Next Article in Journal
Serum Protein Concentration and Serum Protein Fractions in Bottlenose Dolphins (Tursiops truncatus) under Human Care Using Agarose Gel Electrophoresis
Next Article in Special Issue
Airsacculitis Caused by Enterobacteria and Occurrence of Eggs of the Superfamily Diplotriaenoidea in Feces of Tropical Screech Owl (Megascops choliba) in the Amazon Biome
Previous Article in Journal
Novel Mutation in the Feline NPC2 Gene in Cats with Niemann–Pick Disease
Previous Article in Special Issue
Seasonal Variation and Factors Affecting Trypanosoma theileri Infection in Wild Sika Deer (Ezo Sika Deer Cervus nippon yesoensis) in Eastern Hokkaido
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 11
10.3390/ani13111743
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of Wild Boars in the Circulation of Tick-Borne Pathogens: The First Evidence of Rickettsia monacensis Presence

by
Ioana Adriana Matei
1,
Zsuzsa Kalmár
1,2,3,*,
Anamaria Balea
4,
Marian Mihaiu
4,5,
Attila D. Sándor
3,6,7,
Adrian Cocian
1,
Smaranda Crăciun
1,
Cosmina Bouari
1,
Violeta Tincuța Briciu
2 and
Nicodim Fiț
1
1
Department of Microbiology, Immunology and Epidemiology, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine, 400372 Cluj-Napoca, Romania
2
Department of Infectious Diseases, “Iuliu Hațieganu” University of Medicine and Pharmacy, 400012 Cluj-Napoca, Romania
3
ELKH-ÁTE Climate Change, New Blood-Sucking Parasites and Vector-Borne Pathogens Research Group, 1078 Budapest, Hungary
4
Sanitary Veterinary and Food Safety Directorate Cluj, 400609 Cluj-Napoca, Romania
5
Department of Animal Breeding and Food Science, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine, 400372 Cluj-Napoca, Romania
6
Department of Parasitology and Parasitic Diseases, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine, 400372 Cluj-Napoca, Romania
7
Department of Parasitology and Zoology, University of Veterinary Medicine, 1078 Budapest, Hungary
*
Author to whom correspondence should be addressed.
Animals 2023, 13(11), 1743; https://doi.org/10.3390/ani13111743
Submission received: 5 April 2023 / Revised: 19 May 2023 / Accepted: 22 May 2023 / Published: 24 May 2023
(This article belongs to the Special Issue Bacteria and Parasites in Wildlife)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Wildlife has a major role in the transmission and maintenance of zoonotic agents, as most emerging infectious diseases are of wildlife origin. Among the great variety of wildlife species, wild boars (Sus scrofa) are species with continuously increasing abundance and geographical distribution. Wild boars were suggested as appropriate sentinel species for the distribution and abundance of certain tick species in America and Europe. Therefore, these species may also be suitable sentinel species for screening for tick-borne pathogens. The aim of this study was to evaluate the presence of tick-borne pathogens in wild boars in Romania. A total of 203 blood samples were collected from wild boars (Sus scrofa) from two Transylvanian counties (Cluj, Sălaj) in Romania. Three emerging zoonotic pathogens were identified, Anaplasma phagocytophilum and two Rickettsia species (R. helvetica, R. monacensis) DNA, in the blood of tested animals. These results suggest the involvement of wild boars in the epidemiology of Rickettsia species and A. phagocytophilum. Hence, this species may be used as a sentinel for the general surveillance of these zoonotic pathogens.

Abstract

Most wild mammals can serve as hosts both for tick-borne pathogens (TBPs) and for the ticks themselves. Among these, wild boars, due to their large body size, habitat and life span, show high exposure to ticks and TBPs. These species are now one of the widest-ranging mammals in the world, as well as the most widespread suid. Despite the fact that certain local populations have been decimated by African swine fever (ASF), wild boars are still considered overabundant in most parts of the world, including Europe. Altogether, their long-life expectancy, large home ranges including migration, feeding and social behaviors, wide distribution, overabundance and increased chances of interactions with livestock or humans make them suitable sentinel species for general health threats, such as antimicrobial-resistant microorganisms, pollution and ASF geographical distribution, as well as for the distribution and abundance of hard ticks and also for certain TBPs, such as Anaplasma phagocytophilum. The aim of this study was to evaluate the presence of rickettsial agents in wild boars from two counties in Romania. Among 203 blood samples of wild boars (Sus scrofa ssp. attila) collected during 3 (2019–2022) hunting seasons (September–February), 15 were found positive for tick-borne pathogen DNA. Six wild boars were positive for A. phagocytophilum DNA presence and nine for Rickettsia spp. The identified rickettsial species were R. monacensis (six) and R. helvetica (three). No animal was positive either for Borrelia spp., Ehrlichia spp. or Babesia spp. To the best of our knowledge, this is the first report of R. monacensis in European wild boars, thus adding the third species from the SFG Rickettsia, in the epidemiology of which this wild species may have a role as a reservoir host.

1. Introduction

Wildlife has a major role in the transmission and maintenance of zoonotic agents, as most emerging infectious diseases are of wildlife origin [1]. Among the great variety of wildlife species, ungulates, including wild boars (Sus scrofa), are species with continuously increasing abundance and geographical distribution [2]. The increase in the range and population of wild boars and the causes leading to this have been intensely debated among different scientific fields. However, the most accepted causes include climate change, together with the low mortality of piglets during the winter and the decreasing populations of natural predators [2]. Wild boars are an endemic species in all of Europe and Asia and an invasive species in Northern Africa; North, Central and South America; Australia; and New Zealand [3]. Concerning their abundance, they are considered overabundant in most agricultural and rural areas in Europe, as well as in many peri-urban areas [2]. Wild boars are versatile species living in a large variety of habitats, the only limitation being the presence of water. They are omnivore animals and their average life span is eight to ten years [4]. The home range is highly variable depending on multiple factors, including group structure, resources and accessibility. In the absence of the dominating sow (old matriarch), groups can travel long distances, covering up to 1000 ha in a day, sometimes reaching anthropic zones, including peri-urban areas, in the search for food [4]. Among the multiple effects of their overabundance, together with the abovementioned ecological and biological characteristics, it is included the increasing interaction of wild boars with domestic animals and even with humans, with possible negative impacts on animal and human health. Wild boars are important reservoirs and disseminators of infectious agents, such as African swine fever virus, classical swine fever, and Aujeszky’s disease virus, affecting livestock, and also for zoonotic pathogens, such as hepatitis E virus, Brucella suis, and Mycobacterium tuberculosis [5]. In addition to these, many other zoonotic infectious agents have been detected in wild boars, without knowing well the ecological role and importance of these animals in their epidemiology [5]. Due to their ecological and biological characteristics, wild boars have been suggested as appropriate sentinel species for hard tick distribution and abundance in America [6] and Europe [7]. Although not fully evaluated, they may also be suitable sentinel species for the screening of tick-borne pathogens (TBP), in addition to already suggested groups, such as red foxes or dogs [8].
Tick-borne diseases (TBDs) represent around 95% of all vectorial disease cases in North America, Europe and Asia [9]. Ticks are hematophagous arthropods with a complex life cycle and variable host specificity depending on the species and developmental stage [9]. In Europe, in general, and in Romania, in particular, the most prevalent genera are Ixodes, Dermacentor, Rhipicephalus, Haemaphysalis and Hyalomma [10]. Altogether, these ticks may transmit a large variety of TBPs. The commonly reported emergence of TBD is caused by numerous factors, including climate change and the abundance and accessibility of available hosts [11]. The importance of TBD for public and animal health instills major importance for the surveillance of ticks in the continuous effort to control and limit their impact. An important tool in disease surveillance is the monitoring of agents present in the sentinel and reservoir species. Among diverse TBPs, wild boars have been suggested as suitable reservoir species for Anaplasma phagocytophilum, with multiple reports of this bacteria in boars in Europe, including Romania [12]. Concerning other TBPs, in addition to serological studies, Borrelia burgdorferi s.l. has been molecularly detected in wild boars in Italy and Portugal [13,14]. Recently, Babesia divergens was also molecularly detected in this animal species in the Czech Republic [15]. Reports of Rickettsia spp. in European wild boars are few, with only two species being recorded so far: R. slovaca in Italy and R. helvetica in the Netherlands [16,17,18,19]. In addition, R. slovaca was also identified in the spleen samples of wild boars in Algeria, North Africa [20]. Nevertheless, there are several European studies reporting a high prevalence of spotted fever group Rickettsia (SFG Rickettsia) in ticks collected from wild boars, coupled with negative spleen or blood samples in hosts [21,22]. However, the high seroprevalence of Rickettsia spp. reported in Spain, Brazil and Japan may suggest their involvement in rickettsiosis epidemiology [23,24,25,26]. Although there are certain differences between wild boar subspecies across the globe (including between European countries), and also among tick populations, it is expected to have similar observations in Romania.
Considering the potential role of wild boars as hosts and sentinel species for tick-borne diseases, in general, and the previous detection of some TBPs, together with contradictory results of Rickettsia spp. detection across the world, the aim of this study was to evaluate the presence of TBPs in wild boars in Romania.

2. Materials and Methods

2.1. Sampling

Currently, between 6 and 16 wild boar subspecies are recognized worldwide. In Europe, three subspecies are present, and in Romania, there are two: Sus scrofa ssp. scrofa and S. s. attila [27]. For subspecies identification, the most commonly used measurements are lacrimal bone shape and size, molar size and total body weight [27,28,29]. In Transylvania (study’s location), only Eastern European S. s. attila is present. Sus scrofa attila is a large-sized subspecies, which can exceed 350 kg weight, with long lacrimal bones and dark hair, usually lighter colored and larger in size than S. s. scrofa [27,28,29].
The samples were collected during three hunting seasons during 2019–2022. Wild boars were shot by authorized local hunters during the regular hunting season (October–February) as trophies, for population control or for conflict management purposes. The measurements of total body weight and third molars were recorded. The external examination of wild boar carcasses was performed in order to collect the ticks (if present), and a blood sample was collected also. A total of 54 blood samples of boars (S. s. attila) were collected during 2 hunting seasons (2019–2020 and 2020–2021) in Sălaj county in one particular hunting area, representing all the animals hunted in the chosen hunting seasons. Unfortunately, because of African swine fever (ASF) in the first sampling area (high reported mortality and, consequently, an important decrease in the population), in the third hunting season (2021–2022), no blood samples were available. Because of this, 149 additional blood samples collected by local hunters in the mentioned time period and sent to the local veterinary authority from Cluj County (a neighboring county) for ASF surveillance were included in the study.

2.2. Molecular Analysis

Genomic DNA was extracted individually from each sample using ISOLATE II Genomic DNA Kit (Meridian Bioscience, Newtown, OH, USA) following the manufacturer’s instructions.
The presence of TBP’s DNA was evaluated by conventional and nested PCR amplifying fragments of the 16S rRNA genes of A. phagocytophilum and Ehrlichia spp., 18S rRNA gene of Babesia/Theileria spp., intergenic spacer (IGS) of Borrelia spp. and 17 kDa outer membrane antigen gene of Rickettsia spp. Anaplasma-positive samples were further evaluated by heminested PCR amplifying fragments of the groEL gene of A. phagocytophilum (Table 1).
In all cases, the amplification was performed in 25 µL of reaction mixture containing 12.5 µL of 2 × MyTaqTM Red Mix (Bioline, London, UK), 6.5 µL of PCR water, 1 µL of each primer (0.01 mM) and 4 µL aliquot of isolated DNA, and 1 µL of the primary PCR products instead of DNA template for the nPCR.
The amplification profile for Anaplasma spp./A. phagocytophilum was the following: the first PCR consisted of initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 60 s, ending with a final extension at 72 °C for 5 min. For the second PCR, the amplification profile consisted of initial denaturation at 95 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s and extension at 72 °C for 60 s, ending with a final extension at 72 °C for 5 min. For groEL, the first PCR consisted of initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 51 °C for 45 s and extension at 72 °C for 90 s, ending with a final extension at 72 °C for 5 min. The nested step followed the same profile with an annealing temperature of 55 °C.
The amplification profile for Babesia/Theileria spp. was the following: the first PCR consisted of initial denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 54 °C for 30 s and extension at 72 °C for 40 s, ending with a final extension at 72 °C for 5 min.
The amplification profile for Borrelia spp. was the following: 15 min at 90 °C, followed by cycles of 20 s at 90 °C, 30 s at 70 °C, 30 s at 72 °C, lowering the annealing temperature 1 °C/cycle until reaching 60 °C and, finally, 40 cycles at 60 °C, followed by 7 min at 72 °C.
The amplification profile for Ehrlichia spp./E. canis was the following: the first PCR consisted of initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 64 °C for 30 s and extension at 72 °C for 60 s, ending with a final extension at 72 °C for 5 min. For the second PCR, the amplification profile consisted of initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s and extension at 72 °C for 60 s, ending with a final extension at 72 °C for 5 min.
For the amplification profile for SFG Rickettsia spp. 17 kDa outer membrane gene amplification, the profile consisted of an initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 61 °C for 30 s, elongation at 72 °C for 45 s, followed by a final elongation at 72 °C for 5 min. The nested step followed the same profile with an annealing temperature of 54 °C.
Positive and negative controls were included in each PCR set to assess the possible cross-contamination and the specificity of the reactions. PCR was carried out using T100TM Thermal Cycler (Bio-Rad, Hercules, CA, USA). Amplicons were visualized by using electrophoresis in 1.5% agarose gel stained with RedSafe® Nucelic Acid Staining Solution (iNtRON Biotechnology, JungAng Induspia, Seongnam-Si, Republic of Korea).
PCR-positive samples were purified using FavorPrep GEL/PCR Extraction or Purification DNA fragment Kit (Favorgen, Ping Tung, Taiwan) and were further sequenced (Macrogen Europe, Amsterdam, The Netherlands). DNA sequences were analyzed and compared with those available in GenBankTM by using Basic Local Alignments Tool (BLAST) analysis.

2.3. Phylogenetical Analysis

The phylogenetic analysis was performed by MEGA11 software for 17 kDa surface antigen coding gene of Rickettsia spp. and groEL gene of A. phagocytophilum using reference sequences of strains for which sequence data were available in GenBank. The phylogenetic trees were constructed using maximum likelihood method with Tamura–Nei model and a Gamma distribution of 500 bootstrap replicates. The accession numbers, country and host of isolates from each species are displayed in the phylogenetic trees.

2.4. Statistical Analysis

Statistical analysis was performed using Epi InfoTM 7.2 software (CDC, Atlanta, GA, USA). The infection prevalence and its 95% confidence intervals were assessed using the chi-square independence test.

3. Results

The overall infection prevalence of TBP in the collected blood samples from wild boars was 7.4% (15/203; 95% CI: 4.2–11.9). None of the blood samples were positive for Borrelia spp., Ehrlichia spp. or Babesia/Theileria spp.
The 16S rRNA sequence of A. phagocytophilum DNA was identified in six (203; 3.0%, 95% CI: 1.1–6.3) blood samples. The infection prevalence in Cluj County was 3.4% (5/149; 95% CI: 1.1–7.7), and all of the positive samples were detected in only one of the seasons (2021–2022). While in Sălaj County, the infection prevalence was 1.9% (1/54; 95% CI: 0.1–9.9), and only one positive sample was collected in the first season (2019–2020).
Anaplasma-phagocytophilum-positive samples for 16S rRNA were further amplified targeting the groEL gene of A. phagocytophilum. The sequence analysis revealed 100% similarity among DNA sequences from the present study and the same percentage with A. phagocytophilum isolated from S. scrofa blood from the Czech Republic (MT498612). Additionally, high similarity (99.78–100%) with various other strains from GenBank isolated from engorged I. ricinus in different European countries (MN093180, the Netherlands; AY281823, Germany; OP265401, Czech Republic; MF372791, Hungary; HQ629908, Russia) and dog blood (KT970680, Italy) was shown. According to the nucleotide BLAST analysis, the sequences belong to the ecotype I described by Jahfari et al. 2014 [36]. This ecotype consists of strains with zoonotic potential, with all HGA strains belonging to this ecotype.
A total of 33 available sequences of the A. phagocytophilum groEL gene in GenBank (one isolate from each European country/host) was included in the phylogenetic analysis (Figure 1). The ecotype of A. phagocytophilum isolates was not included in the phylogenetic tree since this information was not available in GenBank for each sequence. Anaplasma phagocytophilum isolated from wild boars in Romania was clustered together with an isolate from red foxes (the Czech Republic; Figure 1).
Rickettsia spp. DNA was detected in 4.4% (9/203; 95% CI: 2.1–8.3) of the samples. The infection prevalence in Cluj County was 2.0% (3/149; 95% CI: 0.4–5.8) and 11.1% (6/54; 95% CI: 4.2–22.6) in Sălaj County. Two positive samples (7.7%, 95%CI: 1.0–25.1) were collected in the 2019–2020 season, four were collected (14.28%, 95%CI: 4.0–14.3) in 2020–2021, and three were collected (2.0%, 95% CI: 0.4–5.8) in 2021–2022. We identified two Rickettsia species in both counties, R. monacensis (n = 6) and R. helvetica (n = 3).
The sequence analysis using the BLAST of both Rickettsia species revealed a high similarity (99.9–100%) among DNA sequences from the present study. Rickettsia monacensis showed 99.9–100% similarity to several strains isolated from different hosts in Europe (Lithuania and Italy) identified in ticks that feed on birds (MF491748), sheep (KY319220), roe deer (KY319219) and humans (KY319215).
Additionally, the sequences of R. helvetica recorded in wild boars showed 99.9–100% similarity to several strains isolated from different ticks in Europe (Romania, Lithuania, Italy and Poland): Ixodes kaiseri (MK733577), I. ricinus from the environment (KT734810) and I. ricinus collected from different bird species (MF491752 and MF491751), as well as ungulates (KY346828), but also from mites (MF491777 and MF491768), insects (MF491768) and hosts’ tissues of rodents (MF491760 and MF491758) and insectivore species (MF491754), too. A total of 32 sequences (1 isolate from each European country/host) of R. helvetica (n = 20), R. monacensis (n = 8), R. raoultii (n = 2) and R. slovaca (n = 2) were included in the phylogenetic tree analysis. R. monacensis and R. helvetica isolated from wild boars from Romania were clustered together (Figure 2). However, available sequences in GenBank of 17 kDa surface antigen coding gene of different Rickettsia species distributed in Europe were scarce or missing for certain Rickettsia species (e.g., R. aeschlimannii, R. conorii and R. massiliae).
None of the samples showed mixed infections of different TBP. No ticks were found on the wild boars from Sălaj County, and no information was available regarding tick presence on boars from Cluj County.

4. Discussion

Altogether, the DNA of A. phagocytophilum and two Rickettsia (R. helvetica and R. monaensis) species were recorded in wild boar tissues in Romania in the present study. While both A. phagocitophylum and R. helvetica have already been detected in wild boars [12,13,14,15,16,17], to the best of our knowledge, this is the first report of R. monacensis in wild boars worldwide. So far, within SFG rickettsiae, only R. helvetica and R. slovaca have been detected in wild boar tissue samples in Europe [16,18,19].
Rickettsia slovaca, one of the agents of scalp eschar and neck lymphadenopathy after tick bites (SENLAT), was, for the first time, identified in wild boars in Italy in one out of nine tested skin biopsies. In the same study, ticks (Dermacentor marginatus) collected from wild pigs showed an SFG rickettsiae prevalence of 33.9%, with 2 species being identified as R. slovaca (36 ticks, including 1 collected from wild boar with positive skin biopsy) and R. raoultii (2 ticks) [19]. More recently, 11.3% of Italian wild boar tissues (1 liver and 8 ear biopsies out of 80 tissues tested) were found to be positive for SFG rickettsiae, identified as R. slovaca. Similar to a previously described study, a high R. slovaca prevalence was observed in ticks collected from wild boars, namely, 48% in D. marginatus and 33.3% in D. reticulatus. In addition, Candidatus R. rioja was detected in three D. marginatus collected from wild boars, another recently recognized SENLAT agent [18,37]. In another Italian study, 1 out of 93 spleen samples tested positive for R. slovaca. Among the ticks collected from these wild boars, 16 (9%) D. marginatus were positive for R. slovaca and 1 (0.6%) for R. raoultii, and a single I. ricinus (0.6%) was infected by R. slovaca [19]. The detection of R. slovaca in Italian wild boars is sustained by the high seropositivity to R. slovaca (52.2%) observed in Spanish wild boars [23]. Similar to studies conducted in Italy, R. slovaca was also identified in 30.5% of D. marginatus ticks removed from wild boars [23]. In addition to the European reports, R. slovaca was detected in wild boar spleen samples collected between 2011–2014 in Algeria [20].
Rickettsia helvetica was detected in two whole blood samples (7%) of boars in the Netherlands [17]. Despite these reports of SFG rickettsiae in wild boar tissue samples, other studies report negative results in tissue samples. For instance, a study in Portugal on 65 animals reported negative results in all blood samples for the following: Babesia spp., B. burgdorferi (s.l.), Ehrlichia spp. and Rickettsia spp. [38]. In this study, no data regarding tick presence and TBP in the ticks are provided. In another study conducted in Italy, D. marginatus ticks collected from wild boars were positive for R. slovaca (24%) and R. helvetica (1%), while I. ricinus ticks were positive for R. monacensis (11%) and R. slovaca (18.2%) [22]. However, all 89 tested blood samples yielded negative results [22]. Similarly, in Spain, D. marginatus ticks were positive for R. slovaca (7.3%) and R. raoultii (2.7%); Rhipicephalus sanguineus sensu lato for R. massiliae (13.7%); and Hyalomma lusitanicum for R. slovaca (0.3%), whereas all 167 spleen samples were negative [21].
Although these different results may be explained by a large variety of reasons, such as the geographical location of the study and tick populations and diversity, SFG rickettsiae prevalence in ticks and wild boar population characteristics, including the subspecies present, the detection protocol and the sample type, may also have an important influence. Based on the abovementioned studies, the most common positive types of samples seem to be ear and skin biopsies, followed by spleen and, less commonly, whole blood samples. Thus, blood samples may be considered less appropriate compared to skin biopsies. This could be due to short-lasting bacteremia in wild boars. Considering this, an advantage of biopsies could be the higher detection of pathogens. However, a limitation of this approach could be an overestimation of the pathogen pressure/transmission in the vector’s populations. On the other hand, spleen and blood samples indicate bacteremia, during which the pathogen transmission to the vectors is more important, but an underestimation of the prevalence may occur. Thus, the sample type could be chosen taking into account the study’s aim and proper discussions. Even though a moderate prevalence (4.4%) of SFG rickettsiae was observed in the present study, considering the possible short-lasting bacteremia, the sampling period and the absence of ticks on the animals, it would be expected to obtain even greater prevalence in the period of more intense activity of the tick vectors.
Rickettsia slovaca, the most detected species in wild boar tissue samples, is mainly transmitted by Dermacentor species, while Rickettsia monacensis and R. helvetica (the two species detected in the present study) are transmitted primarily by Ixodes ricinus [39], a more generalist tick species, which is also the most common tick in Romania [40]. The activity peaks of I. ricinus are in May –June (as reviewed by [10]), with more reduced activity during the rest of the year. While this is the case with the abundant subadult stages, adults (although not recorded here) are active in the sampling period of the present study (October–February), too.
In Romania, nine Rickettsia species have been detected in ticks and animals so far (R. aeschlimannii, R. conorii, R. felis, R. helvetica, R. hoogstraalii, R. massiliae, R. monacensis, R. raoultii and R. slovaca) [41,42,43,44,45,46]. Among these, both R. monacensis and R. helvetica have a wide distribution, and they were detected all over Europe in ticks and other arthropods collected from different host species, as well as in hosts’ tissue samples [39].
Rickettsia helvetica has been reported in different tick species belonging to Dermacentor, Ixodes, Haemaphysalis, Hyalomma and Rhipicephalus genera, in unfed ticks or ticks collected from a large variety of hosts species [39]. In addition, R. helvetica has also been isolated in tissue samples from different animals, such as birds, bats, goats, mouflons, deer, mustelids, hedgehogs and rodents [39]. Similarly, R. monacensis has been isolated from tick species belonging to Dermacentor, Ixodes, Haemaphysalis and Rhipicephalus genera, from unfed ticks or ticks collected from a large variety of hosts species, and also from animal tissue samples, such as birds, bats, dogs and rodents [39,45,46].
In Romania, these rickettsial species were jointly detected, in the same geographical area, in I. ricinus as well as in H. punctata, both in free stages [42,43]; in ticks collected from different animal species [44,45]; and in I. ricinus populations collected from a wide array of hosts, including humans, dogs, cats, livestock, wild birds and mammals (for a comprehensive review, see [41]). Both R. helvetica and R. monacensis are recognized as zoonotic species, being reported as causing important illnesses, as described in several studies [47,48,49,50,51]. R. monacensis is the agent of MSF-like syndrome, which is characterized by non-specific flu-like symptoms, hypersensitivity skin reactions and rash. Although initially considered non-pathogenic, R. helvetica may cause fever and eczema. The resulting complications are in the form of subacute meningitis or myopericarditis. This infection has been implicated in cases of fetal pericarditis, sarcoidosis and febrile syndromes [47,48,49,50,51]. Their presence in wild boar blood observed in this study suggests that this species may be involved in different SFG Rickettsia spp. epidemiology in Europe.
The detection of A. phagocytophilum in wild boars was not unexpected. This bacterium was previously detected in Romanian boars [52]. Although the protocol used was the same (targeting the 16S rRNA), the prevalence obtained in this study (3%) was lower compared to the 4.48% prevalence in Transylvania previously published. However, in a previous report, the highest prevalence was obtained in Sibiu county, whereas wild boars sampled in the same (Cluj and Sălaj) counties were negative [52]. The previous study was conducted between 2007 and 2011, while the present study was conducted between 2019 and 2022, suggesting a possible increase in time for prevalence. Previous reports have suggested wild boar as a potential reservoir host for A. phagocytophilum [53]. The agent was detected in tissue samples from wild pigs in Belgium, the Czech Republic, Germany, Italy, Poland, Romania, Slovakia and Slovenia (as reviewed by [12]), as well as, recently, in Hungary [7]. It is the etiological agent of tick-borne fever and equine, canine and human granulocytic anaplasmosis. Anaplasma phagocytophilum is widely distributed across the whole of Europe, being identified in different tick and vertebrate hosts in at least 35 countries (as reviewed by [12]). The strains isolated from wild boars (based on more than one gene’s analysis) belong to the same cluster, ecotype and even genotype as the strains isolated from humans [36,43,54,55]. Thes BLAST analysis of the strains detected in the present study confirms their belonging to ecotype I [36].

5. Conclusions

In conclusion, the present study highlights the presence of three emerging zoonotic pathogens also in Romanian wild boars, reporting, for the first time, the presence of R. monacensis in the blood samples of these animals. The observed prevalence suggests the involvement of wild boars in the epidemiology of these rickettsiae species and A. phagocytophilum, and based on this, boars may be used as sentinels for the general surveillance of these zoonotic pathogens.

Author Contributions

Conceptualization, I.A.M.; methodology, Z.K., A.B., M.M., A.D.S., A.C., S.C., C.B. and V.T.B.; validation, N.F. and I.A.M.; investigation, Z.K., A.B., M.M., A.D.S., A.C., S.C., C.B. and V.T.B.; data curation, I.A.M., Z.K. and N.F.; writing—original draft preparation, I.A.M. and Z.K.; writing—review and editing, A.B., M.M., A.D.S., A.C., S.C., C.B. and V.T.B.; visualization, A.B., M.M., A.D.S., A.C., S.C., C.B. and V.T.B.; supervision, N.F.; project administration, I.A.M.; funding acquisition, I.A.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported and funded by the CNCS-UEFISCDI Grant Agency Romania (grant numbers: PD34/2018 and 21865/4.10.2021). KZ and ADS were supported by TKP2020-NKA-01, implemented with the support provided from the National Research, Development and Innovation Fund of Hungary, financed under the “Tématerületi Kiválósági Program 2020” (2020-4.1.1-TKP2020) funding scheme and by OTKA K-132794 of the National Research, Development and Innovation Office (ADS). The publication was supported by funds from the National Research Development Projects to finance excellence (PFE)-14 (ID 546) and FDI-2023-F-0045 granted by the Romanian Ministry of Research, Innovation and Digitalization.

Institutional Review Board Statement

Not applicable as all the animal samples were collected after the authorized hunting, which is regulated by National Law, the law of hunting and the protection of hunting resources nr. 407/2006.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in this article.

Acknowledgments

We would like to acknowledge the hunters from the Ileanda nr. 2 association and to the Cluj local veterinary authority for their help in sample collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451, 990–994. [Google Scholar] [CrossRef]
  2. Carpio, A.J.; Apollonio, M.; Acevedo, P. Wild ungulate overabundance in Europe: Contexts, causes, monitoring and management recommendations. Mammal Rev. 2020, 51, 95–108. [Google Scholar] [CrossRef]
  3. Markov, N.; Pankova, N.; Morelle, K. Where winter rules: Modeling wild boar distribution in its north-eastern range. Sci. Total Environ. 2019, 687, 1055–1064. [Google Scholar] [CrossRef] [PubMed]
  4. Şelaru, N. Manual Pentru Examenul de Vânător; Editura Cynegis: Bucharest, Romania, 2001. (In Romanian) [Google Scholar]
  5. Contreras, R.C. Urban Wild Boar: Drivers of Presence, Phenotypic Responses and Health Concerns. Ph.D. Thesis, Universitat Autònoma de Barcelona, Barcelona, Spain, 2019. [Google Scholar]
  6. Merrill, M.M.; Boughton, R.K.; Lord, C.C.; Sayler, K.A.; Wight, B.; Anderson, W.M.; Wisely, S.M. Wild pigs as sentinels for hard ticks: A case study from south-central Florida. IJP Parasites Wildl. 2018, 7, 161–170. [Google Scholar] [CrossRef] [PubMed]
  7. Hornok, S.; Szekeres, S.; Horváth, G.; Takács, N.; Bekő, K.; Kontschán, J.; Gyuranecz, M.; Tóth, B.; Sándor, A.D.; Juháasz, A.; et al. Diversity of tick species and associated pathogens on peri-urban wild boars—First report of the zoonotic Babesia cf. crassa from Hungary. Ticks Tick Borne Dis. 2022, 13, 101936. [Google Scholar] [CrossRef]
  8. Millán, J.; Proboste, T.; Fernández de Mera, I.G.; Chirife, A.D.; Fuente, J.; Altet, L. Molecular detection of vector-borne pathogens in wild and domestic carnivores and their ticks at the human–wildlife interface. Ticks Tick. Borne Dis. 2015, 7, 284–290. [Google Scholar] [CrossRef] [PubMed]
  9. Rochlin, I.; Toledo, A. Emerging tick borne pathogens of public health importance : A mini-review. J. Med. Microbiol. 2020, 69, 781–791. [Google Scholar] [CrossRef] [PubMed]
  10. Estrada-Peña, A.; Mihalca, A.D.; Petney, T.N. Ticks of Europe and North Africa. In A Guide to Species Identification; Springer: Berlin/Heidelberg, Germany, 2017; pp. 1–9. [Google Scholar]
  11. Ogden, N.H.; Beard, C.B.; Ginsberg, H.S.; Tsao, J.I. Special collection: Possible Effects of Climate Change on Ixodid Ticks and the Pathogens They Transmit : Predictions and Observations. J. Med. Entomol. 2021, 58, 1536–1545. [Google Scholar] [CrossRef]
  12. Matei, I.A.; Estrada-Peña, A.; Cutler, S.J.; Taussat, M.V.; Castro, L.V.; Potkonjak, A.; Zeller, H.; Mihalca, A.D. A review on the eco-epidemiology and clinical management of human granulocytic anaplasmosis and its agent in Europe. Parasites Vectors 2019, 12, 599. [Google Scholar] [CrossRef]
  13. Faria, A.S.; Paiva-Cardoso, M.N.; Nunes, M.; Carreira, T.; Vale-Gonçalves, H.M.; Coelho, C.; Vieira-Pinto, M.; Vieira, M.L. First Detection of Borrelia burgdorferi sensu lato DNA in Serum of the Wild Boar (Sus scrofa) in Northern Portugal by Nested-PCR. EcoHealth 2015, 12, 183–187. [Google Scholar] [CrossRef] [PubMed]
  14. Ebani, V.V.; Bertelloni, F.; Cecconi, G.; Sgorbini, M.; Cerri, D. Zoonotic tick-borne bacteria among wild boars (Sus scrofa) in Central Italy. Asian Pac. J. Trop. Dis. 2017, 7, 141–143. [Google Scholar] [CrossRef]
  15. Hrazdilová, K.; Lesiczka, P.M.; Bardoň, J.; Vyroubalová, Š.; Šimek, B.; Zurek, L.; Modrý, D. Wild boar as a potential reservoir of zoonotic tick-borne pathogens. Ticks Tick-Borne Dis. 2021, 12, 101558. [Google Scholar] [CrossRef]
  16. Selmi, M.; Martello, E.; Bertolotti, L.; Bisanzio, D.; Tomassone, L. Rickettsia slovaca and Rickettsia raoultii in Dermacentor marginatus ticks collected on wild boars in Tuscany, Italy. J. Med. Entomol. 2009, 46, 1490–1493. [Google Scholar] [CrossRef] [PubMed]
  17. Sprong, H.; Wielinga, P.R.; Fonville, M.; Reusken, C.; Brandenburg, A.H.; Borgsteede, F.; Gaasenbeek, C.; Van der Giessen, J.W. Ixodes ricinus ticks are reservoir hosts for Rickettsia helvetica and potentially carry flea-borne Rickettsia species. Parasites Vector 2009, 7, 41. [Google Scholar] [CrossRef] [PubMed]
  18. Garcia-Vozmediano, A.; Giglio, G.; Ramassa, E.; Nobili, F.; Rossi, L.; Tomassone, L. Dermacentor marginatus and Dermacentor reticulatus, and their infection by SFG Rickettsiae and Francisella -Like Endosymbionts, in mountain and periurban habitats of Northwestern Italy. Vet. Sci. 2020, 7, 157. [Google Scholar] [CrossRef]
  19. Sgroi, G.; Iatta, R.; Lia, R.; Alessio, N.D.; Manoj, R.; Veneziano, V.; Otranto, D. Spotted fever group Rickettsiae in Dermacentor marginatus from wild boars in Italy. Transbound Emerg. Dis. 2020, 68, 2111–2120. [Google Scholar] [CrossRef]
  20. Zeroual, F.; Leulmi, H.; Bitam, I.; Benakhla, A. Molecular evidence of Rickettsia slovaca in spleen of wild boars in northeastern Algeria. New Microbes New Infect. 2018, 24, 17–20. [Google Scholar] [CrossRef] [PubMed]
  21. CastilloüContreras, R.; Magen, L.; Birtles, R.; Varela-Castro, L.; Hall, J.L.; Conejero, C.; López-Olvera, J.R. Ticks on wild boar in the metropolitan area of Barcelona (Spain) are infected with spotted fever group rickettsiae. Transbound Emerg. Dis. 2022, 69, 82–95. [Google Scholar]
  22. Grassi, L.; Menandro, M.L.; Cassini, R.; Mondin, A.; Pasotto, D.; Grillini, M.; Rocca, G.; Drigo, M. High Prevalence of tick-borne zoonotic Rickettsia slovaca in ticks from wild boars, northeastern Italy. Animals 2022, 12, 967. [Google Scholar] [CrossRef] [PubMed]
  23. Ortuño, A.; Lopez-Claessens, S.; Castella, J.; Sanfeliu, I.; Anton, E.; Segura-Porta, F. The role of wild boar (Sus scrofa) in the eco-epidemiology of R. slovaca in northeastern Spain. Vector-Borne Zoo Dis. 2007, 7, 59–64. [Google Scholar] [CrossRef]
  24. Motoi, Y.; Asano, M.; Inokuma, H.; Ando, S.; Kawabata, H.; Takano, A. Detection of Rickettsia tamurae DNA in ticks and wild boar (Sus scrofa leucomystax) skins in Shimane Prefecture, Japan. J. Vet. Med. Sci. 2012, 75, 263–267. [Google Scholar] [CrossRef] [PubMed]
  25. Kmetiuk, L.B.; Krawczak, F.S.; Machado, F.P.; Paploski, I.A.D.; Martins, T.F.; Teider-Junior, P.I.; Serpa, M.C.A.; Barbieri, A.R.; Bach, R.V.; Barros-Filho, I.R.; et al. Ticks and serosurvey of anti- Rickettsia spp. antibodies in wild boars (Sus scrofa), hunting dogs and hunters of Brazil. PLoS Negl. Trop. Dis. 2019, 13, e0007405. [Google Scholar] [CrossRef] [PubMed]
  26. Kmetiuk, L.B.; Martins, T.F.; Bach, R.V.W.; Martins, C.M. Risk factors associated with ticks and Rickettsia spp. exposure in wild boars (Sus scrofa), hunting dogs, and hunters of Brazil. Vet World 2021, 14, 2745–2749. [Google Scholar] [CrossRef] [PubMed]
  27. Genov, P.V. A review of the cranial characteristics of the Wild Boar (Susscrofa Linnaeus 1758), with systematic conclusions. Mammal Rev. 1999, 29, 205–234. [Google Scholar] [CrossRef]
  28. Albarella, U.; Dobney, K.; Rowley-Conwy, P. Size and shape of the Eurasian wild boar (Sus scrofa), with a view to the reconstruction of its Holocene history. Environ. Archaeol. 2009, 14, 103–136. [Google Scholar] [CrossRef]
  29. Markov, N.; Economov, A.; Hjeljord, O.; Rolandsen, C.M.; Bergqvist, G.; Danilov, P.; Senchik, A. The wild boar Sus scrofa in northern Eurasia: A review of range expansion history, current distribution, factors affecting the northern distributional limit, and management strategies. Mammal Rev. 2022, 52, 10–12. [Google Scholar] [CrossRef]
  30. Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.L.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar] [CrossRef] [PubMed]
  31. Alberti, A.; Zobba, R.; Chessa, B.; Addis, M.F.; Sparagano, O.; Pinna Parpaglia, M.L.; Cubeddu, T.; Pintori, G.; Pittau, M. Equine and canine Anaplasma phagocytophilum strains isolated on the island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United States. Appl. Environ. Microbiol. 2005, 71, 6418–6422. [Google Scholar] [CrossRef]
  32. Hornok, S.; Szőke, K.; Kováts, D.; Estók, P.; Görfö, T.; Boldogh, S.A.; Takács, N.; Kontschán, J.; Földvári, G.; Barti, L.; et al. DNA of Piroplasms of ruminants and dogs in Ixodid bat ticks. PLoS ONE 2016, 11, e0167735. [Google Scholar] [CrossRef]
  33. Coipan, E.C.; Fonville, M.; Tijsse-Klasen, E.; van der Giessen, J.W.; Takken, W.; Sprong, H. Geodemographic analysis of Borrelia burgdorferi sensu lato using the 5S-23S rDNA spacer region. Infect. Genet. Evol. 2013, 17, 216–222. [Google Scholar] [CrossRef] [PubMed]
  34. Siarkou, V.I.; Mylonakis, M.E.; Bourtzi-Hatzopoulou, E.; Koutinas, A.F. Sequence and phylogenetic analysis of the 16S rRNA gene of Ehrlichia canis strains in dogs with clinical monocytic ehrlichiosis. Vet. Microbiol. 2007, 125, 304–312. [Google Scholar] [CrossRef]
  35. Leitner, M.; Yitzhaki, S.; Rzotkiewicz, S.; Keysary, A. Polymerase chain reaction-based diagnosis of Mediterranean spotted fever in serum and tissue samples. Am. J. Trop. Med. Hyg. 2002, 67, 166–169. [Google Scholar] [CrossRef] [PubMed]
  36. Jahfari, S.; Coipan, E.C.; Fonville, M.; Leeuwen, A.D.V.; Hengeveld, P.; Heylen, D.; Heyman, P.; Maanen, C.V.; Butler, C.M.; Földvári, G.; et al. Circulation of four Anaplasma phagocytophilum ecotypes in Europe. Parasites Vector 2014, 7, 365. [Google Scholar] [CrossRef] [PubMed]
  37. Portillo, A.; Santibáñez, S.; García-Álvarez, L.; Palomar, A.M.; Oteo, J.A. Rickettsioses in Europe. Microbes Infect. 2015, 17, 834–838. [Google Scholar] [CrossRef] [PubMed]
  38. Pereira, A.; Parreira, R.; Nunes, M.; Casadinho, A.; Vieira, M.L.; Campino, L.; Maia, C. Molecular detection of tick-borne bacteria and protozoa in cervids and wild boars from Portugal. Parasites Vectors 2016, 9, 251. [Google Scholar] [CrossRef] [PubMed]
  39. Guccione, C.; Colomba, C.; Iaria, C.; Cascio, A. Rickettsiales in the WHO European Region: An update from a One Health perspective. Parasites Vectors. 2023, 16, 41. [Google Scholar] [CrossRef]
  40. Mihalca, A.D.; Dumitrache, M.O.; Magdaş, C.; Gherman, C.M.; Domşa, C.; Mircean, V.; Sándor, A.D. Synopsis of the hard ticks (Acari: Ixodidae) of Romania with update on host associations and geographical distribution. Exp. Appl. Acaro 2012, 58, 183–206. [Google Scholar] [CrossRef]
  41. Ivan, T.; Matei, I.A.; Novac, C.Ș.; Kalmár, Z.; Borșan, S.D.; Panait, L.C.; Mihalca, A.D. Spotted Fever Group Rickettsia spp. diversity in ticks and the first report of Rickettsia hoogstraalii in Romania. Vet. Sci. 2022, 9, 343. [Google Scholar] [CrossRef]
  42. Raileanu, C.; Moutailler, S.; Porea, D.; Oslobanu, L.; Anita, D.; Anita, A.; Vayssier-Taussat, M.; Savuta, G. Molecular evidence of Rickettsia spp., Anaplasma phagocytophilum, and ‘Candidatus Neoehrlichia mikurensis’ in ticks from natural and urban habitats in eastern Romania. Vector-Borne Zoonotic Dis. 2018, 18, 343–349. [Google Scholar] [CrossRef]
  43. Borșan, S.D.; Ionică, A.M.; Galon, C.; Toma-Naic, A.; Peștean, C.; Sandor, A.D.; Moutailler, D.; Mihalca, A.D. High diversity, prevalence, and co-infection rates of tick-borne pathogens in ticks and wildlife hosts in an urban area in Romania. Front. Microbiol. 2021, 12, 645002. [Google Scholar] [CrossRef]
  44. Mǎrcuţan, I.D.; Kalmár, Z.; IonicǍ, A.M.; D’Amico, G.; Mihalca, A.D.; Vasile, C.; Sándor, A.D. Spotted fever group rickettsiae in ticks of migratory birds in Romania. Parasites Vector 2016, 9, 3–9. [Google Scholar] [CrossRef]
  45. Sándor, A.D.; Kalmár, Z.; Matei, I.; Ionică, A.M.; Mărcuțan, I.D. Urban Breeding Corvids as Disseminators of Ticks and tick-borne pathogens. Vector Borne Zoonotic Dis. 2017, 17, 152–154. [Google Scholar] [CrossRef]
  46. Matei, I.A.; Corduneanu, A.; Sándor, A.D.; Ionica, A.M.; Panait, L.; Kalmár, Z.; Ivan, T.; Papuc, I.; Bouari, C.; Fit, N.; et al. Rickettsia spp. in bats of Romania: High prevalence of Rickettsia monacensis in two insectivorous bat species. Parasites Vectors 2021, 14, 1–9. [Google Scholar]
  47. Nilsson, K.; Lindquist, O.; Påhlson, C. Association of Rickettsia helvetica with chronic perimy ocarditis in sudden cardiac death. Lancet 1999, 354, 1169–1173. [Google Scholar] [CrossRef]
  48. Fournier, P.; Allombert, C.; Supputamongkol, Y.; Caruso, G.; Brouqui, P.; Raoult, D. Aneruptive Fever Associated with Antibodies to Rickettsia helvetica in Europe and Thailand. J. Clin. Microbiol. 2004, 42, 816–818. [Google Scholar] [CrossRef] [PubMed]
  49. Jado, I.; Oteo, J.A.; Aldámiz, M.; Gil, H.; Escudero, R.; García-amil, C.; Rodríguez-moreno, I.; Anda, P. Rickettsia monacensis and human disease, Spain. Emerg. Infect Dis. 2007, 13, 1405–1407. [Google Scholar] [CrossRef] [PubMed]
  50. Boretti, F.S.; Perreten, A.; Meli, M.L.; Cattori, V.; Willi, B.; Wengi, N.; Honegger, H.; Hegglin, D.; Reusch, C.E.; Lutz, H.; et al. Molecular Investigations of Rickettsia helvetica Infection in Dogs, Foxes, Humans, and Ixodes ticks. App. Environ. Microbiol. 2009, 75, 3230–3237. [Google Scholar] [CrossRef] [PubMed]
  51. Madeddu, G.; Mancini, F.; Caddeo, A.; Ciervo, A.; Babudieri, S.; Maida, I.; Mura, M.S. Rickettsia monacensis as Cause of Mediterranean Spotted Fever – like Illness, Italy. Emerg. Infect. Dis. 2012, 18, 702–704. [Google Scholar] [CrossRef]
  52. Kiss, T.; Cadar, D.; Krupaci, A.F.; Bordeanu, A.; Brudaşcǎ, G.F.; Mihalca, A.D.; Mircean, V.; Gliga, L.; Dumitrache, M.O.; Spînu, M. Serological reactivity to Borrelia burgdorferi sensu lato in dogs and horses from distinct areas in Romania. Vector-Borne Zoonotic Dis. 2011, 11, 1259–1262. [Google Scholar] [CrossRef]
  53. Michalik, J.; Stańczak, J.; Cieniuch, S.; Racewicz, M.; Sikora, B.; Dabert, M. Wild Boars as Hosts of Human- Pathogenic Anaplasma phagocytophilum Variants. Emerg. Infect. Dis. 2012, 18, 2094–2095. [Google Scholar] [CrossRef]
  54. Huhn, C.; Winter, C.; Wolfsperger, T.; Wüppenhorst, N.; Strašek Smrdel, K.; Skuballa, J.; Von Loewenich, F.D. Analysis of the population structure of Anaplasma phagocytophilum using multilocus sequence typing. PLoS ONE 2014, 9, e93725. [Google Scholar] [CrossRef] [PubMed]
  55. Smrdel, K.S.; Bidovec, A.; Malovrh, T.; Petrovec, M.; Duh, D.; Zupanc, T.A. Detection of Anaplasma phagocytophilum in wild boar in Slovenia. Clin. Microbiol. Infect. 2008, 15, 50–52. [Google Scholar] [CrossRef] [PubMed]
Animals 13 01743 g001 550
Figure 1. Phylogenetic tree based on groEL gene of A. phagocytophilum.
Figure 1. Phylogenetic tree based on groEL gene of A. phagocytophilum.
Animals 13 01743 g001
Animals 13 01743 g002 550
Figure 2. Phylogenetic tree based on 17 kDa surface antigen coding gene of Rickettsia species distributed in Europe. *—isolates were obtained from the mentioned tick species collected from the mentioned hosts.
Figure 2. Phylogenetic tree based on 17 kDa surface antigen coding gene of Rickettsia species distributed in Europe. *—isolates were obtained from the mentioned tick species collected from the mentioned hosts.
Animals 13 01743 g002
Table
Table 1. Primer sequences used for each pathogen and gene.
Table 1. Primer sequences used for each pathogen and gene.
PathogenPrimer Name and SequenceGene Reference
Anaplasma spp./
A. phagocytophilum		Ge3a: CACATGCAAGTCGAACGGATTATTC
Ge10: TTCCGTTAAGAAGGATCTAATCTCC
Ge2: AACGGATTATTCTTTATAGCTTGCT
Ge9: GGCAGTATTAAAAGCAGCTCCAGG		16S rRNA[30]
A. phagocytophilumEphplgroEL(569)F: ATGGTATGCAGTTTGATCGC
EphplgroEL(1193)R: TCTACTCTGTCTTTGCGTTC
EphgroEL(1142)R: TTGAGTACAGCAACACCACCGGAA		groEL[31]
Babesia/Theileria spp.,BJ1: GTCTTGTAATTGGAATGATGG
BN2: TAGTTTATGGTTAGGACTACG		18S rRNA[32]
Borrelia spp.5SCB: GAGTTCGCGGGAGAGTAGGTTATTGCC
23SN: TCAGGGTACTTAGATGGTTCACTTCC		IGS[33]
Ehrlichia spp./
E. canis		ECC: AGAACGAACGCTGGCGGCAAGCC
ECB: CGTATTACCGCGGCTGCTGGCA
Canis: CAATTATTTATAGCCTCTGGCTATAGGA
HE3: TATAGGTACCGTCATTATCTTCCCTAT		16S rRNA[34]
SFG Rickettsia spp.17DrikP3 GGAACACTTCTTGGCGGTG
17DrikP2 CATTGTCCGTCAGGTTGGCG
17DrikP4 GAGAGATGCTTATGGTAAGAC
17DrikP5 GAGAGATGCTTATGGTAAGAC		17 kDA[35]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Matei, I.A.; Kalmár, Z.; Balea, A.; Mihaiu, M.; Sándor, A.D.; Cocian, A.; Crăciun, S.; Bouari, C.; Briciu, V.T.; Fiț, N. The Role of Wild Boars in the Circulation of Tick-Borne Pathogens: The First Evidence of Rickettsia monacensis Presence. Animals 2023, 13, 1743. https://doi.org/10.3390/ani13111743

AMA Style

Matei IA, Kalmár Z, Balea A, Mihaiu M, Sándor AD, Cocian A, Crăciun S, Bouari C, Briciu VT, Fiț N. The Role of Wild Boars in the Circulation of Tick-Borne Pathogens: The First Evidence of Rickettsia monacensis Presence. Animals. 2023; 13(11):1743. https://doi.org/10.3390/ani13111743

Chicago/Turabian Style

Matei, Ioana Adriana, Zsuzsa Kalmár, Anamaria Balea, Marian Mihaiu, Attila D. Sándor, Adrian Cocian, Smaranda Crăciun, Cosmina Bouari, Violeta Tincuța Briciu, and Nicodim Fiț. 2023. "The Role of Wild Boars in the Circulation of Tick-Borne Pathogens: The First Evidence of Rickettsia monacensis Presence" Animals 13, no. 11: 1743. https://doi.org/10.3390/ani13111743

APA Style

Matei, I. A., Kalmár, Z., Balea, A., Mihaiu, M., Sándor, A. D., Cocian, A., Crăciun, S., Bouari, C., Briciu, V. T., & Fiț, N. (2023). The Role of Wild Boars in the Circulation of Tick-Borne Pathogens: The First Evidence of Rickettsia monacensis Presence. Animals, 13(11), 1743. https://doi.org/10.3390/ani13111743

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop