re-Immunized Fish after Challenge
3.5. Antibody Response in Challenged Fish
3.6. Immune Gene Expression after Challenge
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bandín, I.; Souto, S. Betanodavirus and VER Disease: A 30-year. Pathogens 2020, 9, 106. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Olveira, J.G.; Souto, S.; Dopazo, C.P.; Thiéry, R.; Barja, J.L.; Bandín, I. Comparative analysis of both genomic segments of betanodaviruses isolated from epizootic outbreaks in farmed fish species provides evidence for genetic reassortment. J. Gen. Virol. 2009, 90, 2940–2951. [Google Scholar] [CrossRef]
- Toffan, A.; Pascoli, F.; Pretto, T.; Panzarin, V.; Abbadi, M.; Buratin, A.; Quartesan, R.; Gijon, D.; Padros, F. Viral nervous necrosis in gilthead sea bream (Sparus aurata) caused by reassortant betanodavirus RGNNV/SJNNV: An emerging threat for Mediterranean aquaculture. Sci. Rep. 2017, 7, 46755. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Volpe, E.; Gustinelli, A.; Caffara, M.; Errani, F.; Quaglio, F.; Fioravanti, M.L.; Ciulli, S. Viral nervous necrosis outbreaks caused by the RGNNV/SJNNV reassortant betanodavirus in gilthead sea bream (Sparus aurata) and European sea bass (Dicentrarchus labrax). Aquaculture 2020, 523, 735155. [Google Scholar] [CrossRef]
- Vázquez-Salgado, L.; Olveira, J.G.; Dopazo, C.P.; Bandín, I. Interspecies transmission between Solea senegalensis and Sparus aurata of reassortant Nervous Necrosis Virus (NNV) strains and effect of stress on the outcome of the infection. Aquaculture 2022, 547, 737519. [Google Scholar] [CrossRef]
- Le Breton, A.; Grisez, L.; Sweetman, J.; Ollevier, F. Viral nervous necrosis (VNN) associated with mass mortalities in cage-reared sea bass, Dicentrarchus labrax (L.). J. Fish Dis. 1997, 20, 145–151. [Google Scholar] [CrossRef]
- Haddad-Boubaker, S.; Bigarré, L.; Bouzgarou, N.; Megdich, A.; Baud, M.; Cabon, J.; Chéhida, N. Ben Molecular epidemiology of betanodaviruses isolated from sea bass and sea bream cultured along the Tunisian coasts. Virus Genes 2013, 46, 412–422. [Google Scholar] [CrossRef]
- Boukedjouta, R.; Pretto, T.; Abbadi, M.; Biasini, L.; Toffan, A.; Mezali, K. Viral encephalopathy and retinopathy is endemic in wild groupers (genus Epinephelus spp.) of the Algerian coast. J. Fish Dis. 2020, 43, 801–812. [Google Scholar] [CrossRef]
- Thwaite, R.; Li, A.; Kawasaki, M.; Lin, C.H.; Stephens, F.; Cherrie, B.; Knuckey, R.; Landos, M.; Barnes, A.C. Longitudinal field survey during deployment of an emergency autogenous vaccine against Betanodavirus in farmed giant grouper (Epinephelus lanceolatus): Multiple factors contribute to outbreaks and survival. Aquaculture 2022, 548, 737599. [Google Scholar] [CrossRef]
- Costa, J.Z.; Thompson, K.D. Understanding the interaction between Betanodavirus and its host for the development of prophylactic measures for viral encephalopathy and retinopathy. Fish Shellfish Immunol. 2016, 53, 35–49. [Google Scholar] [CrossRef]
- Vázquez-Salgado, L.; Olveira, J.G.; Dopazo, C.P.; Bandín, I. Role of rotifer (Brachionus plicatilis) and Artemia (Artemia salina) nauplii in the horizontal transmission of a natural nervous necrosis virus (NNV) reassortant strain to Senegalese sole (Solea senegalensis) larvae. Vet. Q. 2020, 40, 205–214. [Google Scholar] [CrossRef] [PubMed]
- Kai, Y.H.; Chi, S.C. Efficacies of inactivated vaccines against betanodavirus in grouper larvae (Epinephelus coioides) by bath immunization. Vaccine 2008, 26, 1450–1457. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, H.; Fujita, Y.; Kawakami, H.; Nakai, T. The Efficacy of Inactivated Virus Vaccine against Viral Nervous Necrosis (VNN). Fish Pathol. 2005, 40, 15–21. [Google Scholar] [CrossRef] [Green Version]
- Yamashita, H.; Mori, K.; Nakai, T. Protection conferred against viral nervous necrosis by simultaneous inoculation of aquabirnavirus and inactivated betanodavirus in the sevenband grouper, Epinephelus septemfasciatus (Thunberg). J. Fish Dis. 2009, 32, 201–210. [Google Scholar] [CrossRef]
- Pakingking, R.; Seron, R.; Dela Peña, L.; Mori, K.; Yamashita, H.; Nakai, T. Immune responses of Asian sea bass, Lates calcarifer Bloch, against an inactivated betanodavirus vaccine. J. Fish Dis. 2009, 32, 457–463. [Google Scholar] [CrossRef]
- Pakingking, R.; Bautista, N.B.; de Jesus-Ayson, E.G.; Reyes, O. Protective immunity against viral nervous necrosis (VNN) in brown-marbled grouper (Epinephelus fuscogutattus) following vaccination with inactivated betanodavirus. Fish Shellfish Immunol. 2010, 28, 525–533. [Google Scholar] [CrossRef]
- Kai, Y.-H.H.; Wu, Y.-C.C.; Chi, S.-C.C. Immune gene expressions in grouper larvae (Epinephelus coioides) induced by bath and oral vaccinations with inactivated betanodavirus. Fish Shellfish Immunol. 2014, 40, 563–569. [Google Scholar] [CrossRef]
- Valero, Y.; Mokrani, D.; Chaves-Pozo, E.; Arizcun, M.; Oumouna, M.; Meseguer, J.; Esteban, M.Á.; Cuesta, A. Vaccination with UV-inactivated nodavirus partly protects European sea bass against infection, while inducing few changes in immunity. Dev. Comp. Immunol. 2018, 86, 171–179. [Google Scholar] [CrossRef]
- Húsgaro, S.; Grotmol, S.; Hjeltnes, B.K.; Rødseth, O.M.; Biering, E. Immune response to a recombinant capsid protein of striped jack nervous necrosis virus (SJNNV) in turbot Scophthalmus maximus and Atlantic halibut Hippoglossus hippoglossus, and evaluation of a vaccine against SJNNV. Dis. Aquat. Organ. 2001, 45, 33–44. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, S.; Mori, K.; Arimoto, M.; Iwamoto, T.; Nakai, T. Protective immunity of sevenband grouper, Epinephelus septemfasciatus Thunberg, against experimental viral nervous necrosis. J. Fish Dis. 2001, 24, 15–22. [Google Scholar] [CrossRef]
- Lin, C.-C.C.; Lin, J.H.-Y.Y.; Chen, M.-S.S.; Yang, H.-L.L. An oral nervous necrosis virus vaccine that induces protective immunity in larvae of grouper (Epinephelus coioides). Aquaculture 2007, 268, 265–273. [Google Scholar] [CrossRef]
- Lin, C.-F.F.; Jiang, H.-K.K.; Chen, N.-C.C.; Wang, T.-Y.Y.; Chen, T.-Y.Y. Novel subunit vaccine with linear array epitope protect giant grouper against nervous necrosis virus infection. Fish Shellfish Immunol. 2018, 74, 551–558. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.M.; Shih, C.H.; Liu, H.C.; Wu, C.L.; Lin, C.C.; Wang, H.C.; Chen, T.Y.; Yang, H.L.; Lin, J.H.Y. An oral nervous necrosis virus vaccine using Vibrio anguillarum as an expression host provides early protection. Aquaculture 2011, 321, 26–33. [Google Scholar] [CrossRef]
- Gonzalez-Silvera, D.; Guardiola, F.A.; Espinosa, C.; Chaves-Pozo, E.; Esteban, M.Á.; Cuesta, A. Recombinant nodavirus vaccine produced in bacteria and administered without purification elicits humoral immunity and protects European sea bass against infection. Fish Shellfish Immunol. 2019, 88, 458–463. [Google Scholar] [CrossRef] [PubMed]
- Chien, M.-H.H.; Wu, S.-Y.Y.; Lin, C.-H.H. Oral immunization with cell-free self-assembly virus-like particles against orange-spotted grouper nervous necrosis virus in grouper larvae, Epinephelus coioides. Vet. Immunol. Immunopathol. 2018, 197, 69–75. [Google Scholar] [CrossRef]
- Chen, S.P.; Peng, R.H.; Chiou, P.P. Modulatory effect of CpG oligodeoxynucleotide on a DNA vaccine against nervous necrosis virus in orange-spotted grouper (Epinephelus coioides). Fish Shellfish Immunol. 2015, 45, 919–926. [Google Scholar] [CrossRef]
- Vimal, S.; Farook, M.A.; Madan, N.; Abdul Majeed, S.; Nambi, K.S.N.; Taju, G.; Sundar Raj, N.; Venu, S.; Subburaj, R.; Thirunavukkarasu, A.R.; et al. Development, distribution and expression of a DNA vaccine against nodavirus in Asian Seabass, Lates calcarifier (Bloch, 1790). Aquac. Res. 2016, 47, 1209–1220. [Google Scholar] [CrossRef]
- Valero, Y.; Olveira, J.G.; López-Vázquez, C.; Dopazo, C.P.; Bandín, I. Bei inactivated vaccine induces innate and adaptive responses and elicits partial protection upon reassortant betanodavirus infection in senegalese sole. Vaccines 2021, 9, 458. [Google Scholar] [CrossRef]
- Munang’andu, H.M.; Fredriksen, B.N.; Mutoloki, S.; Dalmo, R.A.; Evensen, Ø. The kinetics of CD4+ and CD8+ T-cell gene expression correlate with protection in Atlantic salmon (Salmo salar L) vaccinated against infectious pancreatic necrosis. Vaccine 2013, 31, 1956–1963. [Google Scholar] [CrossRef]
- Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A review of fish vaccine development strategies: Conventional methods and modern biotechnological approaches. Microorganisms 2019, 7, 569. [Google Scholar] [CrossRef]
- Drennan, J.D.; LaPatra, S.E.; Swan, C.M.; Ireland, S.; Cain, K.D. Characterization of serum and mucosal antibody responses in white sturgeon (Acipenser transmontanus Richardson) following immunization with WSIV and a protein hapten antigen. Fish Shellfish Immunol. 2007, 23, 657–669. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.M.; Wang, T.Y.; Chen, T.Y. Immunity to betanodavirus infections of marine fish. Dev. Comp. Immunol. 2014, 43, 174–183. [Google Scholar] [CrossRef] [PubMed]
- Ito, T.; Maeno, Y. Effect of booster shot and investigation of vaccination efficacy period against herpesviral haematopoietic necrosis (HVHN) in goldfish Carassius auratus. Vet. Microbiol. 2015, 175, 139–144. [Google Scholar] [CrossRef] [PubMed]
- Souto, S.; López-Vázquez, C.; Olveira, J.G.; Riaza, A.; González, O.; Brea, C.; Labella, A.; Castro, D.; Bandín, I. Booster vaccination against Nervous necrosis virus (NNV) improves immunity and protection in Senegalese sole. In Proceedings of the XVI Congreso Nacional Virología, Málaga, Spain, 6–9 September 2022; pp. 141–142. [Google Scholar]
- Iwamoto, T.; Nakai, T.; Mori, K.; Arimoto, M.; Furusawa, I.; Nakai, T. Cloning of the fish cell line SSN-1 for piscine nodaviruses. Dis. Aquat. Organ. 2000, 43, 81–89. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Montero, D.; Benitez-Dorta, V.; Caballero, M.J.; Ponce, M.; Torrecillas, S.; Izquierdo, M.; Zamorano, M.J.; Manchado, M. Dietary vegetable oils: Effects on the expression of immune-related genes in Senegalese sole (Solea senegalensis) intestine. Fish Shellfish Immunol. 2015, 44, 100–108. [Google Scholar] [CrossRef]
- Gémez-Mata, J.; Labella, A.M.; Bandín, I.; Borrego, J.J.; García-Rosado, E. Immunogene expression analysis in betanodavirus infected-Senegalese sole using an OpenArray® platform. Gene 2021, 774, 145430. [Google Scholar] [CrossRef]
- Olveira, J.G.; Souto, S.; Bandin, I.; Dopazo, C.P.; Bandín, I.; Dopazo, C.P. Development and Validation of a SYBR Green Real Time PCR Protocol for Detection and Quantification of Nervous Necrosis Virus (NNV) Using Different Standards. Animals 2021, 11, 1100. [Google Scholar] [CrossRef]
- Adams, A. Progress, challenges and opportunities in fish vaccine development. Fish Shellfish Immunol. 2019, 90, 210–214. [Google Scholar] [CrossRef]
- Kaattari, S.; Bromage, E.; Kaattari, I. Analysis of long-lived plasma cell production and regulation: Implications for vaccine design for aquaculture. Aquaculture 2005, 246, 1–9. [Google Scholar] [CrossRef]
- Ye, J.; Kaattari, I.M.; Ma, C.; Kaattari, S. The teleost humoral immune response. Fish Shellfish Immunol. 2013, 35, 1719–1728. [Google Scholar] [CrossRef] [PubMed]
- Pakingking, R.; de Jesus-Ayson, E.G.; Reyes, O.; Brian Bautista, N. Immunization regimen in Asian sea bass (Lates calcarifer) broodfish: A practical strategy to control vertical transmission of nervous necrosis virus during seed production. Vaccine 2018, 36, 5002–5009. [Google Scholar] [CrossRef] [PubMed]
- Somamoto, T.; Koppang, E.O.; Fischer, U. Antiviral functions of CD8+ cytotoxic T cells in teleost fish. Dev. Comp. Immunol. 2014, 43, 197–204. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.K.; Wu, Y.C.; Chi, S.C. Humoral and cytokine responses in giant groupers after vaccination and challenge with betanodavirus. Dev. Comp. Immunol. 2017, 67, 385–394. [Google Scholar] [CrossRef]
- Kole, S.; Qadiri, S.S.N.; Shin, S.M.; Kim, W.S.; Lee, J.; Jung, S.J. PLGA encapsulated inactivated-viral vaccine: Formulation and evaluation of its protective efficacy against viral haemorrhagic septicaemia virus (VHSV) infection in olive flounder (Paralichthys olivaceus) vaccinated by mucosal delivery routes. Vaccine 2019, 37, 973–983. [Google Scholar] [CrossRef]
- Janeway, C.J.; Travers, P.; Walport, M.; Shlomchik, M.J. The Immune System in Health and Disease; Garland Science: New York, NY, USA; London, UK, 2005. [Google Scholar]
- Gatti, E.; Pierre, P. Understanding the cell biology of antigen presentation: The dendritic cell contribution. Curr. Opin. Cell Biol. 2003, 15, 468–473. [Google Scholar] [CrossRef]
- Veenstra, K.A.; Hodneland, K.; Fischer, S.; Takehana, K.; Belmonte, R.; Fischer, U. Cellular immune responses in rainbow trout (Onchorhynchus mykiss) following vaccination and challenge against salmonid alphavirus (sav). Vaccines 2020, 8, 725. [Google Scholar] [CrossRef]
- Tafalla, C.; Coll, J.; Secombes, C.J. Expression of genes related to the early immune response in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagic septicemia virus (VHSV) infection. Dev. Comp. Immunol. 2005, 29, 615–626. [Google Scholar] [CrossRef]
- Xu, C.; Guo, T.C.; Mutoloki, S.; Haugland, Y.; Evensen, Y. Gene expression studies of host response to Salmonid alphavirus subtype 3 experimental infections in Atlantic salmon. Vet. Res. 2012, 43, 2–11. [Google Scholar] [CrossRef] [Green Version]
- Reyes-Cerpa, S.; Reyes-López, F.E.; Toro-Ascuy, D.; Ibañez, J.; Maisey, K.; Sandino, A.M.; Imarai, M. IPNV modulation of pro and anti-inflammatory cytokine expression in Atlantic salmon might help the establishment of infection and persistence. Fish Shellfish Immunol. 2012, 32, 291–300. [Google Scholar] [CrossRef]
- Hu, Y.H.; Chen, L.; Sun, L. CXCL8 of Scophthalmus maximus: Expression, biological activity and immunoregulatory effect. Dev. Comp. Immunol. 2011, 35, 1032–1039. [Google Scholar] [CrossRef] [PubMed]
- Collet, B. Innate immune responses of salmonid fish to viral infections. Dev. Comp. Immunol. 2014, 43, 160–173. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.S.; Zhao, L.; Sun, L. Interleukin-8 of Cynoglossus semilaevis is a chemoattractant with immunoregulatory property. Fish Shellfish Immunol. 2011, 30, 1362–1367. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Yao, X.; Shan, Z.; Li, W.; Gao, Y.; Zhang, Q. E3 ligase Herc4 regulates Hedgehog signalling through promoting Smoothened degradation. J. Mol. Cell Biol. 2019, 11, 791–803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Huang, J.; Jin, B.; He, S.; Dang, Y.; Zhao, T.; Jin, Z. The Emerging Role of Hedgehog Signaling in Viral Infections. Front. Microbiol. 2022, 13, 870316. [Google Scholar] [CrossRef]
- Rise, M.L.; Hall, J.R.; Rise, M.; Hori, T.S.; Browne, M.J.; Gamperl, A.K.; Hubert, S.; Kimball, J.; Bowman, S.; Johnson, S.C. Impact of asymptomatic nodavirus carrier state and intraperitoneal viral mimic injection on brain transcript expression in Atlantic cod (Gadus morhua). Physiol. Genom. 2010, 42, 266–280. [Google Scholar] [CrossRef]
- Chen, Y.M.; Su, Y.L.; Shie, P.S.; Huang, S.L.; Yang, H.L.; Chen, T.Y. Grouper Mx confers resistance to nodavirus and interacts with coat protein. Dev. Comp. Immunol. 2008, 32, 825–836. [Google Scholar] [CrossRef]
- Sato, A.; Okamoto, N. Induction of virus-specific cell-mediated cytotoxic responses of isogeneic ginbuna crucian carp, after oral immunization with inactivated virus. Fish Shellfish Immunol. 2010, 29, 414–421. [Google Scholar] [CrossRef]
- Purcell, M.K.; Kurath, G.; Garver, K.A.; Herwig, R.P.; Winton, J.R. Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination. Fish Shellfish Immunol. 2004, 17, 447–462. [Google Scholar] [CrossRef]
- Labella, A.M.; Garcia-Rosado, E.; Bandín, I.; Dopazo, C.P.; Castro, D.; Alonso, M.C.; Borrego, J.J. Transcriptomic profiles of Senegalese sole infected with nervous necrosis virus reassortants presenting different degree of virulence. Front. Immunol. 2018, 9, 1626. [Google Scholar] [CrossRef]
- Moreno, P.; Gemez-Mata, J.; Garcia-Rosado, E.; Bejar, J.; Labella, A.M.; Souto, S.; Alonso, M.C. Differential immunogene expression profile of European sea bass (Dicentrarchus labrax, L.) in response to highly and low virulent NNV. Fish Shellfish Immunol. 2020, 106, 56–70. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence 5′-3′ | Accession No., Reference or Unigene ID |
---|---|---|
cd4 | F: GACCTCAGGCTGCAATGGT R: TGAGCAGAGTGATGGACAGACT | [37] |
cd8a | F: GTCGCAGTTCTGCTCTCCGC R: TCGGTTGCAGTAGAGGACGG | solea_v4.1_unigene59609 a |
herc4 | F: GCCAAAACACTGGCATGGTT R: AACGCCAAACAGGAAGTACCT | [38] |
ighm | F: TGAAACATTGACACAGCCAGCC R: CGTGTGAGCTTCCAATCCACTC | solea_v4.1_unigene691100 |
il8 | F: AAGGTCCTTACTGCGCAAAC R: TGCTCTTCCCTGCTGATGAA | solea_v4.1_unigene18346 |
mchII | F: CGCTGATGAAAATGATCCACCTTCT R: ACCAGTCACATGACAGATCAGAGT | [38] |
mx | F: CCTCTCTCCTTCAGGATCCTCCTCCTGTGC R: CAAAACAAGAAACTATCTGCCTGGTGGTTC | [38] |
tcrb | F: CAGGAGGCACAGCTATGAAA R: TCTCCACCCAAATCTCCAAA | solea_v4.1_unigene681812 |
actb | F: GACGACATGGAGAAGATC R: GGTGTTGAAGGTCTCAAA | DQ485686 b |
Treatment | Booster Injection (Days) a | Efficacy of Protection | |
---|---|---|---|
Survival (%) | RPS c | ||
Prime-Vaccination | NA b | 81 | 55 |
Booster | 30 | 95 | 76 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
López-Vázquez, C.; Souto, S.; Olveira, J.G.; Riaza, A.; González, Ó.; Brea, C.; Labella, A.M.; Castro, D.; Bandín, I. Nervous Necrosis Virus (NNV) Booster Vaccination Increases Senegalese Sole Survival and Enhances Immunoprotection. Animals 2023, 13, 51. https://doi.org/10.3390/ani13010051
López-Vázquez C, Souto S, Olveira JG, Riaza A, González Ó, Brea C, Labella AM, Castro D, Bandín I. Nervous Necrosis Virus (NNV) Booster Vaccination Increases Senegalese Sole Survival and Enhances Immunoprotection. Animals. 2023; 13(1):51. https://doi.org/10.3390/ani13010051
Chicago/Turabian StyleLópez-Vázquez, Carmen, Sandra Souto, José G. Olveira, Ana Riaza, Óscar González, Cristina Brea, Alejandro M. Labella, Dolores Castro, and Isabel Bandín. 2023. "Nervous Necrosis Virus (NNV) Booster Vaccination Increases Senegalese Sole Survival and Enhances Immunoprotection" Animals 13, no. 1: 51. https://doi.org/10.3390/ani13010051