Peripheral and Central Impact of Methionine Source and Level on Growth Performance, Circulating Methionine Levels and Metabolism in Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethic Statement
2.2. Bird Husbandry
2.3. Feeding Experiment
2.4. Intracerebroventricular Experiment
2.5. Measurement of Plasma Methionine and HMTBa
2.6. RNA Isolation, Reverse Transcription, and Quantitative Real-Time PCR
2.7. Statistics
3. Results
3.1. Feeding Trial
3.2. ICV Experiment
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Kidd, M.T.; Tillman, P.B.; Waldroup, P.W.; Holder, W. Feed-grade amino acid use in the United States: The synergetic inclusion history with linear programming. J. Appl. Poult. Res. 2013, 22, 583–590. [Google Scholar] [CrossRef]
- Vázquez-Añón, M.; González-Esquerra, R.; Saleh, E.; Hampton, T.; Ritcher, S.; Firman, J.; Knight, C. Evidence for 2-Hydroxy-4(Methylthio) Butanoic Acid and dl-Methionine Having Different Dose Responses in Growing Broilers. Poult. Sci. 2006, 85, 1409–1420. [Google Scholar] [CrossRef]
- Boorman, K.N.; Fisher, H. The arginine-lysine interaction in the chick. Br. Poult. Sci. 1966, 7, 39–44. [Google Scholar] [CrossRef]
- Edmonds, M.S.; Baker, D.H. Comparative Effects of Individual Amino Acid Excesses when Added to a Corn-Soybean Meal Diet: Effects on Growth and Dietary Choice in the Chick. J. Anim. Sci. 1987, 65, 699–705. [Google Scholar] [CrossRef] [Green Version]
- Miles, D.M.; Lott, B.D.; Branton, S.L.; Simmons, J.D. Development of a Water Stick to Measure Nipple Waterer Flow Rates. J. Appl. Poult. Res. 2004, 13, 258–262. [Google Scholar] [CrossRef]
- Greenwood, M.W.; Cramer, K.R.; Clark, P.M.; Behnke, K.C.; Beyer, R.S. Influence of feed form on dietary lysine and energy intake and utilization of broilers from 14 to 30 days of age. Int. J. Poult. Sci. 2004, 3, 189–194. [Google Scholar]
- Piekarski, A.; Nagarajan, G.; Ishola, P.; Flees, J.; Greene, E.S.; Kuenzel, W.J.; Ohkubo, T.; Maier, H.; Bottje, W.G.; Cline, M.A.; et al. AMP-Activated Protein Kinase Mediates the Effect of Leptin on Avian Autophagy in a Tissue-Specific Manner. Front. Physiol. 2018, 9, 541. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davis, J.L.; Masuoka, D.T.; Gerbrandt, L.K.; Cherkin, A. Autoradiographic distribution of L-proline in chicks after intracerebral injection. Physiol. Behav. 1979, 22, 693–695. [Google Scholar] [CrossRef]
- Kuenzel, W.J.; Masson, M. A Stereotaxic Atlas of the Brain of the Chick. (Gallus domesticus); Johns Hopkins University Press: Baltimore, MD, USA, 1988. [Google Scholar]
- Rajaei-Sharifabadi, H.; Ellestad, L.; Porter, T.; Donoghue, A.; Bottje, W.G.; Dridi, S. Noni (Morinda citrifolia) Modulates the Hypothalamic Expression of Stress- and Metabolic-Related Genes in Broilers Exposed to Acute Heat Stress. Front. Genet. 2017, 8, 192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dhamad, A.; Greene, E.; Sales, M.; Nguyen, P.; Beer, L.; Liyanage, R.; Dridi, S. 75-kDa glucose-regulated protein (GRP75) is a novel molecular signature for heat stress response in avian species. Am. J. Physiol. Physiol. 2020, 318, C289–C303. [Google Scholar] [CrossRef] [PubMed]
- Ferver, A.; Dridi, S. Regulation of avian uncoupling protein (av-UCP) expression by cytokines and hormonal signals in quail myoblast cells. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2020, 248, 110747. [Google Scholar] [CrossRef] [PubMed]
- Dridi, S.; Hirano, Y.; Tarallo, V.; Kim, Y.; Fowler, B.J.; Ambati, B.K.; Bogdanovich, S.; Chiodo, V.A.; Hauswirth, W.W.; Kugel, J.F.; et al. ERK1/2 activation is a therapeutic target in age-related macular degeneration. Proc. Natl. Acad. Sci. USA 2012, 109, 13781–13786. [Google Scholar] [CrossRef] [Green Version]
- Greene, E.S.; Zampiga, M.; Sirri, F.; Ohkubo, T.; Dridi, S. Orexin system is expressed in avian liver and regulates hepatic lipogenesis via ERK1/2 activation. Sci. Rep. 2020, 10, 19191. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Brugaletta, G.; Greene, E.; Tabler, T.; Orlowski, S.; Sirri, F.; Dridi, S. Effect of Cyclic Heat Stress on Feeding-Related Hypothalamic Neuropeptides of Three Broiler Populations and Their Ancestor Jungle Fowl. Front. Physiol. 2021, 12, 809341. [Google Scholar] [CrossRef]
- Piekarski, A.; Decuypere, E.; Buyse, J.; Dridi, S. Chenodeoxycholic acid reduces feed intake and modulates the expression of hypothalamic neuropeptides and hepatic lipogenic genes in broiler chickens. Gen. Comp. Endocrinol. 2016, 229, 74–83. [Google Scholar] [CrossRef]
- Nguyen, P.; Greene, E.; Ishola, P.; Huff, G.; Donoghue, A.; Bottje, W.; Dridi, S. Chronic Mild Cold Conditioning Modulates the Expression of Hypothalamic Neuropeptide and Intermediary Metabolic-Related Genes and Improves Growth Performances in Young Chicks. PLoS ONE 2015, 10, e0142319. [Google Scholar] [CrossRef]
- Agostini, P.S.; Dalibard, P.; Mercier, Y.; Van der Aar, P.; Van der Klis, J.D. Comparison of methionine sources around requirement levels using a methionine efficacy method in 0 to 28 day old broilers. Poult. Sci. 2016, 95, 560–569. [Google Scholar] [CrossRef]
- Macelline, S.P.; Chrystal, P.V.; McQuade, L.R.; Mclnerney, B.V.; Kim, Y.; Bao, Y.; Selle, P.H.; Liu, S.Y. Graded methionine dietary inclusions influence growth performance and apparent ileal amino acid digestibility coefficients and disappearance rates in broiler chickens. Anim. Nutr. 2021, 8, 160–168. [Google Scholar] [CrossRef] [PubMed]
- Vantress, C. Broiler Performance & Nutrition Supplement Cobb500; Cobb-Vantress Inc.: Springdale, AR, USA, 2018. [Google Scholar]
- Han, Y.; Baker, D.H. Effects of Excess Methionine or Lysine for Broilers Fed a Corn-Soybean Meal Diet. Poult. Sci. 1993, 72, 1070–1074. [Google Scholar] [CrossRef] [PubMed]
- To, V.P.T.H.; Masagounder, K.; Loewen, M.E. Critical transporters of methionine and methionine hydroxy analogue supplements across the intestine: What we know so far and what can be learned to advance animal nutrition. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2021, 255, 110908. [Google Scholar] [CrossRef]
- Elizondo-Vega, R.; Oyarce, K.; Salgado, M.; Barahona, M.J.; Recabal, A.; Ordenes, P.; López, S.; Pincheira, R.; Luz-Crawford, P.; García-Robles, M.A. Inhibition of Hypothalamic MCT4 and MCT1–MCT4 Expressions Affects Food Intake and Alters Orexigenic and Anorexigenic Neuropeptide Expressions. Mol. Neurobiol. 2019, 57, 896–909. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramser, A.; Dridi, S. Avian Orexin: Feed Intake Regulator or Something Else? Vet.-Sci. 2022, 9, 112. [Google Scholar] [CrossRef] [PubMed]
- Sakurai, T. The role of orexin in motivated behaviours. Nat. Rev. Neurosci. 2014, 15, 719–731. [Google Scholar] [CrossRef] [PubMed]
- Parsons, M.P.; Hirasawa, M. ATP-Sensitive Potassium Channel-Mediated Lactate Effect on Orexin Neurons: Implications for Brain Energetics during Arousal. J. Neurosci. 2010, 30, 8061–8070. [Google Scholar] [CrossRef] [Green Version]
- Brachet, P.; Puigserver, A. Na+-independent and nonstereospecific transport of 2-hydroxy 4-methylthiobutanoic acid by brush border membrane vesicles from chick small intestine. Comp. Biochem. Physiol. Part B Comp. Biochem. 1989, 94, 157–163. [Google Scholar] [CrossRef]
- Maenz, D.D.; Engele-Schaan, C.M. Methionine and 2-Hydroxy-4-Methylthiobutanoic Acid Are Transported by Distinct Na+-Dependent and H+-Dependent Systems in the Brush Border Membrane of the Chick Intestinal Epithelium. J. Nutr. 1996, 126, 529–536. [Google Scholar] [CrossRef] [Green Version]
- Zaragozá, R. Transport of Amino Acids Across the Blood-Brain Barrier. Front. Physiol. 2020, 11, 973. [Google Scholar] [CrossRef]
- Bungo, T.; Shiraishi, J.I. Effect of centrally administered methionine or related compounds on feeding behavior in chicks. J. Appl. Anim. Res. 2010, 38, 197–200. [Google Scholar] [CrossRef] [Green Version]
- Cao, C.; Gilbert, E.R.; Cline, M.A. DNA methylation-modifiers reduced food intake in juvenile chickens (Gallus gallus) and Japanese quail (Coturnix japonica). Neurosci. Lett. 2021, 764, 136230. [Google Scholar] [CrossRef]
- Karnani, M.M.; Apergis-Schoute, J.; Adamantidis, A.; Jensen, L.T.; de Lecea, L.; Fugger, L.; Burdakov, D. Activation of Central Orexin/Hypocretin Neurons by Dietary Amino Acids. Neuron 2011, 72, 616–629. [Google Scholar] [CrossRef] [Green Version]
- Cortes-Campos, C.; Elizondo, R.; Carril, C.; Martínez, F.; Boric, K.; Nualart, F.; Garcia-Robles, M.A. MCT2 Expression and Lactate Influx in Anorexigenic and Orexigenic Neurons of the Arcuate Nucleus. PLoS ONE 2013, 8, e62532. [Google Scholar] [CrossRef] [Green Version]
- Lam, C.K.L.; Chari, M.; Wang, P.Y.T.; Lam, T.K.T. Central lactate metabolism regulates food intake. Am. J. Physiol. Metab. 2008, 295, E491–E496. [Google Scholar] [CrossRef] [Green Version]
- Elizondo-Vega, R.; Cortés-Campos, C.; Barahona, M.J.; Carril, C.; Ordenes, P.; Salgado, M.; Oyarce, K.; García-Robles, M.D.L.A. Inhibition of hypothalamic MCT1 expression increases food intake and alters orexigenic and anorexigenic neuropeptide expression. Sci. Rep. 2016, 6, 33606. [Google Scholar] [CrossRef] [Green Version]
- Matsuyama, S.; Ohkura, S.; Iwata, K.; Uenoyama, Y.; Tsukamura, H.; Maeda, K.-I.; Kimura, K. Food Deprivation Induces Monocarboxylate Transporter 2 Expression in the Brainstem of Female Rat. J. Reprod. Dev. 2009, 55, 256–261. [Google Scholar] [CrossRef] [Green Version]
- Ruud, L.E.; Pereira, M.M.A.; de Solis, A.J.; Fenselau, H.; Brüning, J.C. NPY mediates the rapid feeding and glucose metabolism regulatory functions of AgRP neurons. Nat. Commun. 2020, 11, 442. [Google Scholar] [CrossRef] [Green Version]
- Mercer, R.E.; Chee, M.J.S.; Colmers, W.F. The role of NPY in hypothalamic mediated food intake. Front. Neuroendocrinol. 2011, 32, 398–415. [Google Scholar] [CrossRef] [PubMed]
- Elau, J.; Eherzog, H. CART in the regulation of appetite and energy homeostasis. Front. Neurosci. 2014, 8, 313. [Google Scholar] [CrossRef] [Green Version]
- Rogge, G.; Jones, D.; Hubert, G.W.; Lin, Y.; Kuhar, M.J. CART peptides: Regulators of body weight, reward and other functions. Nat. Rev. Neurosci. 2008, 9, 747–758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lau, J.; Farzi, A.; Qi, Y.; Heilbronn, R.; Mietzsch, M.; Shi, Y.-C.; Herzog, H. CART neurons in the arcuate nucleus and lateral hypothalamic area exert differential controls on energy homeostasis. Mol. Metab. 2017, 7, 102–118. [Google Scholar] [CrossRef] [PubMed]
- Cota, D.; Proulx, K.; Blake Smith, K.A.; Kozma, S.C.; Thomas, G.; Woods, S.C.; Seeley, R.J. Hypothalamic mTOR signaling regulates food intake. Science 2006, 312, 927–930. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Ren, J.; Song, T.; Peng, J.; Wei, H. Methionine Regulates mTORC1 via the T1R1/T1R3-PLCβ-Ca2+-ERK1/2 Signal Transduction Process in C2C12 Cells. Int. J. Mol. Sci. 2016, 17, 1684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, Y.; Zhou, Z.; Peng, J.; Loor, J. Methionine and valine activate the mammalian target of rapamycin complex 1 pathway through heterodimeric amino acid taste receptor (TAS1R1/TAS1R3) and intracellular Ca2+ in bovine mammary epithelial cells. J. Dairy Sci. 2018, 101, 11354–11363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qi, H.; Wang, L.; Zhang, M.; Wang, Z.; Gao, X.; Li, M. Methionine and leucine induce ARID1A degradation to promote mTOR expression and milk synthesis in mammary epithelial cells. J. Nutr. Biochem. 2021, 101, 108924. [Google Scholar] [CrossRef] [PubMed]
- Sutter, B.M.; Wu, X.; Laxman, S.; Tu, B.P. Methionine Inhibits Autophagy and Promotes Growth by Inducing the SAM-Responsive Methylation of PP2A. Cell 2013, 154, 403–415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shen, J.; Sun, B.; Yu, C.; Cao, Y.; Cai, C.; Yao, J. Choline and methionine regulate lipid metabolism via the AMPK signaling pathway in hepatocytes exposed to high concentrations of nonesterified fatty acids. J. Cell. Biochem. 2019, 121, 3667–3678. [Google Scholar] [CrossRef]
- Inoki, K.; Zhu, T.; Guan, K.-L. TSC2 Mediates Cellular Energy Response to Control Cell Growth and Survival. Cell 2003, 115, 577–590. [Google Scholar] [CrossRef] [Green Version]
- Gwinn, D.M.; Shackelford, D.B.; Egan, D.F.; Mihaylova, M.M.; Mery, A.; Vasquez, D.S.; Turk, B.E.; Shaw, R.J. AMPK Phosphorylation of Raptor Mediates a Metabolic Checkpoint. Mol. Cell 2008, 30, 214–226. [Google Scholar] [CrossRef] [Green Version]
- Hallett, J.E.H.; Luo, X.; Capaldi, A.P. Snf1/AMPK promotes the formation of Kog1/Raptor-bodies to increase the activation threshold of TORC1 in budding yeast. Elife 2015, 4, e09181. [Google Scholar] [CrossRef]
- Kazyken, D.; Magnuson, B.; Bodur, C.; Acosta-Jaquez, H.A.; Zhang, D.; Tong, X.; Barnes, T.M.; Steinl, G.K.; Patterson, N.E.; Altheim, C.H.; et al. AMPK directly activates mTORC2 to promote cell survival during acute energetic stress. Sci. Signal. 2019, 12, eaav3249. [Google Scholar] [CrossRef]
- Tu, Y.; Fang, Q.-J.; Sun, W.; Liu, B.-H.; Liu, Y.-L.; Wu, W.; Yee, H.-Y.; Yuan, C.-C.; Wang, M.-Z.; Wan, Z.-Y.; et al. Total Flavones of Abelmoschus manihot Remodels Gut Microbiota and Inhibits Microinflammation in Chronic Renal Failure Progression by Targeting Autophagy-Mediated Macrophage Polarization. Front. Pharmacol. 2020, 11, 566611. [Google Scholar] [CrossRef]
- Findrik, Z.; Vasić-Rački, Đ. Biotransformation ofD-methionine intoL-methionine in the cascade of four enzymes. Biotechnol. Bioeng. 2007, 98, 956–967. [Google Scholar] [CrossRef] [PubMed]
- Gu, X.; Orozco, J.M.; Saxton, R.A.; Condon, K.J.; Liu, G.Y.; Krawczyk, P.A.; Scaria, S.M.; Harper, J.W.; Gygi, S.P.; Sabatini, D.M. SAMTOR is an S -adenosylmethionine sensor for the mTORC1 pathway. Science 2017, 358, 813–818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, X.; Zhang, Y.; Wang, G.; Zhang, C.; Wang, F.; Shi, J.; Zhang, T.; Ding, J. Molecular mechanism of S -adenosylmethionine sensing by SAMTOR in mTORC1 signaling. Sci. Adv. 2022, 8, eabn3868. [Google Scholar] [CrossRef] [PubMed]
Ingredient, % As-Is | Starter | Grower |
---|---|---|
Corn | 57.24 | 63.17 |
Soybean meal | 34.73 | 28.74 |
Meat and bone meal | 3.00 | 3.00 |
Poultry fat | 2.38 | 2.55 |
L-lysine HCl | 0.11 | 0.13 |
L-threonine | 0.01 | 0.02 |
Salt | 0.32 | 0.31 |
Dicalcium phosphate | 0.28 | 0.17 |
Choline chloride, 60% | 0.05 | 0.06 |
Limestone | 0.97 | 0.95 |
Corn starch | 0.11–0.37 | 0.12–0.35 |
HMTBa | 0.00–0.50 | 0.00–0.45 |
DL-Met | 0.00–0.43 | 0.00–0.38 |
Phytase | 0.01 | 0.01 |
Sodium bicarbonate | 0.17 | 0.19 |
Mineral premix 2 | 0.10 | 0.10 |
Vitamin premix 3 | 0.10 | 0.10 |
Calculated composition, % unless noted otherwise 4 | ||
AME, kcal/kg | 3031 | 3108 |
CP | 23.08 | 20.70 |
Ca | 0.92 | 0.87 |
Available P | 0.46 | 0.43 |
Na | 0.20 | 0.20 |
Digestible lysine | 1.20 | 1.07 |
Digestible threonine | 0.79 | 0.72 |
HMTBa 63 | HMTBa 75 | HMTBa 87 | DL-Met 63 | DL-Met 75 | DL-Met 87 | ||
---|---|---|---|---|---|---|---|
Starter | |||||||
Total Met | A | 0.37 | 0.35 | 0.36 | 0.50 | 0.65 | 0.81 |
Total TSAA | A | 0.71 | 0.67 | 0.69 | 0.85 | 0.99 | 1.13 |
HMTBa 1 | C | 0.148 | 0.296 | 0.445 | 0.000 | 0.000 | 0.000 |
HMTBa | A | 0.144 | 0.294 | 0.383 | 0.029 | 0.001 | 0.001 |
DL-Met | C | 0.000 | 0.000 | 0.000 | 0.143 | 0.285 | 0.428 |
DL-Met | A | 0.010 | 0.010 | 0.010 | 0.100 | 0.230 | 0.380 |
Grower | |||||||
Total Met | A | 0.34 | 0.33 | 0.32 | 0.43 | 0.54 | 0.72 |
Total TSAA | A | 0.66 | 0.64 | 0.63 | 0.73 | 0.85 | 1.02 |
HMTBa 1 | C | 0.131 | 0.263 | 0.394 | 0.000 | 0.000 | 0.000 |
HMTBa | A | 0.103 | 0.206 | 0.428 | 0.001 | 0.001 | 0.001 |
DL-Met | C | 0.000 | 0.000 | 0.000 | 0.127 | 0.253 | 0.380 |
DL-Met | A | 0.000 | 0.000 | 0.000 | 0.110 | 0.190 | 0.290 |
Gene | Accession Number a | Primer Sequence (5’ → 3’) | Orientation | Product Size (bp) |
---|---|---|---|---|
MCT1 | NM_001006323 | GCATCTTTGGGAGTTCTGTTGAT | Forward | 69 |
CCTATCGTGCTCCAACAAACC | Reverse | |||
MCT2 | NM_001199604 | TCTGGGTTTGGCATTCAACTT | Forward | 66 |
CGCTTCTTATAGAAATACTTGCCAATC | Reverse | |||
MCT3 | NM_205140 | GGGTCCGCCCTCATGTG | Forward | 69 |
TGTCGAGCCATTGAAGAGCAT | Reverse | |||
DAO | XM_040684675 | ATGGAACACCATGGGATAGAAGA | Forward | 63 |
CCTTACCATTGCCACAGAAATG | Reverse | |||
HAO | NM_001199442 | CTAGCTCTGGGCGCCAAA | Forward | 58 |
AAACCAAGCCCCAGATGAGA | Reverse |
Treatment 1 | BW, d 35 | BWG | FI | FCR | Mortality | |
---|---|---|---|---|---|---|
Source | Level | (kg) | (kg) | (kg) | (g:g) | (%) |
Interactive effects of methionine level and source (n = 10) | ||||||
HMTBa | 63 | 2.804 | 2.763 | 3.937 | 1.455 | 6.67 |
HMTBa | 75 | 2.942 | 2.902 | 3.972 | 1.402 | 8.10 |
HMTBa | 87 | 2.936 | 2.895 | 3.875 | 1.383 | 9.52 |
DL-Met | 63 | 2.921 | 2.880 | 3.949 | 1.414 | 10.00 |
DL-Met | 75 | 2.973 | 2.933 | 3.936 | 1.376 | 10.95 |
DL-Met | 87 | 2.911 | 2.870 | 3.897 | 1.399 | 10.48 |
SEM | 0.0335 | 0.0335 | 0.0299 | 0.0155 | 2.081 | |
Main effect of methionine level (n = 20) | ||||||
63 | 2.862 b | 2.822 b | 3.943 | 1.434 a | 8.33 | |
75 | 2.958 a | 2.917 a | 3.954 | 1.389 b | 9.52 | |
87 | 2.924 a,b | 2.883 a,b | 3.886 | 1.391 b | 10.00 | |
SEM | 0.0237 | 0.0237 | 0.0211 | 0.0110 | 1.472 | |
Main effect of methionine source (n = 60) | ||||||
HMTBa | 2.894 | 2.853 | 3.928 | 1.413 | 8.10 | |
DL-Met | 2.935 | 2.895 | 3.927 | 1.396 | 10.48 | |
SEM | 0.0194 | 0.0193 | 0.0173 | 0.0090 | 1.202 | |
p-value | ||||||
Interaction | 0.114 | 0.110 | 0.582 | 0.187 | 0.833 | |
Source | 0.137 | 0.136 | 0.981 | 0.188 | 0.167 | |
Level | 0.021 | 0.020 | 0.057 | 0.007 | 0.713 |
Treatment 1 | BW, d 7 | BWG | FI | FCR | |
---|---|---|---|---|---|
Source | Level | (kg) | (kg) | (kg) | (g:g) |
Interactive effects of methionine level and source (n = 10) | |||||
HMTBa | 63 | 0.170 a | 0.129 a | 0.142 | 1.106 |
HMTBa | 75 | 0.177 a | 0.137 a | 0.146 | 1.077 |
HMTBa | 87 | 0.175 a | 0.135 a | 0.143 | 1.073 |
DL-Met | 63 | 0.178 a | 0.137 a | 0.146 | 1.072 |
DL-Met | 75 | 0.176 a | 0.136 a | 0.143 | 1.066 |
DL-Met | 87 | 0.173 a | 0.132 a | 0.143 | 1.099 |
SEM | 0.0021 | 0.0020 | 0.0022 | 0.0126 | |
Main effect of methionine level (n = 20) | |||||
63 | 0.174 | 0.133 | 0.144 | 1.089 | |
75 | 0.177 | 0.136 | 0.145 | 1.071 | |
87 | 0.174 | 0.132 | 0.143 | 1.072 | |
SEM | 0.0015 | 0.0020 | 0.0015 | 0.0089 | |
Main effect of methionine source (n = 60) | |||||
HMTBa | 0.174 | 0.133 | 0.144 | 1.085 | |
DL-Met | 0.176 | 0.135 | 0.144 | 1.079 | |
SEM | 0.0012 | 0.0011 | 0.0012 | 0.0072 | |
p-value | |||||
Interaction | 0.031 2 | 0.022 2 | 0.341 | 0.063 | |
Source | 0.356 | 0.325 | 0.880 | 0.546 | |
Level | 0.276 | 0.207 | 0.780 | 0.325 |
Treatment 1 | BW, d 14 | BWG | FI | FCR | |
---|---|---|---|---|---|
Source | Level | (kg) | (kg) | (kg) | (g:g) |
Interactive effects of methionine level and source (n = 10) | |||||
HMTBa | 63 | 0.515 | 0.474 | 0.546 | 1.165 |
HMTBa | 75 | 0.534 | 0.494 | 0.558 | 1.143 |
HMTBa | 87 | 0.525 | 0.484 | 0.552 | 1.151 |
DL-Met | 63 | 0.528 | 0.487 | 0.553 | 1.155 |
DL-Met | 75 | 0.535 | 0.495 | 0.555 | 1.145 |
DL-Met | 87 | 0.527 | 0.486 | 0.554 | 1.157 |
SEM | 0.0056 | 0.0056 | 0.0055 | 0.0060 | |
Main effect of methionine level (n = 20) | |||||
63 | 0.521 | 0.481 | 0.549 | 1.160 a | |
75 | 0.535 | 0.494 | 0.556 | 1.144 b | |
87 | 0.526 | 0.485 | 0.553 | 1.154 a,b | |
SEM | 0.0040 | 0.0040 | 0.0039 | 0.0042 | |
Main effect of methionine source (n = 60) | |||||
HMTBa | 0.525 | 0.484 | 0.552 | 1.153 | |
DL-Met | 0.530 | 0.490 | 0.554 | 1.152 | |
SEM | 0.0032 | 0.0032 | 0.0032 | 0.0035 | |
p-value | |||||
Interaction | 0.514 | 0.497 | 0.637 | 0.387 | |
Source | 0.253 | 0.252 | 0.661 | 0.924 | |
Level | 0.055 | 0.057 | 0.425 | 0.033 |
Treatment 1 | BW, d 21 | BWG | FI | FCR | |
---|---|---|---|---|---|
Source | Level | (kg) | (kg) | (kg) | (g:g) |
Interactive effects of methionine level and source (n = 10) | |||||
HMTBa | 63 | 1.124 | 1.083 | 1.304 | 1.222 |
HMTBa | 75 | 1.142 | 1.102 | 1.316 | 1.208 |
HMTBa | 87 | 1.140 | 1.100 | 1.309 | 1.210 |
DL-Met | 63 | 1.148 | 1.108 | 1.327 | 1.219 |
DL-Met | 75 | 1.172 | 1.132 | 1.331 | 1.205 |
DL-Met | 87 | 1.137 | 1.096 | 1.312 | 1.216 |
SEM | 0.0134 | 0.0134 | 0.0131 | 0.0061 | |
Main effect of methionine level (n = 20) | |||||
63 | 1.136 | 1.096 | 1.315 | 1.220 | |
75 | 1.157 | 1.117 | 1.324 | 1.207 | |
87 | 1.139 | 1.098 | 1.310 | 1.213 | |
SEM | 0.0095 | 0.0094 | 0.0092 | 0.0043 | |
Main effect of methionine source (n = 60) | |||||
HMTBa | 1.136 | 1.095 | 1.310 | 1.213 | |
DL-Met | 1.152 | 1.112 | 1.323 | 1.213 | |
SEM | 0.0078 | 0.0077 | 0.0075 | 0.0035 | |
p-value | |||||
Interaction | 0.414 | 0.394 | 0.754 | 0.670 | |
Source | 0.135 | 0.129 | 0.209 | 0.979 | |
Level | 0.238 | 0.241 | 0.580 | 0.096 |
Treatment 1 | BW, d 28 | BWG | FI | FCR | |
---|---|---|---|---|---|
Source | Level | (kg) | (kg) | (kg) | (g:g) |
Interactive effects of methionine level and source (n = 10) | |||||
HMTBa | 63 | 1.955 | 1.914 | 2.493 | 1.326 |
HMTBa | 75 | 2.006 | 1.965 | 2.486 | 1.300 |
HMTBa | 87 | 1.997 | 1.957 | 2.467 | 1.292 |
DL-Met | 63 | 1.990 | 1.950 | 2.514 | 1.317 |
DL-Met | 75 | 2.022 | 1.981 | 2.511 | 1.294 |
DL-Met | 87 | 1.991 | 1.950 | 2.465 | 1.299 |
SEM | 0.0191 | 0.0191 | 0.0221 | 0.0051 | |
Main effect of methionine level (n = 20) | |||||
63 | 1.972 | 1.932 | 2.503 | 1.321 a | |
75 | 2.014 | 1.973 | 2.498 | 1.297 b | |
87 | 1.994 | 1.954 | 2.466 | 1.295 b | |
SEM | 0.0135 | 0.0135 | 0.0157 | 0.0036 | |
Main effect of methionine source (n = 60) | |||||
HMTBa | 1.986 | 1.945 | 2.482 | 1.306 | |
DL-Met | 2.001 | 1.961 | 2.496 | 1.303 | |
SEM | 0.0110 | 0.0110 | 0.0128 | 0.0029 | |
p-value | |||||
Interaction | 0.557 | 0.543 | 0.813 | 0.206 | |
Source | 0.334 | 0.332 | 0.424 | 0.569 | |
Level | 0.108 | 0.108 | 0.200 | <0.001 |
Treatment 1 | Methionine | HMTBa | |
---|---|---|---|
Source | Level | (mmol/mL) | (mmol/mL) |
Interactive effects of methionine level and source (n = 10) | |||
HMTBa | 63 | 64.8 d | 1.9 |
HMTBa | 75 | 103.1 c,d | 15.2 |
HMTBa | 87 | 135.3 b,c | 25.8 |
DL-Met | 63 | 109.1 c,d | 0.2 |
DL-Met | 75 | 171.2 b | 0.1 |
DL-Met | 87 | 246.4 a | 0.0 |
SEM | 12.37 | 5.24 | |
Main effect of methionine level (n = 20) | |||
63 | 86.9 c | 1.0 | |
75 | 137.2 b | 7.6 | |
87 | 190.8 a | 12.9 | |
SEM | 8.37 | 3.55 | |
Main effect of methionine source (n = 60) | |||
HMTBa | 101.1 | 14.3 | |
DL-Met | 175.6 | 0.1 | |
SEM | 6.73 | 2.85 | |
p-value | |||
Interaction | 0.023 | 0.063 | |
Source | <0.001 | 0.001 | |
Level | <0.001 | 0.069 |
Gene 1 | Control | DL-Met | Alimet | SAM |
---|---|---|---|---|
AgRP | 1 ± 0.03 | 1.30 ± 0.10 | 1.67 ± 0.40 | 1.33 ± 0.20 |
POMC | 1 ± 0.04 | 1.08 ± 0.10 | 1.51 ± 0.20 | 1.09 ± 0.09 |
NPGL | 1 ± 0.01 | 1.22 ± 0.20 | 1.57 ± 0.30 | 1.13 ± 0.10 |
Adip | 1 ± 0.01 | 2.41 ± 0.80 | 1.99 ± 0.50 | 2.26 ± 0.40 |
AdipR1 | 1 ± 0.02 | 1.33 ± 0.07 | 1.19 ± 0.10 | 0.98 ± 0.06 |
AdipR2 | 1 ± 0.01 | 1.03 ± 0.10 | 1.09 ± 0.08 | 0.85 ± 0.06 |
ORXR1 | 1 ± 0.01 | 1.02 ± 0.10 | 1.43 ± 0.30 | 0.90 ± 0.10 |
ORXR2 | 1 ± 0.01 | 1.24 ± 0.20 | 1.97 ± 0.70 | 0.74 ± 0.09 |
AMPKα2 | 1 ± 0.01 | 1.19 ± 0.30 | 1.38 ± 0.30 | 0.40 ± 0.10 |
MCT3 | 1 ± 0.01 | 1.99 ± 0.80 | 1.79 ± 0.40 | 1.35 ± 0.30 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maynard, C.W.; Gilbert, E.; Yan, F.; Cline, M.A.; Dridi, S. Peripheral and Central Impact of Methionine Source and Level on Growth Performance, Circulating Methionine Levels and Metabolism in Broiler Chickens. Animals 2023, 13, 1961. https://doi.org/10.3390/ani13121961
Maynard CW, Gilbert E, Yan F, Cline MA, Dridi S. Peripheral and Central Impact of Methionine Source and Level on Growth Performance, Circulating Methionine Levels and Metabolism in Broiler Chickens. Animals. 2023; 13(12):1961. https://doi.org/10.3390/ani13121961
Chicago/Turabian StyleMaynard, Craig W., Elizabeth Gilbert, Frances Yan, Mark A. Cline, and Sami Dridi. 2023. "Peripheral and Central Impact of Methionine Source and Level on Growth Performance, Circulating Methionine Levels and Metabolism in Broiler Chickens" Animals 13, no. 12: 1961. https://doi.org/10.3390/ani13121961